Abstract
Scorpions are predator arachnids of ancient origin and worldwide distribution. Two scorpion species, Vaejovis smithi and Centruroides limpidus, were found to harbor two different Mollicutes phylotypes: a Scorpion Mycoplasma Clade (SMC) and Scorpion Group 1 (SG1). Here we investigated, using a targeted gene sequencing strategy, whether these Mollicutes were present in 23 scorpion morphospecies belonging to the Vaejovidae, Carboctonidae, Euscorpiidae, Diplocentridae, and Buthidae families. Our results revealed that SMC is found in a species-specific association with Vaejovidae and Buthidae, whereas SG1 is uniquely found in Vaejovidae. SMC and SG1 co-occur only in Vaejovis smithi where 43% of the individuals host both phylotypes. A phylogenetic analysis of Mollicutes 16S rRNA showed that SMC and SG1 constitute well-delineated phylotypes. Additionally, we found that SMC and scorpion phylogenies are significantly congruent, supporting the observation that a cospeciation process may have occurred. This study highlights the phylogenetic diversity of the scorpion associated Mollicutes through different species revealing a possible cospeciation pattern.
Introduction
Many animals possess symbiotic bacteria of mutualistic nature [1]. They have different physiological roles in their hosts, including nutrient uptake and synthesis [2,3] and participate in digestion [4], reproduction [5,6], immune system maturation [7], toxin degradation [8,9], toxin production for prey killing [10], and suppression of other symbionts [11]. In addition, bacterial symbionts offer protection against natural enemies such as pathogenic fungi [12,13], viruses [14], predators [15], parasitoids [16–18], and parasitic nematodes [19]. In some insects such as termites, bark beetles and in the carmine cochineals there are nitrogen-fixing bacteria that compensate low nitrogen diets [20–22].
If mutualistic symbiosis is beneficial for both organisms, transmission of bacterial symbionts to further generations emerges as a mechanism to preserve the advantages of the relationship [23]. Vertical transmission in long evolutionary periods can lead to a cospeciation process [24]. Cospeciation is commonly observed between insects and their bacterial endosymbionts, especially for obligate primary endosymbionts harbored in specialized bacteriocyte cells [25,26]. Cospeciation has been described in many insects of the Hemiptera order [27–36]. However, cospeciation in insects is not limited to bacteriocyte endosymbionts; some gut bacteria can be vertically transmitted and cospeciate with their hosts through different post-hatch mechanisms such as egg smearing, coprophagy, or symbiont capsules [37–39].
Scorpions (Arachnida) are ancient animals that have colonized almost all major landscapes on Earth. They have conserved ancestral anatomical features since terrestrial colonization; these are a clear differentiated metasoma (tail) and mesosoma (body), chelate pedipalps, chelicerae, pectins, and a terminal telson [40]. To date, over 2300 scorpion species have been described worldwide [41,42].
Although bacterial symbionts are recognized as major drivers of evolution in arthropods [43], interactions between scorpions and bacteria have only rarely been studied. Presence of Wolbachia has been reported in species from the genus Opistophthalmus (Scorpionidae, [44]), Tityus (Buthidae, [45]), and Hemiscorpius (Hemiscorpiidae, [46]). Notably, prevalent arachnid and insect symbionts such as Cardinium, Rickettsia, Spiroplasma, and Wolbachia were undetected with canonical primers in a collection of 40 Vaejovidae scorpion species [47].
Gut bacterial phylotypes of the scorpion species Centruroides limpidus and Vaejovis smithi represent novel lineages belonging to the Mollicutes. Among these novel lineages, Scorpion Group 1 (SG1) is present with high frequency in V. smithi, but absent in C. limpidus specimens. SG1 16S rRNA sequence had 79% identity to Spiroplasma lampyridicola. Furthermore, two other closely related Mycoplasma-like lineages were found in high frequencies in each of these scorpion species; with 16S rRNA gene sequences 89% and 88% identical to Mycoplasma hyorhinis. These lineages form a well-delineated clade within the Mollicutes named Scorpion Mycoplasma clade (SMC) [48]. The species-specificity, phylogenetic relationship of SMC lineages within their clade and the recent discovery of Mollicutes in the African scorpion Androctonus australis [49], that according to our phylogenetic analysis would correspond to the SMC clade, suggest that this clade might have undergone a cospeciation process with their hosts.
In this study, we expanded the scorpion-symbiont survey to 23 morphospecies belonging to seven genera and five families collected in Central and Southern Mexico. DNA was extracted from gut tissue and screened using Polymerase Chain Reaction (PCR) with specific primers targeting the scorpion Mollicutes. Scorpion gene markers were amplified and sequenced to confirm the taxonomic assignments. Additionally, scorpion and SMC phylogenetic reconstructions were tested to determine whether the topologies reveal cospeciation associations. Here we show that the novel Mollicutes lineages are found as symbionts of a broad group of scorpion species from different locations and habitats. Furthermore, SMC and scorpion phylogenies are significantly congruent, suggesting these organisms have probably undergone a cospeciation process.
Materials and methods
Sample collection and DNA extraction
Thirty-nine scorpions were collected from different locations in Mexico (Fig 1 and Table 1) during August and September 2015. Sampling conducted in Cuernavaca locality was done in private land under owner’s permission. The rest of the collection was donated from several parties (see Acknowledgments), specifically from other ongoing scorpion projects conducted in Mexico. These specimens have been collected under permits issued by SEMARNAT (SGPA/DGVS/02483 of March 18, 2005) and Scientific Permit FAUT-0175 to Oscar Francke (extended to Carlos Santibáñez from 2014 to 2016). None of the scorpion species analysed in this study are listed as endangered or protected in the Convention on Trade in Endangered Species of Wild Fauna and Flora (CITES). Ethics approval is not required for arachnid-related experimentation. Rock and log rolling was the method to spot the scorpions, thereafter were captured using tweezers and placed in closed containers. The specimens belonged to 23 morphospecies from seven genera and five families. Species identification was based on key morphological characters reported in several scorpion taxonomy studies, using a light stereo microscope; higher genus classification followed Sharma et al. [50]. When not clearly assigned to a species, scorpions were identified as “similar to” (affinis or aff.) the closest morphologically similar species. The mitochondrial 16S rRNA and cytochrome c oxidase subunit 1 (CO1) and the nuclear 28S rRNA scorpion gene sequence analysis confirmed most of the assignments. Due to the diversity and lack of information regarding the starvation stress tolerance for each species, scorpions were processed directly from the field.
Fig 1. Sampling sites of scorpions in Mexico.
Map of Mexico showing the sampling locations, number of individuals and percentage of the different genera collected. Pie chart centres are positioned over the sampling locations. The size of the pie charts corresponds to the number of total individuals collected and colors represent the proportions of the different genera sampled.
Table 1. GenBank accession numbers of the DNA sequences obtained by PCR with specific primers for SMC and SG1 (16S rRNA), scorpion mitochondrial gene markers (16S rRNA and CO1) and scorpion nuclear gene marker 28S rRNA.
| ID | Species | Sex | Collection site | SMC 16S rRNA |
SG1 16S rRNA |
Scorpion 16S rRNA |
Scorpion CO1 |
Scorpion 28S rRNA |
|---|---|---|---|---|---|---|---|---|
| A9 | Vaejovis smithi | M | Cuernavaca, Morelos | X | MF134724 | MF134669 | MF134771 | MF134737 |
| A11 | Vaejovis smithi | ND | Cuernavaca, Morelos | X | MF134725 | MF134673 | MF134772 | MF134738 |
| A3 | Vaejovis smithi | F | Cuernavaca, Morelos | X | MF134726 | MF134670 | MF134773 | MF134734 |
| A5 | Vaejovis smithi | F | Cuernavaca, Morelos | X | MF134727 | – | – | – |
| A6 | Vaejovis smithi | F | Cuernavaca, Morelos | MF134708 | MF134728 | MF134674 | MF134774 | MF134735 |
| A7 | Vaejovis smithi | F | Cuernavaca, Morelos | MF134709 | MF134729 | MF134671 | MF134775 | MF134736 |
| A19 | Vaejovis smithi | ND | Cuernavaca, Morelos | MF134710 | MF134730 | MF134672 | MF134776 | X |
| A32 | Vaejovis granulatus | M | Cuernavaca, Morelos | X | MF134731 | MF134675 | MF134777 | MF134739 |
| A4 | Mesomexovis aff. punctatus | F | Tepeyehualco, Puebla | MF134712 | X | MF134678 | MF134782 | MF134740 |
| A23 | Mesomexovis aff. punctatus | M | Tepeyehualco, Puebla | MF134711 | X | MF134676 | MF134784 | MF134743 |
| A20 | Mesomexovis aff. punctatus | F | León, Guanajuato | X | MF134722* | MF134681 | MF134786 | MF134744 |
| A34 | Mesomexovis aff. punctatus | F | Cuernavaca, Morelos | X | MF134723 | MF134682 | MF134785 | MF134745 |
| A17 | Mesomexovis aff. subcristatus | F | Zapotitlán, Puebla | X | X | MF134679 | MF134779 | MF134746 |
| A26 | Mesomexovis aff. subcristatus | ND | Zapotitlán, Puebla | X | X | MF134677 | MF134780 | MF134747 |
| A36 | Mesomexovis aff. subcristatus | ND | Zapotitlán, Puebla | X | – | MF134680 | MF134781 | MF134748 |
| A38 | Mesomexovis aff. oaxaca | F | Huajuapam, Oaxaca | X | MF134732 | MF134683 | MF134783 | MF134741 |
| A39 | Mesomexovis aff. oaxaca | F | Huajuapam, Oaxaca | X | – | MF134684 | X | MF134742 |
| A18 | Thorellius intrepidus | F | Tecomán, Colima | X | X | MF134685 | MF134778 | MF134756 |
| A43 | Hoffmannihadrurus aztecus | F | Zapotitlán, Puebla | X | X | MF134686 | MF134787 | MF134749 |
| A42 | Megacormus gertschi | F | Zacualtipan, Hidalgo | X | X | MF134687 | MF134805 | MF134750 |
| A46 | Megacormus gertschi | M | Zacualtipan, Hidalgo | X | X | MF134688 | MF134806 | MF134751 |
| A44 | Diplocentrus duende | F | Zapotitlán, Puebla | X | MF134733 ** | MF134706 | X | MF134755 |
| A40 | Diplocentrus tehuano | F | Santo Domingo Tehuantepec, Oaxaca | X | X | MF134705 | MF134788 | MF134752 |
| A13 | Diplocentrus mexicanus | M | San Juan Atepec, Oaxaca | X | X | MF134704 | MF134789 | MF134753 |
| A22 | Diplocentrus melici | ND | Idolos, Veracruz | X | X | MF134703 | MF134790 | MF134754 |
| A16 | Centruroides baergi | F | Zapotitlán, Puebla | MF134713 | X | MF134701 | MF134793 | MF134764 |
| A47 | Centruroides baergi | F | Zapotitlán, Puebla | X | – | MF134702 | MF134794 | X |
| A2 | Centruroides limpidus | M | Cuernavaca, Morelos | KM978315 | X | MF134690 | MF134791 | MF134760 |
| A12 | Centruroides elegans | M | Emiliano Zapata, Jalisco | MF134714 | X | MF134691 | MF134792 | MF134762 |
| A14 | Centruroides hoffmanni | F | Tehuantepec, Oaxaca | X | X | MF134692 | MF134795 | MF134761 |
| A24 | Centruroides noxius | M | Pantanal, Nayarit | MF134715 | X | MF134698 | MF134796 | MF134767 |
| A28 | Centruroides noxius | F | Pantanal, Nayarit | MF134716* | – | MF134699 | MF134797 | MF134768 |
| A15 | Centruroides infamatus | F | Guanajuato, Guanajuato | X | X | MF134694 | MF134798 | MF134763 |
| A29 | Centruroides tecomanus | M | Comalá, Colima | MF134717 | – | MF134696 | MF134800 | MF134758 |
| A25 | Centruroides tecomanus | M | Comalá, Colima | MF134718 | X | MF134695 | MF134799 | MF134757 |
| A30 | Centruroides flavopictus | F | Xalapa, Veracruz | MF134719 | X | MF134700 | MF134804 | MF134769 |
| A37 | Centruroides fulvipes | M | Puerto Escondido, Oaxaca | X | X | MF134693 | MF134803 | MF134765 |
| A10 | Centruroides gracilis | M | Tuxtepec, Oaxaca | MF134720 | X | MF134689 | MF134801 | MF134759 |
| A41 | Centruroides nigrimanus | M | Oaxaca, Oaxaca | MF134721 | X | MF134697 | MF134802 | MF134766 |
| Avi | Mastigoproctus sp. | ND | Cuernavaca, Morelos | X | MF774367 ** | MF134707 | MF134807 | MF134770 |
M, male; F, female; ND, not determined; X, unamplified sequence; – PCR was not performed
* identical sequences obtained from scorpion gut and embryos
** these sequences do not correspond to SG1, but to other spiroplasmas (S1 Fig).
Scorpions were anesthetized by placing them in sealed containers with chloroform and their sex was determined. The exoskeleton surface was disinfected with three rinse cycles of 70% ethanol. Midgut and hindgut (including Malpighian tubules) dissections were performed using a stereoscope, sterile tweezers and scalpel. Occasionally, when pregnant females were dissected, embryos were collected and washed five times with sterile water. DNA was extracted from a pool of embryos from each female. One leg and hemolymph from each specimen were also used for DNA extraction. One leg and the gut of a vinegaroon Mastigoproctus sp. were dissected as well.
Dissected tissues were placed in 180 μl of buffer ATL (Qiagen, Valencia, CA). The tissue was macerated with a sterile polypropylene micro pestle to achieve a homogenous solution. DNA extractions were performed using the DNeasy Blood & Tissue kit (Qiagen, Valencia, CA) according to the manufacturer’s recommendations. DNA quality check was performed on 1% agarose gels (90 V, 35 min) and measured with a Nanodrop spectrophotometer (Thermo-Fischer Scientific, Wilmington, DE).
SMC and SG1 primer design
Primers were designed using OLIGO 7 primer analysis software [51], based on the alignment of SMC and SG1 with Mycoplasma and Spiroplasma 16S rRNA sequences. The alignment included: 47 representative mycoplasmas and spiroplasmas, 13 sequences obtained from two clone libraries representing SMC from V. smithi and C. limpidus (GenBank accession numbers MG813912-MG813923), and the 31 representative SMC and SG1 sequences reported in Bolaños et al. [48]. The alignment corresponds to positions ~37 through 1450 in the E. coli 16S rRNA sequence. Three primer pairs were chosen: one pair for SMC and two for SG1. The Myco65F and Myco1429R primers have two degenerated positions each, representing variable positions in SMC and mycoplasma sequences; this allowed a certain level of flexibility between different scorpion species. Given that SG1 had only one representative species, we designed two primer pairs to increase the probability of detecting it.
Two sets of primers targeting the rpoB gene of SMC and SG1 (S1 Table) were designed with OLIGO 7 based on annotated sequences from V. smithi and C. limpidus metagenomes [48] and Mollicutes sequences retrieved from NCBI GenBank
Polymerase Chain Reaction (PCR) amplifications
DNA extracted from guts, embryos, and hemolymph was used as template for PCR amplification of bacterial 16S rRNA genes. Symbiont targeted PCR amplifications were done with the set of custom primers (Table 2). Mitochondrial (16S rRNA and CO1) and nuclear (28S rRNA) scorpion gene markers were amplified using DNA extracted from one leg as template (Table 2).
Table 2. Primers used for PCR amplification.
| Primer name (alias) | Sequence (5’ – 3’) | Gene | PCR size (pb) | Annealing temperature (°C) | Extension time | Reference |
|---|---|---|---|---|---|---|
| 16Sar (LR-N-13398) | CGCCTGTTTATCAAAAACAT | Invertebrate 16S rRNA | 490 | 47 | 1:00 | Simon et al., 1994 [52] |
| 16Sbr (LR-J-12887) | CTCCGGTTTGAACTCAGATCA | Invertebrate 16S rRNA | 490 | 47 | 1:00 | Simon et al., 1994 [52] |
| HCO (HCO2198-N-2175) | TAAACTTCAGGGTGACCAAAAAATCA | Invertebrate cytochrome oxidase I | 700 | 43 | 1:00 | Folmer et al., 1994 [53] |
| LCO (LCO-1490-J-1514) | GGTCAACAAATCATAAAGATATTGG | Invertebrate cytochrome oxidase I | 700 | 43 | 1:00 | Folmer et al., 1994 [53] |
| 28Sa (D3A) | GACCCGTCTTGAAACACGGA | Invertebrate 28S rRNA | 330 | 50 | 1:00 | Nunn et al., 1996 [54] |
| 28Sb (D3B) | TCGGAAGGAACCAGCTACTA | Invertebrate 28S rRNA | 330 | 50 | 1:00 | Nunn et al., 1996 [54] |
| Myco65F | CRAAYGGGTGAGTAACACGTA | SMC 16S rRNA | 1397 | 54 | 1:45 | This study |
| Myco1429R | ASGGYTACCTTGTTACGACTT | SMC 16S rRNA | 1397 | 54 | 1:45 | This study |
| SG1-46F | ACATGCAAGTTGAACGGGAAG | SG1 16S rRNA | 1305 | 54 | 1:45 | This study |
| SG1-1406R | ATTCACCGCAACGTGGCTGAT | SG1 16S rRNA | 1305 | 54 | 1:45 | This study |
| SG1F | ACCTAACCTGCCTATATATC | SG1 16S rRNA | 1069 | 54 | 1:45 | This study |
| SG1R | TTTGTCATCATCCTTTCCTC | SG1 16S rRNA | 1069 | 54 | 1:45 | This study |
Final concentrations for 20 μl PCR reactions were as follows: 1 μl DNA (25 ng μl−1), 0.2 nM of each primer, 0.2 mM dNTPs, 0.5 U of Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA), 1X Taq polymerase buffer and 1.5 mM MgCl. The reaction conditions were 94°C for 5 minutes, 30 cycles at 94°C for 1 minute, annealing for 1 minute (see Table 2 for temperatures specific to each primer set), and a final extension at 72°C for 10 minutes. PCR products were observed on 1% agarose gels (90 V, 40 min). Sanger sequencing of correct size amplicons was performed by Macrogen Inc. (Seoul, South Korea). The nucleotide sequences determined in this study have been deposited in GenBank database with accession numbers shown in Table 1, except for rpoB sequences which are found in supplementary material (S1 Fasta file).
Mollicutes phylogenetic analyses
We created a Mollicutes phylogenetic tree with the novel scorpion gut bacteria sequences generated from this study aligned with a set of 16S rRNA gene sequences retrieved from the Ribosomal Database Project (RDP) release 11 [55] and the Silva Database release 128 [56]. The retrieved RDP sequences were type strains, environmental sequences and new sequenced Mollicutes that do not cluster with any of the defined groups, each longer than 1200 bp. Additionally, we used the sequences with GenBank accession numbers KT923413 and KT923388 from the NCBI database. These two sequences represented a Spiroplasma-related bacteria and a Mycoplasma from Androctonus australis, respectively [49]. Sequences were aligned using Mafft 7.397 [57] considering secondary structure. JModelTest 2.1.10 [58] was used to determine the best model to fit the data set. The final alignment consisted of 237 sequences. The Mollicutes phylogenetic tree was constructed on RAXML 8.2.4 [59] using maximum likelihood and the GTR + G model of evolution with 1000 bootstrap replicates; 1069 bases were used for the analysis. The Mollicutes phylogenetic tree was visualized and edited with MEGA7 [60].
A Mollicutes phylogenetic tree based on rpoB sequences was constructed with a dataset of 161 sequences retrieved from GenBank. Translation from nucleotide to amino acid sequences was done using the genetic code 4 for Mycoplasmataceae. The phylogenetic tree was constructed in PhyML using LG + G + I as model of evolution with 1000 bootstrap replicates; 282 amino acids were used for the analysis. The tree was visualized and edited with MEGA7.
Scorpion phylogenetic analysis
A scorpion phylogenetic tree was constructed with the three concatenated sequences (16S rRNA, CO1 and 28S rRNA). A. australis sequences retrieved from GenBank were also included. Sequences were aligned with Clustal W [61]. Only one representative sequence from each scorpion species was included. The tree was constructed and edited with MEGA7 [60], using maximum likelihood and the GTR + G + I model of evolution with 1000 bootstrap replicates; 1209 bases were used for the analysis. Phylogenetic trees with ML were also constructed with each individual gene, using the models suggested by JModelTest 2.1.10. These were T92 + G, GTR + G + I, and HKY for 16S rRNA, CO1 and 28S rRNA, respectively. The tree constructed with the three concatenated genes was selected, given that the phylogeny had a similar topology to both 16S rRNA and CO1. The similarity to the 28S rRNA phylogeny was not considered because this gene by itself does not reflect the phylogenetic relationships of the species, given its high evolutionary conservation.
The Bayesian Inference analyses of the three matrices were performed using MrBayes 3.2.2 [62] and the GTR + G + I model for each partition (16S rRNA, 28S rRNA, and CO1). Four runs each with four Markov chains were implemented for 1 X 107 generations (10 million), using default priors and discarding 2.5 x 106 generations (25%) as burn-in.
Cophylogenetic analyses
To study the evolutionary associations between SMC and scorpions, we used the maximum likelihood tree topologies obtained from Mollicutes 16S rRNA gene and the three scorpion genes. We used the reconciliation tool Jane 4 [63], which requires costs for five events that can describe host-parasite (or host-symbiont) cophylogenies: cospeciation (joint speciation with the host lineage); duplication (both symbionts are kept in the same host); duplication and host switch (symbionts are duplicated and transferred from one host species to another); losses (loss of symbiont); and failure to diverge. We used the following cost ranges: cospeciation, 0-1; duplication, 1-2; duplication and host switch, 1-2; losses, 1-2; and failure to diverge, 1-2. We used different host ranges in order that Jane computed solutions for every combination of costs. Given that Jane 4 does not consider bootstrap values, nodes lacking substantial support were collapsed, with a cut-off bootstrap value of 50%, so that only nodes with bootstraps greater than 50% were considered for the analysis. Collapsed phylogenies that had been obtained with the different models recreated the same topology. To estimate whether the reconstruction results are different from those expected by chance a thousand random cycles were performed. It must be noted that in the case of C. limpidus, the scorpion sequences and the SMC sequence were obtained from different specimens, although both were collected at the same location (Cuernavaca, Morelos).
Genetic and geographic distances similarity analysis
The relationship between geographical localization and positive SMC amplicon was tested using two distance matrices. The first distance matrix was created with the linear distances in kilometers between the different sampling locations. The second was a presence/absence matrix, in which we assigned a value of 0.01 when two samples amplified SMC and 0.99 when just one or none of them were positive for SMC, reflecting the shortest and longest possible distances.
The relationship between geographical localization and genetic distance of scorpions or SMC was tested using the subset of geographical distances in kilometers for SMC positive scorpions. The Kimura 2-parameter genetic distance matrix for scorpions was done with the dnadist program of Phylip package version 3.695 [64]. Distances were calculated using the concatenated alignment of CO1 and 16S rRNA genes. 28S rRNA was excluded from the concatenation due to the absence in one sample. The SMC genetic distance matrix was obtained using the aligned 16S rRNA sequences following the same strategy described for the scorpion genes.
Euclidean distance matrices were calculated with the dist function in R for every matrix. Mantel tests were performed with the mantel command of Vegan package version 2.4-5 [65] for the following pairwise comparisons: geographical distances - SMC presence/absence; geographical distances - scorpion genetic distances; geographical distances - SMC genetic distances; and scorpion - SMC genetic distances.
Results
Scorpion Mycoplasma clade (SMC) bacteria frequently present in Vaejovidae and Buthidae species, SG1 constrained to Vaejovidae
Thirty-nine scorpions belonging to five families, seven genera and 23 morphospecies were sampled and evaluated by PCR for the presence of the recently discovered Mollicutes SMC and SG1 (Table 1), using specific primers. Mollicutes were found in the guts of eight Centruroides, four Mesomexovis, two Vaejovis, and one Diplocentrus species. SMC amplicons were obtained from Vaejovis smithi and Centruroides limpidus as previously reported [48]. Moreover, SG1 was also found in Mesomexovis aff. punctatus and eight Centruroides species. SG1 was found in V. smithi as previously reported [48], and in the species M. aff. punctatus and Vaejovis granulatus. SG1 could not be detected in any Centruroides spp.
In 43% of V. smithi scorpions, both SMC and SG1 were found in the same specimen. These frequencies are similar to those previously reported with universal 16S rRNA primers [48]. This was not observed in the Mesomexovis species sampled, as they had either SMC or SG1. SMC was detected in two specimens of M. aff. punctatus (A4 and A23), and SG1 in other two (A20 and A34). SMC and SG1 were not detected in M. aff. subcristatus, and SG1 was detected in M. aff. oaxaca.
SMC and SG1 were not detected in Diplocentrus spp. We could only amplify a PCR product from one species, Diplocentrus duende (A44) with the SG1 primers, but this sequence corresponds to a canonical spiroplasma from the Citri-Chrysopicola-Mirum clade rather than to SG1 (Table 1 and S1 Fig). No PCR amplification products were obtained from Thorellius intrepidus, Hoffmannihadrurus aztecus, and Megacormus gertschi using either the SMC or SG1 primers. There is no clear pattern suggesting a sex-bias in the presence of these bacteria in scorpions (Table 1). DNA extracted from scorpion’s hemolymph did not amplify any of the two Mollicutes symbionts. Overall, 16S rRNA primers used in this study had low frequency of false positives. Only five non–targeted sequences were obtained from the whole set of reactions (S2 Table).
SMC rpoB sequences were amplified from five samples from two species, in three V. smithi specimens and two Mesomexovis aff. punctatus. Additionally, SG1 rpoB sequences were obtained from three V. smithi specimens and two Mesomexovis aff. punctatus as well. Amplifications were positive in samples where previously 16S rRNA amplicons of the targeted bacteria were obtained, confirming the presence of the symbionts.
16S rRNA phylogeny supported the designation of the novel Scorpion Mycoplasma Clade (SMC) and SG1 clade
A 16S rRNA phylogenetic tree was constructed using 237 sequences from Mollicutes consisting of the major taxonomic clades including novel SMC, SG1 and scorpion-spiroplasma related sequences (Fig 2 and S1 Fig). SG1 and one of the symbionts from the freshwater snail Biomphalaria glabrata seem to form a clade basal to the Entomoplasmatales group. Previously, it was reported that C. limpidus also harbors a Spiroplasma related sequence named OTU4 (KM978318, [48]). This sequence was found in around 30% of C. limpidus individuals and is 88% similar to Spiroplasma platyhelix. It is positioned as a clade within the Entomoplasmatales group, along with a sequence amplified from a vinegaroon (Mastigoproctus sp.). Some of the nodes related to these sequences are not well supported (bootstrap values <40), reflecting the divergence between them and the rest of the dataset. It has been challenging to determine the position of SG1 lineage due to the lack of related sequences.
Fig 2. Mollicutes 16S rRNA phylogenetic tree.
A phylogenetic tree was constructed with maximum likelihood and the GTR + G model using 237 sequences representing different species and the new lineages found in scorpions. Streptococcus pneumoniae, Bacillus subtilis and Bacillus cereus were used as outgroups. Bootstrap values above 60 are shown. Representative Mollicutes clades were collapsed (See S1 Fig for the non-collapsed tree).
SMC is related to the Mycoplasma Hominis group and sequences within this clade form two major sister subclades. The first one is composed of sequences amplified from scorpions belonging to the Vaejovidae family (genera Mesomexovis and Vaejovis). The second clade is composed of sequences obtained from scorpions belonging to the Buthidae family (genus Centruroides and Androctonus). SMC sequences derived from the genus Centruroides form a compact clade, and the sequence derived from A. australis is positioned as a basal group.
Unrelated to the SG1 lineage, the sequence obtained from Diplocentrus duende (A44) has a 99% identity with Spiroplasma leucomae. Also, A. australis has a sequence related to the genus Spiroplasma (GenBank KT923385). Both sequences are grouped within the canonical Citri-Chrysopicola-Mirum clade and are 99% identical to each other (S1 Fig).
A rpoB phylogenetic tree constructed using sequences amplified from V. smithi and Mesomexovis aff. punctatus showed SMC embedded within the Hominis group, not as a sister clade of it. SG1 rpoB was placed as a sister lineage of the Pulmonis group (S2 Fig).
Congruence analysis of SMC 16S rRNA and scorpion phylogenies
The scorpion phylogenetic trees recovered from the analysis of 16S rRNA, CO1, and 28S rRNA gene sequences based on Bayesian Inference and Maximum likelihood showed congruence with previously published phylogenies (e.g. [49]; Fig 3A, S2 and S3 Figs). For instance, the presence of both currently recognized parvorders (Iurida and Buthida) was recovered in our phylogeny. Moreover, scorpions of the three families Vaejovidae, Carboctonidae and Euscorpiidae form a clade and configure superfamily Chactoidea. Within Vaejovidae, the specimens classified as Mesomexovis aff punctatus, branched independently in different positions suggesting being three species instead of a monophyletic group representing one species. Diplocentridae is representative of the superfamily Scorpionoidea. These two superfamilies are representatives of parvorder Iurida. Family Buthidae was monophyletic and is representative of parvorder Buthida. Remarkably, the distinct species of genus Centruroides used in this study, were recovered in two clades, in agreement with their morphological characterization (“striped group” and “gracilis group” sensu [66]).
Fig 3. Comparison of scorpion and symbiont phylogenies.
Different colors were used for each genus or clade: dark blue, Vaejovis; light blue, Mesomexovis; dark green, Thorellius; light green, Hoffmanihadrurus; purple, Megacormus; pink, Diplocentrus; red, Centruroides, “striped group”; yellow, Centruroides, “gracilis group”; brown, Androctonus; black, outgroups (Mastigoproctus sp. or Mycoplasma hyorhinis). (A) Scorpion phylogeny with concatenated 16S rRNA, CO1 and 28S rRNA genes (GTR + G + I). (B) SMC 16S rRNA gene phylogeny (GTR + G). (C) SG1 16S rRNA gene phylogeny (GTR + G).
The SMC 16S rRNA phylogeny from Vaejovidae and Buthidae mimics the scorpion phylogeny (Fig 3 and S2 Fig). The phylogenies of scorpion and SG1 showed a similar “mirror” pattern (Fig 3), but the low number of positive species limited a statistical cospeciation analysis, which could be performed with the SMC phylogeny. Some nodes of the SMC 16S rRNA gene phylogeny had very low bootstrap values and very short branches (Fig 3). Therefore, we decided to collapse nodes with 50% or lower bootstrap values, resulting in some polytomies that can be analysed with Jane 4 (Fig 4). This analysis showed several possible cophylogenies, all of which suggested cospeciation in all the nodes (Fig 5). No other evolutionary events such as host-switches, losses, duplications or failure to diverge were revealed by Jane. We performed random reconstructions and compared the total cost values. Of a total of 1000 randomizations, 99.5% had a total cost value higher than that of our predicted results, suggesting that the reconstructions obtained may not be attributed to randomness.
Fig 4. Tanglegrams of host species and SMC phylogenies used for cophylogenetic analyses.
Scorpion phylogeny (left) constructed with concatenated 16S rRNA, CO1 and 28S rRNA genes, and SMC phylogeny (right) with 16S rRNA. Nodes with bootstrap values lower than 50% were collapsed. Colors are as in Fig 3.
Fig 5. Cophylogenetic reconstruction of scorpion hosts and their SMC symbionts obtained with Jane 4.
The individual phylogenies were constructed and inferred as in Fig 3. Black branches delineate the scorpion phylogeny. Blue branches represent SMC phylogeny. The polytomies formed after collapsing nodes with bootstrap values lower than 50% are shown in purple. Red circles outlined at the nodes indicate suggested cospeciation events.
To explore the alternative hypothesis that the pattern of SMC presence and distribution might not be entirely explained by cospeciation, we tested whether the location and geographical distance between collection localities were biasing our results. Linear geographical distances between collection sites did not correlate with the positive SMC amplifications (Mantel rho = 0.04999, p= 0.279). This means that there is no specific geographical region more prone to be inhabited by scorpions with SMC. Linear distances did not show a significant correlation with scorpion genetic distances (Mantel rho = 0.3873, p = 0.006), as we can find different species cohabiting single regions. Additionally, SMC genetic distances did not correlate with linear distances either (Mantel rho = 0.3506, p = 0.021). However, genetic distances between SMC and scorpions do have a significant correlation (Mantel statistic r: 0.9478 significance: 0.001). This evidence suggests that closely genetically related scorpions will host closely related SMC and vice versa, as expected under the cospeciation hypothesis.
DNA from embryos of different scorpion species was also used as a template for PCR amplifications. SG1 was amplified from gut and embryos in one female M. aff. punctatus (A20). Regarding SMC, we amplified it from gut and embryos in a female C. noxius (A28) (Table 1). These results indicate a probable transmission of the symbionts to the embryos; however, it remains unclear whether the bacteria are found inside the embryos or over them.
Discussion
Two scorpion species, C. limpidus and V. smithi, were previously found to harbor a Mycoplasma novel clade (SMC) and a novel Mollicutes (SG1) restricted to V. smithi [48]. In this study, a more extensive scorpion sampling approach was used to explore whether the Mollicutes bacteria extend to other scorpion species. A total of 23 scorpion morphospecies belonging to five families were sampled.
SMC was present in some specimens from Vaejovidae and Buthidae families, and SG1 was found only in Vaejovidae (all Vaejovis individuals and two out of three Mesomexovis species). The Citri-Chrysopicola-Mirum Spiroplasma sequences that were found in scorpions (from Diplocentrus duende A44 and Androctonus australis) were related to common insect symbionts [67] and their high identities suggest recent horizontal acquisition.
SMC lineages in the Mollicutes tree mirrored the scorpion phylogeny which indicated a possible cospeciation processes. Although some external nodes of the Mollicutes tree had low bootstrap support value when SMC sequences were included, scorpion Mycoplasma clustering within the clade is stable and highly supported. The phylogenetic tree constructed with the rpoB gene shifted the SMC position to the Hominis group. A recent phylogenomic Mollicutes reconstruction using SMC genomic sequences recovered from Centruroides vitattus and Centruroides sculpturatus placed SMC within the Hominis group [68]. A more accurate phylogenetic position of SMC will be achieved as more sequences become available.
Jane cophylogeny analyses supported the possibility of cospeciation between SMC and scorpions. The suggested cospeciation events indicate that SMC is an ancient symbiont within scorpions. Additionally, Mantel tests showed that the presence of SMC did not correlate with geographic region, but with host genetic distances as expected with cospeciation. The most recent phylogenomic reconstruction of scorpions placed Buthidae in the parvorder Buthida and Vaejovidae in the parvorder Iurida [50]. Based on the chelicerate hemocyanins phylogeny, these parvorders seemingly separated ~120 million years ago [69–71]. If the first bacterial infection of SMC took place in the common ancestor of the two parvorders, the lack of bacterial gene amplifications in other scorpion families beyond Vaejovidae and Buthidae is intriguing and could be explained by primers biased to existing SMC 16S rRNA sequences, low bacterial abundances, or PCR inhibitors. Shotgun metagenomic sequencing of multiple species, including Vaejovidae and Buthidae, as well as an analysis of more specimens of each scorpion species will be needed to clearly determine the presence or absence of Mollicutes in other scorpions. Dissecting scorpions without any starving laboratory treatment could have precluded enrichment of SMC [48,72]. The low number of collected specimens belonging to Carboctonidae and Euscorpiidae led to inconclusive negative results for these groups.
Embryos of two scorpion species, M. aff. punctatus (A20) and C. noxius (A28), were positive for SG1 and SMC respectively, indicating that these symbionts are probably transmitted vertically. Vertical transmission would support the cospeciation mechanism, as has been reported for insects and their bacterial endosymbionts [24, 43].
Besides Arthropoda, vertical transmission of associated bacteria has also been observed in other invertebrates as in Porifera, Bivalvia, Ascidiacea, Bryozoa, Oligochaeta, Cephalopoda and Nematoda [1] and cospeciation has been suggested in some of them [73–76]. Some invertebrates may also present a mixed-mode of transmission (from the environment and maternally inherited) [1,77,78].
Pentatomomorpha insects have evolved post-hatch mechanisms to transmit their gut symbionts to the next generation [37]. It is known that mammals may pass their gut symbionts to neonates through breast milk [79] among other strategies; animals may do so also by trophallaxis (direct transfer of food or fluids from one individual to another), or coprophagy [77–83]. We do not know how scorpions may transmit their symbionts to their offspring. A recent study in Androctonus australis found that SMC was present in scorpion’s gonads adding evidence of a probable vertical transmission [49]. To further study the transmission of these bacteria, fluorescent in situ hybridization should be done.
Mollicutes is a bacterial class widely associated with plants, animals, and fungi [84–86]. Among Mollicutes, mycoplasmas have been primarily recognized as vertebrate pathogens or opportunistic organisms [87,88]. Spiroplasmas are commensals or pathogens in plants and insects [89]. Over the last years, novel Mollicutes lineages related to the Mycoplasma and Spiroplasma genera have been discovered in different invertebrate animals such as jellyfishes [90], and deep sea [91,92] and terrestrial isopods [93]. Many Mycoplasma and Spiroplasma species are considered fastidious bacteria due to their complex nutrient requirements [94].
Here we suggest that the SMC and SG1 symbionts are not generalists, since they are specifically found in their host species; we consider that they may be beneficial to scorpions. Although Mollicutes are not generally recognized as mutualist organisms, some examples have been described recently, in which they can provide benefits to their hosts by conferring protection against viruses [92,95] and parasites [96]. Additionally, the proportion of SMC increases in food-deprived scorpions compared to recently captured or laboratory-fed individuals [48], suggesting that these bacteria are not transient food-derived microbiota, but have a stable relationship with scorpions. An evolutionary process of cospeciation is suggested by a host-symbiont mirror phylogeny, as well as more in-depth cophylogenetic analyses. Importantly, these bacterial symbionts were found among a heterogeneous group of scorpion species, differing in geographical locations and ecomorphotypes (sensu [97]) along with intrinsic differences in physiologic traits (e.g. metabolic rates) and behavioural characteristics (e,g, feeding or burrowing) [97].
Bacterial symbionts have been recognized as important participants in the physiology, ecology, and evolution of arthropods [43]. Here we showed a broader species distribution of novel Mollicutes lineages in scorpions and a possible cospeciation process.
Supporting information
16S rRNA phylogeny of Mollicutes showing all sequences used for constructing the collapsed phylogeny in Fig 2.
(TIF)
rpoB gene phylogeney of Mollicutes showing all sequences except the scorpion groups SMC and SG1, which are shown collapsed.
(TIF)
Phylogenies described in Fig 3 reconstructed with Bayesian Inference. (A) Scorpion phylogeny with concatenated 16S rRNA, CO1 and 28S rRNA genes. (B) SMC 16S rRNA gene phylogeny. (C) SG1 16S rRNA gene phylogeny.
(TIF)
Phylogenies for each of the three marker genes performed with maximum likelihood. Substitution models used were T92 + G for 16S rRNA, GTR + G + I for CO1, and HKY for 28S rRNA. Colors for each genus or clade are as in Fig 3.
(TIF)
(DOCX)
(DOCX)
(FASTA)
Acknowledgments
AMI, AMA, CG, VM, and FG are students from the Undergraduate Program on Genomic Sciences at the National Autonomous University of Mexico (UNAM). We thank Lourival D. Possani for critical reviewing the manuscript and sample donation. We thank Oscar Francke and people from the visited localities for sample donations. Michael Dunn and Christopher Suffridge for proofreading the manuscript. Victor Higareda for providing scorpion photographs and Violeta Rodríguez for data entry assistance.
Data Availability
All gene sequences obtained in this study can be found in the GenBank (NCBI) repository under the accession numbers: MF134669-MF134807 and MF774367 and in the supplementary files.
Funding Statement
This research was supported by CONACyT Basic Science grant 253116 to EMR and Universidad Nacional Autónoma de México PAPIIT (UNAM) IN207718 to EMR. TGS is a doctoral student from the graduate program in Biomedical Sciences UNAM and received a fellowship (number 580519) from CONACYT. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Bright M, Bulgheresi S. A complex journey: transmission of microbial symbionts. Nat Rev Microbiol. 2010; 8(3):218 10.1038/nrmicro2262 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Engel P, Martinson VG, Moran NA. Functional diversity within the simple gut microbiota of the honey bee. Proc Natl Acad Sci U S A. 2012; 109(27):11002–7. 10.1073/pnas.1202970109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Salem H, Bauer E, Strauss AS, Vogel H, Marz M, Kaltenpoth M. Vitamin supplementation by gut symbionts ensures metabolic homeostasis in an insect host. Proc Biol Sci. 2014; 281(1796):20141838 10.1098/rspb.2014.1838 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Brune A, Ohkuma M. Role of the termite gut microbiota in symbiotic digestion In Biology of termites: a modern synthesis. Dordrecht: Springer; 2010. 439-475 p. [Google Scholar]
- 5.Werren JH, Baldo L, Clark ME. Wolbachia: master manipulators of invertebrate biology. Nat Rev Microbiol. 2008; 6(10):741 10.1038/nrmicro1969 [DOI] [PubMed] [Google Scholar]
- 6.Sharon G, Segal D, Ringo JM, Hefetz A, Zilber-Rosenberg I, Rosenberg E. Commensal bacteria play a role in mating preference of Drosophila melanogaster. Proc Natl Acad Sci U S A. 2012; 109(22):8618–22. 10.1073/pnas.1200231109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Guo L, Karpac J, Tran SL, Jasper H. PGRP-SC2 promotes gut immune homeostasis to limit commensal dysbiosis and extend lifespan. Cell. 2014; 156(1-2):109–22. 10.1016/j.cell.2013.12.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Kikuchi Y, Hayatsu M, Hosokawa T, Nagayama A, Tago K, Fukatsu T. Symbiont-mediated insecticide resistance. Proc Natl Acad Sci U S A. 2012; 109(22):8618–22. 10.1073/pnas.1200231109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Ceja-Navarro JA, Vega FE, Karaoz U, Hao Z, Jenkins S, Lim HC, et al. Gut microbiota mediate caffeine detoxification in the primary insect pest of coffee. Nat Commun. 2015; 6:7618 10.1038/ncomms8618 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Nishiwaki H, Nakashima K, Ishida C, Kawamura T, Matsuda K. Cloning, functional characterization, and mode of action of a novel insecticidal pore-forming toxin, sphaericolysin, produced by Bacillus sphaericus. Appl Environ Microbiol. 2007; 73(10):3404–11. 10.1128/AEM.00021-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Goto S, Anbutsu H, Fukatsu T. Asymmetrical interactions between Wolbachia and Spiroplasma endosymbionts coexisting in the same insect host. Appl Environ Microbiol. 2006; 72(7):4805–10. 10.1128/AEM.00416-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Kaltenpoth M, Göttler W, Herzner G, Strohm E. Symbiotic bacteria protect wasp larvae from fungal infestation. Curr Biol. 2005; 15(5):475–9. 10.1016/j.cub.2004.12.084 [DOI] [PubMed] [Google Scholar]
- 13.Łukasik P, van Asch M, Guo H, Ferrari J, Godfray CJ. Unrelated facultative endosymbionts protect aphids against a fungal pathogen. Ecol Lett. 2013; 16(2):214–8. 10.1111/ele.12031 [DOI] [PubMed] [Google Scholar]
- 14.Teixeira L, Ferreira Á, Ashburner M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. PLoS Biol. 2008; 6(12):e1000002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Kellner RL, Dettner K. Differential efficacy of toxic pederin in deterring potential arthropod predators of Paederus (Coleoptera: Staphylinidae) offspring. Oecologia. 1996; 107(3):293–300. 10.1007/BF00328445 [DOI] [PubMed] [Google Scholar]
- 16.Oliver KM, Russell JA, Moran NA, Hunter MS. Facultative bacterial symbionts in aphids confer resistance to parasitic wasps. Proc Natl Acad Sci U S A. 2003; 100(4):1803–7. 10.1073/pnas.0335320100 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Xie J, Butler S, Sanchez G, Mateos M. Male killing Spiroplasma protects Drosophila melanogaster against two parasitoid wasps. Heredity. 2014; 112(4):399 10.1038/hdy.2013.118 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Mateos M, Winter L, Winter C, Higareda‐Alvear VM, Martinez‐Romero E, Xie J. Independent origins of resistance or susceptibility of parasitic wasps to a defensive symbiont. Ecol Evol. 2016; 6(9):2679–87. 10.1002/ece3.2085 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Jaenike J, Unckless R, Cockburn SN, Boelio LM, Perlman SJ. Adaptation via symbiosis: recent spread of a Drosophila defensive symbiont. Science. 2010; 329(5988):212–5. 10.1126/science.1188235 [DOI] [PubMed] [Google Scholar]
- 20.Lilburn TG, Kim KS, Ostrom NE, Byzek KR, Leadbetter JR, Breznak JA. Nitrogen fixation by symbiotic and free-living spirochetes. Science. 2001; 292(5526):2495–8. 10.1126/science.1060281 [DOI] [PubMed] [Google Scholar]
- 21.Morales-Jiménez J, de León AV, García-Domínguez A, Martínez-Romero E, Zúñiga G, Hernández-Rodríguez C. Nitrogen-fixing and uricolytic bacteria associated with the gut of Dendroctonus rhizophagus and Dendroctonus valens (Curculionidae: Scolytinae). Microb Ecol. 2013; 66(1):200–10. 10.1007/s00248-013-0206-3 [DOI] [PubMed] [Google Scholar]
- 22.Vera-Ponce de León A, Ormeño-Orrillo E, Ramírez-Puebla ST, Rosenblueth M, Degli Esposti M, Martínez-Romero J, et al. Candidatus Dactylopiibacterium carminicum, a nitrogen-fixing symbiont of Dactylopius cochineal insects (Hemiptera: Coccoidea: Dactylopiidae). Genome Biol Evol. 2017; 9(9):2237–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Sachs JL, Skophammer RG, Regus JU. Evolutionary transitions in bacterial symbiosis. Proc Natl Acad Sci U S A. 2011; 108(Supplement 2):10800–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Hosokawa T, Kikuchi Y, Nikoh N, Shimada M, Fukatsu T. Strict host-symbiont cospeciation and reductive genome evolution in insect gut bacteria. PLoS Biol. 2006; 4(10):e337 10.1371/journal.pbio.0040337 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Thao ML, Moran NA, Abbot P, Brennan EB, Burckhardt DH, Baumann P. Cospeciation of psyllids and their primary prokaryotic endosymbionts. Appl Environ Microbiol. 2000; 66(7):2898–905. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Baumann L, Baumann P. Cospeciation between the primary endosymbionts of mealybugs and their hosts. Curr Microbiol. 2005; 50(2):84–7. 10.1007/s00284-004-4437-x [DOI] [PubMed] [Google Scholar]
- 27.Clark MA, Moran NA, Baumann P, Wernegreen JJ. Cospeciation between bacterial endosymbionts (Buchnera) and a recent radiation of aphids (Uroleucon) and pitfalls of testing for phylogenetic congruence. Evolution. 2000; 54(2):517–25. [DOI] [PubMed] [Google Scholar]
- 28.Martinez-Torres D, Buades C, Latorre A, Moya A. Molecular systematics of aphids and their primary endosymbionts. Mol Phylogenet Evol. 2001; 20(3):437–49. 10.1006/mpev.2001.0983 [DOI] [PubMed] [Google Scholar]
- 29.Thao ML, Gullan PJ, Baumann P. Secondary (γ-Proteobacteria) endosymbionts infect the primary (β-Proteobacteria) endosymbionts of mealybugs multiple times and coevolve with their hosts. Appl Environ Microbiol. 2002; 68(7):3190–7. 10.1128/AEM.68.7.3190-3197.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Moran NA, Dale C, Dunbar H, Smith WA, Ochman H. Intracellular symbionts of sharpshooters (Insecta: Hemiptera: Cicadellinae) form a distinct clade with a small genome. Environ Microbiol. 2003; 5(2):116–26. [DOI] [PubMed] [Google Scholar]
- 31.Thao ML, Baumann P. Evolutionary relationships of primary prokaryotic endosymbionts of whiteflies and their hosts. Applied and Environmental Microbiology. 2004. June 1;70(6):3401–6. 10.1128/AEM.70.6.3401-3406.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Gruwell ME, Morse GE, Normark BB. Phylogenetic congruence of armored scale insects (Hemiptera: Diaspididae) and their primary endosymbionts from the phylum Bacteroidetes. Mol Phylogenet Evol. 2007; 44(1):267–80. 10.1016/j.ympev.2007.01.014 [DOI] [PubMed] [Google Scholar]
- 33.Rosenblueth M, Sayavedra L, Sámano‐Sánchez H, Roth A, Martínez‐Romero E. Evolutionary relationships of flavobacterial and enterobacterial endosymbionts with their scale insect hosts (Hemiptera: Coccoidea). J. Evol Biol. 2012; 25(11):2357–68. 10.1111/j.1420-9101.2012.02611.x [DOI] [PubMed] [Google Scholar]
- 34.Urban JM, Cryan JR. Two ancient bacterial endosymbionts have coevolved with the planthoppers (Insecta: Hemiptera: Fulgoroidea). BMC Evol Biol. 2012; 12(1):87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Ahmed MZ, De Barro PJ, Ren SX, Greeff JM, Qiu BL. Evidence for horizontal transmission of secondary endosymbionts in the Bemisia tabaci cryptic species complex. PLoS One. 2013; 8(1):e53084 10.1371/journal.pone.0053084 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Hall AA, Morrow JL, Fromont C, Steinbauer MJ, Taylor GS, Johnson SN, et al. Codivergence of the primary bacterial endosymbiont of psyllids versus host switches and replacement of their secondary bacterial endosymbionts. Environ Microbiol. 2016; 18(8):2591–603. 10.1111/1462-2920.13351 [DOI] [PubMed] [Google Scholar]
- 37.Kikuchi Y, Hosokawa T, Fukatsu T. Diversity of bacterial symbiosis in stinkbugs New York: Nova Science Publishers Inc; 2008. [Google Scholar]
- 38.Kikuchi Y, Hosokawa T, Nikoh N, Meng XY, Kamagata Y, Fukatsu T. Host-symbiont co-speciation and reductive genome evolution in gut symbiotic bacteria of acanthosomatid stinkbugs. BMC Biol. 2009; 7(1):2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Duron O, Noël V. A wide diversity of Pantoea lineages are engaged in mutualistic symbiosis and cospeciation processes with stinkbugs. Environ Microbiol Rep. 2016; 8(5):715–27. 10.1111/1758-2229.12432 [DOI] [PubMed] [Google Scholar]
- 40.Polis GA. The biology of scorpions Stanford: Stanford University Press; 1990. [Google Scholar]
- 41.Prendini L. Order Scorpiones CL Koch, 1850. Animal biodiversity: An outline of higher-level classification and survey of taxonomic richness New Zealand: Zootaxa; 2011. 115-117 p. [DOI] [PubMed] [Google Scholar]
- 42.Santibáñez-López CE, Francke OF, Ureta C, Possani LD. Scorpions from Mexico: From species diversity to venom complexity. Toxins (Basel). 2015; 8(1):2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Douglas AE. Lessons from studying insect symbioses. Cell Host Microbe. 2011; 10(4):359–67. 10.1016/j.chom.2011.09.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Baldo L, Prendini L, Corthals A, Werren JH. Wolbachia are present in Southern African scorpions and cluster with supergroup F. Curr Microbiol. 2007; 55(5):367–73. 10.1007/s00284-007-9009-4 [DOI] [PubMed] [Google Scholar]
- 45.Suesdek-Rocha L, Bertani R, DASILVA P, Selivon D. The first record for Wolbachia in a scorpion: the parthenogenetic yellow scorpion Tityus serrulatus (Scorpiones, Buthidae). Rev Iber Arachnol. 2006; 14:183–4. [Google Scholar]
- 46.Baradaran M, Jalali A, Jolodar A. Molecular diagnosis of Wolbachia endosymbiont from Iranian scorpion Hemiscorpius lepturus using polymerase chain reaction (PCR) amplification of 16S rDNA gene. Afr J Biotechnol. 2011; 10(85):19802–206. [Google Scholar]
- 47.Bryson RW. Bacterial endosymbiont infections in ‘living fossils’: a case study of North American vaejovid scorpions. Mol Ecol Resour. 2014; 14(4):789–93. 10.1111/1755-0998.12220 [DOI] [PubMed] [Google Scholar]
- 48.Bolaños LM, Rosenblueth M, Castillo‐Ramírez S, Figuier‐Huttin G, Martínez‐Romero E. Species‐specific diversity of novel bacterial lineages and differential abundance of predicted pathways for toxic compound degradation in scorpion gut microbiota. Environ Microbiol. 2016; 18(5):1364–78. 10.1111/1462-2920.12939 [DOI] [PubMed] [Google Scholar]
- 49.Elmnasri K, Hamdi C, Ettoumi B, Crotti E, Guesmi A, Najjari A, et al. Highly divergent Mollicutes symbionts coexist in the scorpion Androctonus australis. J Basic Microbiol. 2018; 58(10):811–901. [DOI] [PubMed] [Google Scholar]
- 50.Sharma PP, Fernández R, Esposito LA, González-Santillán E, Monod L. Phylogenomic resolution of scorpions reveals multilevel discordance with morphological phylogenetic signal. Proc Biol Sci. 2015; 282(1804):20142953 10.1098/rspb.2014.2953 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Rychlik W. OLIGO 7 primer analysis software. InPCR Primer Design. New York: Humana Press; 2007. 33-59 p. [Google Scholar]
- 52.S Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann Entomol Soc Am. 1994; 87(6):651–701. [Google Scholar]
- 53.Folmer O, Black MB, Hoch W, Lutz RA, Vrijenhoek RC. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol. 1994; 3(5):294–9. [PubMed] [Google Scholar]
- 54.Nunn GB, Theisen BF, Christensen B, Arctander P. Simplicity-correlated size growth of the nuclear 28S ribosomal RNA D3 expansion segment in the crustacean order Isopoda. J Mol Evol. 1996; 42(2):211–23. [DOI] [PubMed] [Google Scholar]
- 55.Cole JR, Chai B, Marsh TL, Farris RJ, Wang Q, Kulam SA, et al. The Ribosomal Database Project (RDP-II): previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy. Nucleic Acids Res. 2003; 31(1):442–3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic acids research. 2012. November 27;41(D1):D590–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Katoh K, Rozewicki J, Yamada KD. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform. 2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Posada D. jModelTest: phylogenetic model averaging. Mol Biol Evol. 2008; 25(7):1253–6. 10.1093/molbev/msn083 [DOI] [PubMed] [Google Scholar]
- 59.Stamatakis A, Hoover P, Rougemont J. A rapid bootstrap algorithm for the RAxML web servers. Syst Biol. 2008; 57(5):758–71. 10.1080/10635150802429642 [DOI] [PubMed] [Google Scholar]
- 60.Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016; 33(7):1870–4. 10.1093/molbev/msw054 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994; 22(22):4673–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Ronquist F, Teslenko M, Van Der Mark P, Ayres DL, Darling A, Höhna S, et al. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol. 2012; 61(3):539–42. 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Conow C, Fielder D, Ovadia Y, Libeskind-Hadas R. Jane: a new tool for the cophylogeny reconstruction problem. Algorithms Mol Biol. 2010. December;5(1):16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Felsenstein J. PHYLIP-phylogeny inference package (version 3.2). Cladistics. 1989;5(163):6. [Google Scholar]
- 65.Oksanen J, Blanchet FG, Kindt R, Legendre P, Minchin PR, O’hara RB, et al. Package ‘vegan’. Community Ecology Package, version. 2013; 2(9). [Google Scholar]
- 66.Santibáñez-López CE, Ponce-Saavedra J. A new species of Centruroides (Scorpiones: Buthidae) from the northern mountain range of Oaxaca, Mexico. Rev Mex Biodivers. 2009; 80(002). [Google Scholar]
- 67.Bolaños LM, Servín-Garcidueñas LE, Martínez-Romero E. Arthropod–Spiroplasma relationship in the genomic era. FEMS Microbiol Ecol. 2014; 91(2015). [DOI] [PubMed] [Google Scholar]
- 68.Yamashita T, Rhoads DD, Pummill J. Genome Analyses of a New Mycoplasma Species From the scorpion Centruroides vittatus. 2018. Preprint. Available from: bioRxiv:394825. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Rehm P, Pick C, Borner J, Markl J, Burmester T. The diversity and evolution of chelicerate hemocyanins. BMC Evol Biol. 2012; 12(1):19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Santibáñez-López CE, Kriebel R, Sharma PP. eadem figura manet: Measuring morphological convergence in diplocentrid scorpions (Arachnida: Scorpiones: Diplocentridae) under a multilocus phylogenetic framework. Invertebr Syst. 2017; 31(3):233–48. [Google Scholar]
- 71.Sharma PP, Baker CM, Cosgrove JG, Johnson JE, Oberski JT, Raven RJ, et al. A revised dated phylogeny of scorpions: Phylogenomic support for ancient divergence of the temperate Gondwanan family Bothriuridae. Mol Phylogenet Evol. 2018; 122:37–45. 10.1016/j.ympev.2018.01.003 [DOI] [PubMed] [Google Scholar]
- 72.Fraune S, Zimmer M. Host‐specificity of environmentally transmitted Mycoplasma‐like isopod symbionts. Environ Microbiol. 2008; 10(10):2497–2504. [DOI] [PubMed] [Google Scholar]
- 73.Nishiguchi MK, Ruby EG, McFall-Ngai MJ. Competitive dominance among strains of luminous bacteria provides an unusual form of evidence for parallel evolution in sepiolid squid-Vibrio symbioses. Appl Environ Microbiol. 1998; 64(9):3209–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Schramm A, Davidson SK, Dodsworth JA, Drake HL, Stahl DA, Dubilier N. Acidovorax‐like symbionts in the nephridia of earthworms. Environ Microbiol. 2003; 5(9):804–9. [DOI] [PubMed] [Google Scholar]
- 75.Fenn K, Blaxter M. Are filarial nematode Wolbachia obligate mutualist symbionts? Trends Ecol Evol. 2004; 19(4):163–6. 10.1016/j.tree.2004.01.002 [DOI] [PubMed] [Google Scholar]
- 76.Bhat AH, Chaubey AK, Půža V. The first report of Xenorhabdus indica from Steinernema pakistanense: co-phylogenetic study suggests co-speciation between X. indica and its steinernematid nematodes. J Helminthol. 2018; 1–0. [DOI] [PubMed] [Google Scholar]
- 77.Ebert D. The epidemiology and evolution of symbionts with mixed-mode transmission. Annu Rev Ecol Evol Syst. 2013; 44:623–43. [Google Scholar]
- 78.Itoh H, Aita M, Nagayama A, Meng XY, Kamagata Y, Navarro R, et al. Evidence of environmental and vertical transmission of Burkholderia symbionts in the oriental chinch bug, Cavelerius saccharivorus (Heteroptera: Blissidae). Appl Environ Microbiol. 2014; 80(19):5974–83. 10.1128/AEM.01087-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Jost T, Lacroix C, Braegger CP, Rochat F, Chassard C. Vertical mother–neonate transfer of maternal gut bacteria via breastfeeding. Environ Microbiol. 2014; 16(9):2891–904. 10.1111/1462-2920.12238 [DOI] [PubMed] [Google Scholar]
- 80.Huang QY, Wang WP, Mo RY, Lei CL. Studies on feeding and trophallaxis in the subterranean termite Odontotermes formosanus using rubidium chloride. Odontotermes formosanus using rubidium chloride. Entomol Exp Appl. 2008; 129(2):210–5. [Google Scholar]
- 81.Koch H, Abrol DP, Li J, Schmid‐Hempel P. Diversity and evolutionary patterns of bacterial gut associates of corbiculate bees. Mol Ecol. 2013; 22(7):2028–44. 10.1111/mec.12209 [DOI] [PubMed] [Google Scholar]
- 82.Sylvain FÉ, Derome N. Vertically and horizontally transmitted microbial symbionts shape the gut microbiota ontogenesis of a skin-mucus feeding discus fish progeny. Sci Rep. 2017; 7(1):5263 10.1038/s41598-017-05662-w [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Rahman NA, Parks DH, Willner DL, Engelbrektson AL, Goffredi SK, Warnecke F, et al. A molecular survey of Australian and North American termite genera indicates that vertical inheritance is the primary force shaping termite gut microbiomes. Microbiome. 2015; 3(1):5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Razin S. The genus Mycoplasma and related genera (class Mollicutes) In The prokaryotes. New York: Springer; 2006. 836-904 p. [Google Scholar]
- 85.Naumann M, Schüßler A, Bonfante P. The obligate endobacteria of arbuscular mycorrhizal fungi are ancient heritable components related to the Mollicutes. ISME J. 2010; 4(7):862 10.1038/ismej.2010.21 [DOI] [PubMed] [Google Scholar]
- 86.Razin S. Mycoplasma taxonomy and ecology In Mycoplasmas: molecular biology and pathogenesis. Washington, D.C: AMERICAN SOCIETY FOR MICROBIOLOGY: 1992. 3-22 p. [Google Scholar]
- 87.Razin S, Yogev D, Naot Y. Molecular biology and pathogenicity of mycoplasmas. Microbiol Mol Biol Rev. 1998; 62(4):1094–156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Regassa LB, Gasparich GE. Spiroplasmas: evolutionary relationships and biodiversity. Front Biosci. 2006; 11:2983–3002. [DOI] [PubMed] [Google Scholar]
- 89.Gasparich GE. Spiroplasmas and phytoplasmas: microbes associated with plant hosts. Biologicals. 2010; 38(2):193–203. 10.1016/j.biologicals.2009.11.007 [DOI] [PubMed] [Google Scholar]
- 90.Viver T, Orellana LH, Hatt JK, Urdiain M, Díaz S, Richter M, et al. The low diverse gastric microbiome of the jellyfish Cotylorhiza tuberculata is dominated by four novel taxa. Environ Microbiol. 2017; 19(8):3039–58. 10.1111/1462-2920.13763 [DOI] [PubMed] [Google Scholar]
- 91.Wang Y, Huang JM, Wang SL, Gao ZM, Zhang AQ, Danchin A, et al. Genomic characterization of symbiotic mycoplasmas from the stomach of deep‐sea isopod Bathynomus sp. Environ Microbiol. 2016; 18(8):2646–59. 10.1111/1462-2920.13411 [DOI] [PubMed] [Google Scholar]
- 92.Leclercq S, Dittmer J, Bouchon D, Cordaux R. Phylogenomics of “Candidatus Hepatoplasma crinochetorum,” a lineage of mollicutes associated with non-insect arthropods. Genome Biol Evol. 2014; 6(2):407–15. 10.1093/gbe/evu020 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Whitcomb RF. Culture media for spiroplasmas Methods in Mycoplasmology. New York: Academic Press; 1983. 147-158 p. [Google Scholar]
- 94.Razin S, Hayflick L. Highlights of mycoplasma research—an historical perspective. Biologicals. 2010; 38(2):183–90. 10.1016/j.biologicals.2009.11.008 [DOI] [PubMed] [Google Scholar]
- 95.He LS, Zhang PW, Huang JM, Zhu FC, Danchin A, Wang Y. The enigmatic genome of an obligate ancient Spiroplasma symbiont in a hadal holothurian. Appl Environ Microbiol. 2017; AEM-01965. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 96.Xie J, Vilchez I, Mateos M. Spiroplasma bacteria enhance survival of Drosophila hydei attacked by the parasitic wasp Leptopilina heterotoma. PLoS One. 2010; 5(8):e12149 10.1371/journal.pone.0012149 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 97.Prendini L. Substratum specialization and speciation in southern African scorpions: the Effect Hypothesis revisited. Scorpions. 2001; 113–38. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
16S rRNA phylogeny of Mollicutes showing all sequences used for constructing the collapsed phylogeny in Fig 2.
(TIF)
rpoB gene phylogeney of Mollicutes showing all sequences except the scorpion groups SMC and SG1, which are shown collapsed.
(TIF)
Phylogenies described in Fig 3 reconstructed with Bayesian Inference. (A) Scorpion phylogeny with concatenated 16S rRNA, CO1 and 28S rRNA genes. (B) SMC 16S rRNA gene phylogeny. (C) SG1 16S rRNA gene phylogeny.
(TIF)
Phylogenies for each of the three marker genes performed with maximum likelihood. Substitution models used were T92 + G for 16S rRNA, GTR + G + I for CO1, and HKY for 28S rRNA. Colors for each genus or clade are as in Fig 3.
(TIF)
(DOCX)
(DOCX)
(FASTA)
Data Availability Statement
All gene sequences obtained in this study can be found in the GenBank (NCBI) repository under the accession numbers: MF134669-MF134807 and MF774367 and in the supplementary files.





