Skip to main content
BioMed Research International logoLink to BioMed Research International
. 2018 Dec 27;2018:4657396. doi: 10.1155/2018/4657396

Biofilm Formation by Methicillin-Resistant and Methicillin-Sensitive Staphylococcus aureus Strains from Hospitalized Patients in Poland

Małgorzata Piechota 1, Barbara Kot 1,✉, Aneta Frankowska-Maciejewska 1, Agata Grużewska 2, Agnieszka Woźniak-Kosek 3
PMCID: PMC6327255  PMID: 30687745

Abstract

Biofilm-mediated infections in the hospital environment have a significant negative impact on patient health. This study aimed to investigate biofilm production in vitro and the presence of icaABCD genes in methicillin-resistant S. aureus (MRSA) and methicillin-sensitive S. aureus (MSSA) strains isolated from hospitalized patients. MRSA (73) and MSSA (57) strains were evaluated for biofilm production by the microtiter plate method. The presence of ica operon was investigated by PCR. Out of 130 strains, 99.2% were biofilm producers. Strong biofilms were formed by 39.7% of MRSA and 36.8% of MSSA strains. The highest percentage of strong biofilm producers was found among the strains isolated from sputum and tracheostomy tube (66.7%), nose and catheter (50%), throat (44.4%), and bronchoalveolar washings (43.8%). The strains isolated from bronchoalveolar washings produced significantly more biofilm than strains isolated from wound and anus. The ability of biofilm forming by fecal strains was significantly lower compared to strains from other materials. MRSA strains had significantly higher ability of biofilm formation than MSSA strains (P = 0.000247). The presence of ica operon in MRSA was detected in all strains. Comparison of strong biofilm biomass of the strains with icaABCD, icaABD, and icaAD revealed that strains with icaABCD and icaABD produced highly significantly more biofilm than strains with icaAD. Biofilm forming by both MRSA and MSSA strains indicates high ability of theses strains to persist in hospital environment which increases the risk of disease development in hospitalized patients.

1. Introduction

Health-care-associated infections are a live and serious problem in hospital environment. Methicillin-resistant Staphylococcus aureus (MRSA) is one of the major human pathogens. It is responsible for many diseases from skin infections to serious invasive infections such as pneumonia, infections of soft tissues, bones, heart valves, and even fatal septicemia in human [1]. The number of infections caused by MRSA isolates increased during the recent years and these are more frequently associated with mortality than infections caused by other bacteria. S. aureus is one of the most common causes of bacteremia and currently carries 20–40% mortality at 30 days despite an appropriate treatment [2]. In recent 20 years S. aureus infections have become more dangerous and costly to treat because of increasing prevalence of antimicrobial resistance in S. aureus due to the widespread use of antibiotics [3]. MRSA are resistant to β-lactam antibiotics but often the MRSA isolates are multidrug-resistant (MDR) because they show resistance to other antimicrobial agents, e.g., macrolides, tetracycline, aminoglycosides, chloramphenicol, and fluoroquinolones that are commonly used in therapy of infection caused by these microorganisms [4]. MRSA infections have been routinely detected in hospitalized patients including those in high-income countries. These infections are estimated to affect more than 150,000 patients annually in the European Union [5]. MRSA may infect different parts of the body including surgical wounds, skin, lower respiratory tract, and bloodstream in which they can cause different symptoms [6].

Chronic infections caused by bacterial cells forming biofilm and showing increased resistance against antimicrobial treatment are an important medical problem. It is considered that biofilms contribute to >80% of all infections in humans [7]. Colonization of medical surfaces, such as catheters and other devices, plays an important role in the problem of healthcare-associated infections because bacterial cells in biofilm show an increased resistance against classical antimicrobial treatment and host immune factors [8]. Biofilm formation by MRSA and methicillin-sensitive S. aureus (MSSA) strains is considered an important virulence factor influencing its persistence in both the environment and the host organism. Production of biofilm by S. aureus is most frequently associated with the synthesis of polysaccharide intracellular adhesin (PIA) encoded by ica operon [9]. Biofilm-mediated infections have an adverse effect on patient health, and therefore the main aim of this study was to investigate the capacity of clinical strains of S. aureus to form biofilms and the presence of icaABCD genes in these strains.

2. Materials and Methods

2.1. Bacterial Strains

A total of 130 S. aureus strains from clinical materials from humans such as swabs from wound (25), nose (8), anus (16), throat (9), tracheostomy tube (3), and catheter (2) and samples of blood (13), urine (5), bronchoalveolar washings (32), purulence (6), sputum (3), and other samples (8) were used in this study. The strains were obtained from hospitals in Siedlce and Warsaw (Poland) in 2015-2017. The methods of identification of isolates as S. aureus were described previously [10]. The resistance of the strains to methicillin was tested with a disc diffusion method according to CLSI [11]. The mecA gene responsible for resistance against β-lactam antibiotics was identified by PCR [12].

2.2. Biofilm Formation Assay

Each strain was grown on Tryptic-Soy Agar (TSA; BBL, Becton Dickinson, Sparks, Md.) with 0.5% glucose at 37°C for 18 h. After that, bacterial cells were transferred to Tryptic-Soy Broth (TSB) with 0.5% glucose in order to prepare cell suspension containing about 108CFU/mL. Subsequently, bacterial cell suspension (200 μL) was inoculated in eight replicates to wells of a tissue culture polystyrene 96-well plate (Nunclon, Roskilde, Denmark). Biofilms were developed for 48 h at 37°C. After this time, the medium was removed and nonadherent bacterial cells were discarded by washing the biofilms twice with 250 μL of sterile phosphate buffered saline (PBS, pH 7.4). Biofilm was fixed with 200 μL of methanol per well for 15 min and stained for 5 min with 200 μL of 1% crystal violet per well (Sigma-Aldrich, Steinheim, Germany). After rinsing with distilled water the plates were air dried. After that, colorant was solved in 96% ethanol to measure absorbance at 492 nm in microplate reader (Apollo LB913, Berthold Technologies, Germany). Each assay was performed three times and the results were averaged. Values of absorbance ≥0.12 were regarded as biofilm positive, <0.2 were considered weak producers, 0.2-0.4 were moderate producers, and >0.4 were considered strong producers [13].

2.3. DNA Isolation

Genomic DNA was isolated from S. aureus strains by using the NucleoSpin Microbial DNA (Macherey-Nagel GmbH&Co.KG, Düren, Germany) according to the manufacturer's protocol. 2.5 μL of the total extracted material from each test sample was used as a template DNA for PCR application.

2.4. Primers and PCR Conditions

The primers specific for the icaA, icaB, icaC, and icaD synthesized by DNA-Gdańsk (Gdańsk, Poland) are listed in Table 1.

Table 1.

Oligonucleotide primers used in the study.

Primers Sequence (5′→ 3′) Amplicon length (bp) References
icaA (F) ACACTTGCTGGCGCAGTCAA 188 [14]
icaA (R) TCTGGAACCAACATCCAACA    
icaB (F) GTCTTCATTTGGAGGATTCGGC 900 [15]
icaB (R) AATCACTACTGACTTCGGCTGG    
icaC (F) ATGGGACGGATTCCATGAAAAAGA 1100 [15]
icaC (R) TAATAAGCATTAATGTTCAATT    
icaD (F) ATGGTCAAGCCCAGACAGAG 198 [14]
icaD (R) AGTATTTTCAATGTTTAAAGCAA    

The monoplex PCR for each gene was performed in a 25-μL volume containing 2.5 μL of DNA template, 1×PCR buffer, 0.2 mM each dATP, dCTP, dGTP, and dTTP (Fermentas, Lithuania), the specific primers at 100 nM, and 1 U of REDTaq Genomic DNA polymerase (Sigma-Aldrich, Germany). The amplification was carried out in the following conditions: initial denaturation (94°C, 4 min), followed by 35 subsequent cycles consisting of denaturation (94°C, 30 s), primer annealing (56°C, 30 s), extension (72°C, 1 min), and final extension (72°C, 10 min).

Amplifications were carried out in the Eppendorf Mastercycler nexus gradient (Germany). The PCR products were analyzed by electrophoresis in 1.5% agarose gels stained with ethidium bromide. Molecular size markers (Sigma-Aldrich) were also run for product size verification. The gel was electrophoresed in 2 × Tris-borate buffer at 70 V for 1.5 h.

2.5. Statistical Analysis

Comparisons were analyzed by using Statistics 13.1 (Analytical Software, Tallahassee, FL). The comparison of average values of absorbance at 492 nm between two groups was performed by Mann-Whitney U-test. In case of nonparametric tests of three or more groups, Kruskal-Wallis test was performed. In the analysis, multiple comparisons of average ranks were used.  χ2 test was used to determine the relationships between the presence of ica operon genes and susceptibility or resistance to methicillin.

3. Results

S. aureus strains included in this study were collected from individuals in hospitals in Siedlce and Warsaw (Poland) between 2015 and 2017 and were divided into MSSA (57 strains) and MRSA (73 strains). S. aureus strains were evaluated for biofilm formation on polystyrene surface. Out of 130 strains, 99.2% were biofilm producers. Only one strain isolated from anus did not produce biofilm. Based on absorbance values at 492 nm, the strains were considered weak, moderate, and strong producers of biofilm. About 37% of strains were strong producers, while above 49% and above 13% of strains were moderate and weak producers, respectively. The highest percentage of strong biofilm producers was among the strains isolated from sputum and tracheostomy tube (66.7%), nose and catheter (50%), throat (44.4%), and bronchoalveolar washings (43.8%) (Table 2).

Table 2.

Ability of S. aureus strains to produce biofilm on polystyrene.

Origin of strains (no.) No. (%) of strains
Specific biofilm formation
  Strong Moderate Weak
Bronchoalveolar washings (32) 14 (43.8) 15 (46.8) 3 (9.4)
Wound (25) 7 (28) 12 (48) 6 (24)
Anus (16)∗ 2 (12.5) 9 (56.2) 4 (25)
Blood (13) 5 (38.5) 7 (53.8) 1 (7.7)
Nose (8) 4 (50) 4 (50) -
Purulence (6) 2 (33.4) 4 (66.6) -
Urine (5) 1(20) 4 (80) -
Throat (9) 4 (44.4) 5 (55.6) -
Sputum (3) 2 (66.7) 1 (33.3) -
Tracheostomy tube (3) 2 (66.7) 1 (33.3) -
Catheter (2) 1(50) - 1 (50)
Other (8) 4 (50) 2 (25) 2 (25)
Total 48 (36.9) 64 (49.2) 17 (13.1)

∗ - One strain did not form biofilm.

All strains from tracheostomy tube and catheter were MRSA. Among the strains from throat about 89% were resistant to methicillin. The percentage of strains resistant to this group of antibiotics isolated from sputum was equal to 66.7%, while among strains from nose and bronchoalveolar washings it was 62.5%.

The comparison of biofilm biomass (absorbance at 492 nm) of four most numerous groups of strains isolated from blood, bronchoalveolar washings, wound, and anus revealed that strains isolated from bronchoalveolar washings produced significantly more biofilm than strains isolated from wound and anus but difference between biofilm biomass of strains from bronchoalveolar washings and from blood was not statistically significant. No statistically significant difference in biofilm production was observed between strains isolated from blood and wound. While, the ability of biofilm forming by the strains isolated from anus was significantly lower comparing to strains isolated from other clinical materials (Figure 1).

Figure 1.

Figure 1

Biofilm-forming ability of the four most numerous groups of S. aureus strains isolated from blood (B), bronchoalveolar washings (BW), wound (W), and anus (AN). Values of absorbance at 492 nm (A492) were compared by using Kruskal-Wallis test. In analysis, multiple comparisons of average ranks at P ≤ 0.05 were used. The designation with different letters indicates that biofilm biomass formed by different groups of strains differs significantly.

The majority of the 73 MRSA strains examined (47.9%) formed moderate biofilms. The strong biofilms were formed by 39.7% of the MRSA strains, while 11% of strains were weak producers of biofilm. One methicillin-resistant strain isolated from anus did not produce biofilm. A large group of the 57 MSSA strains examined (45.6%) also formed moderate biofilms, while 36.8% and 17.6% of MSSA strains were strong and weak producers, respectively. Comparison of biofilm biomass (absorbance at 492 nm) using the statistical test showed that MRSA strains had significantly higher ability of biofilm formation than MSSA strains (P = 0.000247) (Figure 2).

Figure 2.

Figure 2

Comparison of ability of biofilm forming by MRSA and MSSA strains. Two group comparisons of average values of absorbance at 492 nm (A492) were analyzed by using Mann-Whitney U-test. The designation with different letters indicates that biofilm biomass formed by MRSA and MSSA strains differs significantly at P = 0.000247.

The presence of the ica operon in the investigated strains was demonstrated by amplification of the specific fragments for icaA (188 bp), icaB (900 bp), icaC (1100 bp), and icaD (198 bp) (Figure 3).

Figure 3.

Figure 3

Electrophoresis in 1.5% agarose gel PCR products obtained by using specific primers for icaABCD genes. Lines M: molecular weight markers (1000, 900, 800, 700, 600, 500, 400, 300, 200, 100 bp; GenoPlast Biochemicals, Poland), Lines 1–4: products (188 bp) obtained by using specific primers for icaA gene; Lines 5–8: products (900 bp) obtained by using specific primers for icaB gene; Lines 9–12: products (1100 bp) obtained by using specific primers for icaC gene; Lines 13–16: products (198 bp) obtained by using specific primers for icaD gene.

The icaABCD genes were present in 67 (51.5%) strains, while the icaABD and icaAD genes were detected in 34 (26.1%) and 20 (15.4%) strains, respectively. Few strains harbored only icaA (3.1%) or icaACD (1.5%) genes. In remaining three strains the icaAB, icaBD, and icaBCD genes were detected. The comparison of strong biofilm biomass of the strains with icaABCD, icaABD, and icaAD revealed that strains with icaABCD and icaABD produced highly significantly more biofilm than strains with icaAD (P = 0.000027 and P = 0.003027, respectively) (Figure 4). No statistically significant difference in biofilm production was observed in strains that harbored these genes and formed moderate and weak biofilm.

Figure 4.

Figure 4

Comparison of ability of strong biofilm forming by S. aureus strains with icaABCD, icaABD, and icaAD genes. Values of absorbance at 492 nm were compared by using Kruskal-Wallis test. In analysis, multiple comparisons of average ranks at P ≤ 0.01 were used. The designation with different letters indicates that biofilm biomass formed by strains with different genes differs significantly.

The occurrence of icaABCD genes was significantly associated with the MRSA strains (P = 0.04). The icaABCD genes were also present in small group of MSSA strains (Figure 5).

Figure 5.

Figure 5

The relationships between the presence of ica operon genes and susceptibility or resistance to methicillin. ∗ The icaABCD genes were significantly associated with the MRSA strains (P = 0.04) (χ2 test).

4. Discussion

Biofilm production by S. aureus has been identified as an important factor of pathogenesis, protecting against the immune system and antibiotics, and is considered to be responsible for chronic or persistent infections [16]. S. aureus forming biofilm causes many diseases including septicemia, endocarditis, and osteomyelitis and is a serious problem in nosocomial infections caused by S. aureus [17, 18]. In our study we investigated the ability to form biofilm by S. aureus strains isolated from clinical materials from hospitalized patients and almost all strains (99.2%) adhered to polystyrene but differed in the ability of producing biofilm, whereas Agarwal and Jain (2013) [19], who grouped S. aureus in three categories, showed that isolates showing biofilm producing potential occurred more often among invasive (from blood) and colonizing (from intravenous device) isolates than in group of commensal isolates (from skin or nose). Our strains also originated from diverse sources but had variable ability to form biofilm. We found that the highest percentage of strong biofilm producers was among the strains isolated from sputum and tracheostomy tube (66.7), nose and catheter (50%), throat (44.4%), and bronchoalveolar washings (43.8%). This indicates that production of strong biofilm by S. aureus isolated from respiratory tract and medical devices is a result of environmental selection that led to predominance of strong biofilm producers, because biofilm formation is important for their persistence in these difficult environmental conditions. Bridier et al. (2010) [20] reported that S. aureus strains from different sources produced biofilms with high biovolumes. In present study, we compared biofilm biomass and revealed that strains isolated from bronchoalveolar washings produced significantly more biofilm than strains isolated from wound and anus. Biofilm formation depends on many factors such as environment, availability of nutrients, and above all the presence of the biofilm-associated genes and their expression [21]. In our previous studies we found that the expression levels of genes encoding binding factors (elastin-, laminin-, and fibrinogen-binding protein) in weakly adhering strain of S. aureus were significantly lower than in strongly adhering strain of S. aureus [22]. The results reported by Beloin et al. (2006) [23] showed that the nature of the strains also plays role in the expression levels of genes that are involved in the synthesis of PIA. The results of our previous study revealed that in biofilm formed by weakly adhering S.aureus strain icaA expression gradually increased, while expression of icaD did not change over time, whereas in strongly adhering strain, the highest expression levels of these genes were detected during first hours of biofilm formation [22].

Fecal screening for S. aureus is of key importance in infection control and that is why in our research strains from anus of hospitalized patients constituted a large group.

Other authors showed that feces of hospitalized patients are an important source of both MRSA and MSSA strains for nosocomial transmission and a risk factor for disease development [24]. Patients with MRSA colonized diarrheal stools impact significantly on environmental contamination. In our study, 62.5% of S. aureus strains from feces were resistant to methicillin. Other authors showed also that hospitalized patients with stools and nose colonized are significantly more sensitive to colonize skin compared to patients with nose colonization only [25, 26]. In our research, almost all strains isolated from anus produced biofilm but the ability of biofilm forming by these strains was significantly lower comparing to strains isolated from other clinical materials. In this study we showed that the majority of MRSA and MSSA strains were moderate producers of biofilm which is in accordance with the results obtained by Smith et al. (2008) [27]. However, these authors detected no significant correlation between susceptibility to methicillin and biofilm formation, while we found that MRSA strains produced significantly more biofilm than MSSA strains. Our data were in accordance with the results obtained by Neopane et al. (2018) [21] who observed that among biofilm producers MRSA strains comprised 43.3% and no MRSA strains were identified among biofilm nonproducers. Batistão et al. (2016) [28] showed that all strains characterized as strong biofilm producers carried the SCCmec type III (staphylococcal cassette chromosome mec), while Lim et al. (2013) [29] found SCCmec type III as a genetic marker of strong biofilm producers.

S. aureus biofilm formation depends on the production of an intercellular polysaccharide adhesin named PIA which is composed of beta-1,6-linked N-acetylglucosamine residues and an anionic fraction with a lower content of non-N-acetylated D-glucosaminyl residues [30]. The products of the ica locus comprising icaADBC genes were demonstrated to be necessary for biofilm formation. The PIA mediates intercellular adherence and accumulation of multilayer biofilms [31]. In our study the ica operon was present in all S. aureus strains but strains differed in biofilm biomass. It is suggested that these biofilm producer strains also used other systems to form biofilm such as the protein A (SpA), S. aureus surface proteins G (SasG), and C (SasC) or the fibronectin-binding proteins (FnBPs) which were found essential for biofilm formation [32–35]. Moreover, biofilm-associated protein (Bap) and Bap-related proteins of S. aureus also can substitute PIA-mediated biofilm development in ica-independent biofilms [36]. In our research, not all genes of ica operon were detected in investigated strains. Similar results were obtained by Diamond-Hernandez et al. (2010) [37] and Bazari et al. (2017) [38]. In our study, statistical analysis showed that biofilm biomass of strains with icaABCD and icaABD, which formed strong biofilm, was highly significantly higher than the biofilm biomass of strains with icaAD. IcaB is the deacetylase responsible for deacetylation of poly-N-acetylglucosamine. Deacetylation of the polymer is essential for biofilm formation. Deletion of icaB leads to synthesis of complete poly-N-acetylglucosamine, less efficiently binding to the bacterial cell surface which leads to reduction in biofilm formation [39]. In this study, icaABCD was significantly associated with MRSA strains that had significantly higher ability of biofilm formation than MSSA strains. The prevalence of icaABD was similar in both MRSA and MSSA strains. Lower biofilm biomass of MSSA strains can be caused by a less frequent occurrence of icaABCD in this bacteria than in MRSA strains. The results obtained by other authors [40] showed that biofilm development in MSSA is icaABCD dependent and environmental regulation may play an important role in ica transcription. Biofilm development in MRSA is ica independent and involves a protein adhesin regulated by the accessory gene regulator (agr) and the staphylococcal accessory regulator (sarA), whereas sarA regulated PIA plays more important role in MSSA biofilm development [41, 42].

5. Conclusions

The present study revealed that MRSA and MSSA strains isolated from clinical materials from hospitalized patients produced biofilm. Biofilm biomass formed by strains from different clinical materials was different. The strains from bronchoalveolar washings produced significantly more biofilm than strains from wounds and anus, while biofilm biomass formed by strains from blood was not significantly lower than biofilm biomass of strains from bronchoalveolar washings. The ability of biofilm forming by strains from feces was significantly lower comparing to strains isolated from other clinical materials. Biofilm biomass of MRSA strains was significantly higher than biofilm biomass formed by MSSA strains. All strains had ica operon, and strains forming strong biofilm with icaABCD and icaABD produced highly significantly more biofilm than strains with icaAD. The biofilm-forming capacity of MRSA and MSSA strains indicates high ability of these strains to persist in hospital environment and increase the risk of disease development in hospitalized patients.

Acknowledgments

This work was supported by the Siedlce University of Natural Science and Humanities (Scientific Research Project no. 316/12/S).

Data Availability

The data used to support the findings of this study are available from the corresponding author upon request.

Conflicts of Interest

The authors declare that there are no conflicts of interest regarding the publication of this paper.

References

  • 1.Gordon R. J., Lowy F. D. Pathogenesis of methicillin-resistant Staphylococcus aureus infection. Clinical Infectious Diseases. 2008;46(5):S350–S359. doi: 10.1086/533591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Melzer M., Welch C. Thirty-day mortality in UK patients with community-onset and hospital-acquired meticillin-susceptible Staphylococcus aureus bacteraemia. Journal of Hospital Infection. 2013;84(2):143–150. doi: 10.1016/j.jhin.2012.12.013. [DOI] [PubMed] [Google Scholar]
  • 3.Neyra R. C., Frisancho J. A., Rinsky J. L., et al. Multidrug-resistant and methicillin-resistant Staphylococcus aureus (MRSA) in hog slaughter and processing plant workers and their community in North Carolina (USA) Environmental Health Perspectives. 2014;122(5):471–477. doi: 10.1289/ehp.1306741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Ness T. Multiresistant bacteria in ophthalmology. Ophthalmology. 2010;107(4):318–322. doi: 10.1007/s00347-009-2076-0. [DOI] [PubMed] [Google Scholar]
  • 5.Köck R., Becker K., Cookson B., et al. Methicillin-resistant Staphylococcus aureus (MRSA): burden of disease and control challenges in Europe. Eurosurveillance. 2010;15(41):19694–19688. doi: 10.2807/ese.15.41.19688-en. [DOI] [PubMed] [Google Scholar]
  • 6.Brown A. F., Leech J. M., Rogers T. R., McLoughlin R. M. Staphylococcus aureus colonization: modulation of host immune response and impact on human vaccine design. Frontiers in Immunology. 2014;4:1–20. doi: 10.3389/fimmu.2013.00507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Davies D. Understanding biofilm resistance to antibacterial agents. Nature Reviews Drug Discovery. 2003;2(2):114–122. doi: 10.1038/nrd1008. [DOI] [PubMed] [Google Scholar]
  • 8.Simões M., Bennett R. N., Rosa E. A. S. Understanding antimicrobial activities of phytochemicals against multidrug resistant bacteria and biofilms. Natural Product Reports. 2009;26(6):746–757. doi: 10.1039/b821648g. [DOI] [PubMed] [Google Scholar]
  • 9.Cerca N., Jefferson K. K., Maira-Litran T., et al. Molecular Basis for Preferential Protective Efficacy of Antibodies Directed to the Poorly Acetylated Form of Staphylococcal Poly-N-Acetyl- -(1-6)-Glucosamine. Infection and Immunity. 2007;75(7):3406–3413. doi: 10.1128/IAI.00078-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Kot B., Wierzchowska K., Grużewska A., Lohinau D. The effects of selected phytochemicals on biofilm formed by five methicillin-resistant Staphylococcus aureus. Natural Product Research. 2017;32(11):1299–1302. doi: 10.1080/14786419.2017.1340282. [DOI] [PubMed] [Google Scholar]
  • 11.CLSI. Performance Standards for Antimicrobial Susceptibility Testing. 27th. Wayne, PA, USA: Clinical and Laboratory Standards Institute; 2017. (CLSI Suppl M100). [Google Scholar]
  • 12.Murakami K., Minamide W., Wada K., Nakamura E., Teraoka H., Watanabe S. Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. Journal of Clinical Microbiology. 1991;29(10):2240–2244. doi: 10.1128/jcm.29.10.2240-2244.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Cafiso V., Bertuccio T., Santagati M., et al. FEMS Immunology & Medical Microbiology. 2007;51(1):220–227. doi: 10.1111/j.1574-695X.2007.00298.x. [DOI] [PubMed] [Google Scholar]
  • 14.Rohde H., Knobloch J. K., Horstkotte M. A., et al. Correlation of Staphylococcus aureus icaADBC Genotype and Biofilm Expression Phenotype. Journal of Clinical Microbiology. 2001;39(12):4595–4596. doi: 10.1128/JCM.39.12.4595-4596.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kiem S., Oh W. S., Peck K. R., et al. Phase variation of biofilm formation in Staphylococcus aureus by IS 256 insertion and its impact on the capacity adhering to polyurethane surface. Journal of Korean Medical Science. 2004;19(6):p. 779. doi: 10.3346/jkms.2004.19.6.779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Stewart P. S., Costerton J. W. Antibiotic resistance of bacteria in biofilms. The Lancet. 2001;358(9276):135–138. doi: 10.1016/S0140-6736(01)05321-1. [DOI] [PubMed] [Google Scholar]
  • 17.Götz F. Staphylococcus and biofilms. Molecular Microbiology. 2002;43(6):1367–1378. doi: 10.1046/j.1365-2958.2002.02827.x. [DOI] [PubMed] [Google Scholar]
  • 18.Kim J. H., Kim C. H., Hacker J., Ziebuhr W., Lee B. K., Cho S. H. Molecular characterization of regulatory genes associated with biofilm variation in a Staphylococcus aureusstrain. Journal of Microbiology Biotechnology. 2008;18(1):28–34. [PubMed] [Google Scholar]
  • 19.Agarwal A., Jain A. Glucose & sodium chloride induced biofilm production ica operon in clinical isolates of staphylococci. Indian Journal of Medical Research. 2013;138(2):262–266. [PMC free article] [PubMed] [Google Scholar]
  • 20.Bridier A., Dubois-Brissonnet F., Boubetra A., Thomas V., Briandet R. The biofilm architecture of sixty opportunistic pathogens deciphered using a high throughput CLSM method. Journal of Microbiological Methods. 2010;82(1):64–70. doi: 10.1016/j.mimet.2010.04.006. [DOI] [PubMed] [Google Scholar]
  • 21.Neopane P., Nepal H. P., Shrestha R., Uehara O., Abiko Y. In vitro biofilm formation by Staphylococcus aureus isolated from wounds of hospital-admitted patients and their association with antimicrobial resistance. Journal of General Internal Medicine. 2018;11:25–32. doi: 10.2147/IJGM.S153268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kot B., Sytykiewicz H., Sprawka I. Expression of the Biofilm-Associated Genes in Methicillin-Resistant Staphylococcus aureus in Biofilm and Planktonic Conditions. International Journal of Molecular Sciences. 2018;19(11):p. 3487. doi: 10.3390/ijms19113487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Beloin C., Michaelis K., Lindner K., et al. The Transcriptional Antiterminator RfaH Represses Biofilm Formation in Escherichia coli. Journal of Bacteriology. 2006;188(4):1316–1331. doi: 10.1128/JB.188.4.1316-1331.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Claassen-Weitz S., Shittu A. O., Ngwarai M. R., Thabane L., Nicol M. P., Kaba M. Fecal Carriage of Staphylococcus aureus in the Hospital and Community Setting: A Systematic Review. Frontiers in Microbiology. 2016;7 doi: 10.3389/fmicb.2016.00449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Bhalla A., Aron D. C., Donskey C. J. Staphylococcus aureus intestinal colonization is associated with increased frequency of S. aureuson skin of hospitalized patients. BMC Infectious Diseases. 2007;7(105):1–7. doi: 10.1186/1471-2334-7-105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Boyce J. M., Havill N. L., Otter J. A., Adams N. M. Widespread environmental contamination associated with patients with diarrhea and methicillin-resistant Staphylococcus aureus colonization of the gastrointestinal tract. Infection Control & Hospital Epidemiology. 2007;28(10):1142–1147. doi: 10.1086/520737. [DOI] [PubMed] [Google Scholar]
  • 27.Smith K., Perez A., Ramage G., Lappin D., Gemmell C. G., Lang S. Biofilm formation by Scottish clinical isolates of Staphylococcus aureus. Journal of Medical Microbiology. 2008;57(8):1018–1023. doi: 10.1099/jmm.0.2008/000968-0. [DOI] [PubMed] [Google Scholar]
  • 28.Batistão D., Amaral de Campos P., Camilo N. C., et al. Biofilm formation of Brazilian meticillin-resistant Staphylococcus aureus strains: prevalence of biofilm determinants and clonal profiles. Journal of Medical Microbiology. 2016;65(4):286–297. doi: 10.1099/jmm.0.000228. [DOI] [PubMed] [Google Scholar]
  • 29.Lim Y., Shin H. J., Kwon A. S., Reu J. H., Park G., Kim J. Predictive genetic risk markers for strong biofilm-forming Staphylococcus aureus: fnbB gene and SCCmec type III. Diagnostic Microbiology and Infectious Disease. 2013;76(4):539–541. doi: 10.1016/j.diagmicrobio.2013.04.021. [DOI] [PubMed] [Google Scholar]
  • 30.Mack D., Fischer W., Krokotsch A., et al. The intercellular adhesin involved in biofilm accumulation of Staphylococcus epidermidis is a linear β-1,6-linked glucosaminoglycan: purification and structural analysis. Journal of Bacteriology. 1996;178(1):175–183. doi: 10.1128/jb.178.1.175-183.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lappin-Scott H. M., Bass C. Biofilm formation: attachment, growth, and detachment of microbes from surfaces. American Journal of Infection Control. 2001;29(4):250–251. doi: 10.1067/mic.2001.115674. [DOI] [PubMed] [Google Scholar]
  • 32.Merino N., Toledo-Arana A., Vergara-Irigaray M., et al. Protein A-mediated multicellular behavior in Staphylococcus aureus. Journal of Bacteriology. 2009;191(3):832–843. doi: 10.1128/jb.01222-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Houston P., Rowe S. E., Pozzi C., Waters E. M., O'Gara J. P. Essential role for the major autolysin in the fibronectin-binding protein-mediated Staphylococcus aureus biofilm phenotype. Infection and Immunity. 2011;79(3):1153–1165. doi: 10.1128/IAI.00364-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Geoghegan J. A., Corrigan R. M., Gruszka D. T., et al. Role of surface protein SasG in biofilm formation by Staphylococcus aureus. Journal of Bacteriology. 2010;192(21):5663–5673. doi: 10.1128/JB.00628-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Schroeder K., Jularic M., Horsburgh S. M., et al. Molecular characterization of a novel Staphylococcus aureus surface protein (SasC) involved in cell aggregation and biofilm accumulation. PLoS ONE. 2009;4(10):p. e7567. doi: 10.1371/journal.pone.0007567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Lasa I., Penadés J. R. Bap: a family of surface proteins involved in biofilm formation. Research in Microbiology. 2006;157(2):99–107. doi: 10.1016/j.resmic.2005.11.003. [DOI] [PubMed] [Google Scholar]
  • 37.Diemond-Hernández B., Solórzano-Santos F., Leaños-Miranda B., Peregrino-Bejarano L., Miranda-Novales G. Production of icaADBC-encoded polysaccharide intercellular adhesin and therapeutic failure in pediatric patients with staphylococcal device-related infections. BMC Infectious Diseases. 2010;15(10):p. 68. doi: 10.1186/1471-2334-10-68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Bazari P. A., Honarmand Jahromy S., Zare Karizi S. Phenotypic and genotypic characterization of biofilm formation among Staphylococcus aureus isolates from clinical specimens, an Atomic Force Microscopic (AFM) study. Microbial Pathogenesis. 2017;110:533–539. doi: 10.1016/j.micpath.2017.07.041. [DOI] [PubMed] [Google Scholar]
  • 39.Vuong C., Kocianova S., Voyich J. M., et al. A crucial role for exopolysaccharide modification in bacterial biofilm formation, immune evasion, and virulence. The Journal of Biological Chemistry. 2004;279(52):54881–54886. doi: 10.1074/jbc.M411374200. [DOI] [PubMed] [Google Scholar]
  • 40.O'Neill E., Pozzi C., Houston P., et al. Association between methicillin susceptibility and biofilm regulation in Staphylococcus aureus isolates from device-related infections. Journal of Clinical Microbiology. 2007;45(5):1379–1388. doi: 10.1128/JCM.02280-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Beenken K. E., Dunman P. M., McAleese F., et al. Global Gene Expression in Staphylococcus aureus Biofilms. Journal of Bacteriology. 2004;186(14):4665–4684. doi: 10.1128/JB.186.14.4665-4684.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Tan X., Qin N., Wu C., et al. Transcriptome analysis of the biofilm formed by methicillin-susceptible Staphylococcus aureus. Scientific Reports. 2015;5(1) doi: 10.1038/srep11997. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data used to support the findings of this study are available from the corresponding author upon request.


Articles from BioMed Research International are provided here courtesy of Wiley

RESOURCES