Skip to main content
NCBI home page
British Journal of Pharmacology logoLink to British Journal of Pharmacology
. 2018 Dec 9;176(3):416–435. doi: 10.1111/bph.14538

Sirtuin 1 represses PKC‐ζ activity through regulating interplay of acetylation and phosphorylation in cardiac hypertrophy

Jingyan Li 1,†, Junying Huang 2,†, Jing Lu 1,†, Zhen Guo 1, Zhuoming Li 1, Hui Gao 1,3, Panxia Wang 1, Wenwei Luo 1, Sidong Cai 1, Yuehuai Hu 1, Kaiteng Guo 1, Luping Wang 1, Zhenzhen Li 1, Minghui Wang 1, Xiaolei Zhang 1,✉, Peiqing Liu 1,✉
PMCID: PMC6329629  PMID: 30414383

Abstract

Background and Purpose

Activation of PKC‐ζ is closely linked to the pathogenesis of cardiac hypertrophy. PKC‐ζ can be activated by certain lipid metabolites such as phosphatidylinositol (3,4,5)‐trisphosphate and ceramide. However, its endogenous negative regulators are not well defined. Here, the role of the sirtuin1‐PKC‐ζ signalling axis and the underlying molecular mechanisms were investigated in cardiac hypertrophy.

Experimental Approach

Cellular hypertrophy in cultures of cardiac myocytes, from neonatal Sprague‐Dawley rats, was monitored by measuring cell surface area and the mRNA levels of hypertrophic biomarkers. Interaction between sirtuin1 and PKC‐ζ was investigated by co‐immunoprecipitation and confocal immunofluorescence microscopy. Sirtuin1 activation was enhanced by resveratrol treatment or Ad‐sirtuin1 transfection. A model of cardiac hypertrophy in Sprague‐Dawley rats was established by abdominal aortic constriction surgery or induced by isoprenaline in vivo.

Key Results

Overexpression of PKC‐ζ led to cardiac hypertrophy and increased activity of NF‐κB, ERK1/2 and ERK5, which was ameliorated by sirtuin1 overexpression. Enhancement of sirtuin1 activity suppressed acetylation of PKC‐ζ, hindered its binding to phosphoinositide‐dependent kinase 1 and inhibited PKC‐ζ phosphorylation in cardiac hypertrophy. Consequently, the downstream pathways of PKC‐ζ' were suppressed in cardiac hypertrophy. This regulation loop suggests a new role for sirtuin1 in mediation of cardiac hypertrophy.

Conclusions and Implications

Sirtuin1 is an endogenous negative regulator for PKC‐ζ and mediates its activity via regulating the acetylation and phosphorylation in the pathogenesis of cardiac hypertrophy. Targeting the sirtuin1‐PKC‐ζ signalling axis may suggest a novel therapeutic approach against cardiac hypertrophy.

Abbreviations

AAC

abdominal aortic constriction

ANF

atrial natriuretic factor

β‐MHC

β‐myosin heavy chain

BNP

brain natriuretic polypeptide

BW

body weight

HW

heart weight

NAD

nicotinamide adenosine dinucleotide

PDK‐1

phosphoinositide‐dependent kinase 1

SIRT1

sirtuin 1

TL

tibial length

Introduction

Cardiac hypertrophy, initiated by a variety of physiological or pathological stimuli, is an adaptive response of the heart to compensate for the loss or decrease of cardiac function. However, chronic cardiac hypertrophy will gradually decrease the cardiac function and eventually progress into heart failure, arrhythmia and sudden death (Haider et al., 1998; Katz, 2002; Heineke and Molkentin, 2006; Meng et al., 2018). Cardiac hypertrophy is characterized by enlargement of cardiomyocyte size and reprogramming of fetal genes in cardiomyocytes, including atrial natriuretic factor (ANF), brain natriuretic polypeptide (BNP) and β‐myosin heavy chain (β‐MHC) (Balakumar and Jagadeesh, 2010; Govindsamy et al., 2018). As multiple complex cellular events are involved in the development of cardiac hypertrophy, the mechanisms underlying are not well understood.

PKC‐ζ is a member of the PKC family of serine/threonine kinases which are involved in a host of cellular processes such as proliferation, differentiation and secretion (Singh et al., 2017a,b). Unlike the classical PKC isoenzymes which are calcium dependent, PKC‐ζ exhibits a kinase activity which is independent of calcium and DAG. The activation of PKC‐ζ is dependent on other lipid‐derived second messengers, such as phosphatidylinositol (3,4,5)‐trisphosphate (PIP3) and ceramide (Simonis et al., 2007; Qvit and Mochly‐Rosen, 2010; Steinberg, 2012). Many studies demonstrate that PKC‐ζ is involved in the activation of MAPK and NF‐κB, which are important signals that participate in cell proliferation and survival, as well as cardiac hypertrophy (Berra et al., 1995; Leitges et al., 2001). The expression and activation of PKC‐ζ in the left ventricle can be significantly augmented in pathological conditions such as volume overload and pressure overload (Bowman et al., 1997; Borges et al., 2008). Over‐activation of PKC‐ζ can increase the expression of ANF in myocardial cells of rats (Decock et al., 1994). On the contrary, knockout of PKC‐ζ prevents cardiac hypertrophy induced by angiotensin II (Ang II) (Garcia‐Hoz et al., 2012). In our previous work, an important mechanism underlying the effect of PKC‐ζ on cardiomyocyte hypertrophy was identified, via interaction and activation of STAT3 (Li et al., 2016). These observations show that PKC‐ζ plays a pivotal role in cardiac hypertrophy.

Sirtuin 1 (SIRT1), a member of class III group of histone deacetylases, contains a highly conserved deacetylase domain (Sosnowska et al., 2017). By deacetylating histones and a growing list of non‐histone proteins, SIRT1 regulates a range of cellular events including cell survival, apoptosis, growth, senescence and metabolism (Finkel et al., 2009). Many studies have suggested that the activation of SIRT1 postpones the progress of cardiac hypertrophy. SIRT1 expression is significantly up‐regulated by pressure overload in the heart, and SIRT1 overexpression protects transgenic mice against cardiac hypertrophy induced by ageing (Alcendor et al., 2007). Moreover, SIRT1 showed protective effects on cardiac hypertrophy induced by phenylephrine, isoprenaline or Ang II treatment (Planavila et al., 2011; Geng et al., 2013).

Although it is well known that PKC‐ζ can be activated by certain lipid metabolites (Steinberg, 2012), it remains unexplored whether endogenous negative regulators of PKC‐ζ participate in the cardiac hypertrophic response. In our preliminary studies, we found that SIRT1 could markedly inhibit the activation of PKC‐ζ in the pathogenesis of cardiac hypertrophy. As SIRT1 is a deacetylase, we hypothesized that SIRT1 might regulate the acetylation of PKC‐ζ, thereby altering its phosphorylation and activation. Therefore, the present study was designed to investigate the regulatory role of SIRT1 in cardiac hypertrophy and the mechanism of modulating PKC‐ζ.

Methods

Animals

All animal care and experimental procedures complied with the Guide for the Care and Use of Laboratory Animals (NIH Publication No. 85‐23, revised 1996), were in accordance with the China Animal Welfare Legislation and were approved by the Research Ethics Committee of Sun Yat‐sen University. Animal studies are reported in compliance with the ARRIVE guidelines (Kilkenny et al., 2010; McGrath and Lilley, 2015). Sprague Dawley (SD) rats (male, weighing 200–220 g, specific pathogen free (SPF) grade, certification no. 44005800004147) (RGD ID: 70508, RRID:RGD_70508) were supplied by the Experimental Animal Center of Guangzhou University of Chinese Medicine (Guangzhou, China). SD rats were housed under controlled environmental conditions (12:12 h light/dark cycle and room temperature 21–23°C) and SPF and had free access to standard laboratory food pellets and water.

Abdominal aortic constriction (AAC) surgery

Pressure overload was induced by AAC according to procedures previously described (Phrommintikul et al., 2008). SD rats were randomized into two groups and anaesthetized with sodium pentobarbital (30 mg·kg−1, i.p.). Fentanyl (0.16 mg·kg−1, s.c.) was given as an analgesic agent. The adequacy of anaesthesia was monitored by evaluating and recording body temperature, cardiac and respiratory rates and pattern, muscle relaxation and lash reflex. Under sterile conditions, the abdominal aorta above the kidneys was exposed through a midline abdominal incision and constricted at the suprarenal level with a 4‐0 silk suture tied around both the aorta and a blunted 22‐gauge needle. The needle was promptly removed after constriction. Sham‐operated group underwent a similar procedure without banding the aorta. SD rats were submitted to AAC surgery (8 weeks) and randomly assigned to treatment with the SIRT1 activator resveratrol (150 mg·kg−1·day−1, intragastric, for 4 weeks) or its vehicle (carboxymethyl cellulose sodium).

Intramyocardial delivery of recombinant adenovirus or adeno‐associated virus

SD rats were randomized into two groups and anaesthetized with sodium pentobarbital (30 mg·kg−1, i.p.). Fentanyl (0.16 mg·kg−1, s.c.) was given as an analgesic agent and then rats were endotracheally intubated and ventilated with a respirator. To expose the heart, a small left oblique thoracotomy was conducted at the left third to fourth intercostal space. For direct gene delivery, 200 μL of adenovirus (1010 particles) or adeno‐associated virus (1012 particles) were injected into five to six sites along the left ventricular walls by a curved 25‐gauge needle (Lu et al., 2016). After the operation, the surgical wound was sutured, and gentamicin was given to prevent infection. And then isoprenaline (1.5 mg·kg−1·day−1) was subcutaneously injected for seven consecutive days to induce cardiac hypertrophy. The vehicle control group was given equal treatments of normal saline.

Echocardiography

After treatment, rats were anaesthetized with isoflurane (3%); two‐dimensional‐guided M‐mode echocardiography was performed by a Technos MPX ultrasound system (ESAOTE, Italy) (Vevo 2100, RRID:SCR_015816) (Zhou et al., 2006). Afterwards, the rats were killed, and then, their hearts were quickly removed for trimming the left ventricles. Five‐micrometre‐thick histological cross sections of the heart tissues were stained with haematoxylin–eosin (HE) for morphometric measurement.

Cell culture

Primary cultures of neonatal rat cardiomyocytes (NRCMs), isolated from the hearts of SD rats (1‐ to 3‐day‐old) and identified via a specific assay, were prepared as previously described (Feng et al., 2015). The cardiomyocytes were purified and seeded at a density of 1 × 106 cells per well onto six‐well plates and then maintained in DMEM supplemented with 10% FBS and 5‐bromodeoxyuridine (0.1 mM) at 37°C with 5% CO2. After 48 h, NRCMs were incubated in serum‐free medium for 24 h before treatment with phenylephrine or other stimuli.

Transfections of plasmids and small‐interfering RNA

PcDNA3‐myc‐SIRT1 and pcDNA3‐myc‐H363Y plasmids were provided by Kaipeng Huang (The First Affiliated Hospital, Sun Yat‐sen University). PKC‐ζ plasmid was constructed with pEGFP‐N3 and confirmed by DNA sequencing in Sangon Biotech Co., Ltd (Shanghai, China). Cardiomyocytes were transiently transfected with plasmids using Lipofectamine LTX & Plus according to the manufacturer's instructions. The sequences for small‐interfering RNA (siRNA) of SIRT1 (si‐SIRT1), PKC‐ζ (si‐PKC‐ζ), phosphoinositide‐dependent kinase 1 (PDK‐1) (si‐PDK‐1) and negative control siRNA (si‐NC) were purchased from Genema (Shanghai, China). The sequences of siRNAs are listed in Supporting Information Table S1. Cells were transfected with siRNAs using RNAiMAX transfection reagent according to the manufacturer's protocol and then incubated for 48 h before harvesting.

Adenovirus infection

Adenovirus expressing PKC‐ζ (Ad‐PKC‐ζ), SIRT1 (Ad‐SIRT1) and GFP (Ad‐GFP) were constructed by Vigene Biosciences (Shandong, China). Cells were exposed to Ad‐PKC‐ζ or Ad‐GFP at the multiplicity of infection of 60 for 48 h before they were harvested for RNA or protein extraction. Adeno‐associated virus expressing the si‐RNA sequence of PKC‐ζ was constructed by Hanbio Biotechnology (Shanghai, China). Adenovirus expressing mutant‐SIRT1 (Ad‐H363Y) was constructed by Genechem (Shanghai, China).

Immunofluorescence assay

Cardiomyocytes were seeded and cultured on glass coverslips. After treatment, cells were washed three times with cold PBS, fixed with 4% paraformaldehyde for 10 min and then permeabilized with 0.3% TritonX‐100 for 10 min at room temperature. After another three washes, cells were blocked for 30 min using 10% goat serum, and then, the cells were incubated with rabbit monoclonal antibody against SIRT1 (diluted 1:100) (Cell Signaling Technology Cat# 9475, RRID:AB_2617130), rabbit polyclonal antibody against PDK‐1 (diluted 1:100) (Cell Signaling Technology Cat# 3062, RRID:AB_2236832) or mouse monoclonal antibody against PKC‐ζ (diluted 1:50) (Santa Cruz Biotechnology Cat# sc‐17781, RRID:AB_628148) overnight at 4°C. After incubation with Alexa Fluor 488‐conjugated anti‐rabbit IgG (H + L) secondary antibody (Cell Signaling Technology Cat# 4412, RRID:AB_1904025) and Alexa Fluor 594‐conjugated anti‐mouse IgG (H + L) secondary antibody (diluted 1:200, Cell Signaling Technology Cat# 4409, RRID:AB_1904022) for 1 h at room temperature, DAPI (Cell Signaling Technology, Cat# 4083) was used to stain the nuclei for 10 min, and then, cells were examined with a confocal microscope (LSM710, Carl Zeiss, Germany).

Assay of SIRT1 deacetylase activity

To measure SIRT1 deacetylase activity, a fluorometric assay kit (CY‐1151V2; CycLex, Ina, Nagano, Japan) was used according to the manufacturer's instructions. After appropriate treatments, extracts of NRCMs (200 μg) were immunoprecipitated with mouse anti‐SIRT1 antibody (diluted 1:100) (Cell Signaling Technology Cat# 8469S, RRID:AB_10999470) overnight and then incubated with 20 μL of protein A/G‐agarose beads (Pierce, Rockford, IL, USA) (Thermo Fisher Scientific Cat# 20241) at 4°C for 4 h. The beads were extensively washed, followed by deacetylation assay. First, ‘Distilled water’, ‘SIRT1 Assay Buffer’, ‘Fluoro‐Substrate Peptide’ and ‘NAD’ were added into microtiter plate wells, and then, ‘Developer’ was added into each well for mixing. Reactions were initiated by adding ‘the beads’ or ‘Buffer of Enzyme Sample’ or ‘Recombinant SIRT1’ to each well at room temperature. Finally, the fluorescence was measured at 360 nm excitation and 460 nm emission using a microplate reader (Tecan, Mannedorf, Switzerland).

Nicotinamide adenosine dinucleotide (NAD) determination

The NAD levels were measured as described previously (Yu et al., 2013) with a slight modification. The cells were suspended in 200 μL of 0.5 M perchloric acid. The cell extract was centrifuged at 12 000× g for 10 min after neutralization with an equal volume of 1 M KOH and 0.33 M KH2PO4/K2HPO4 (pH 7.5). The supernatant (50 μL, or NAD standard) was added to 200 μL of NAD reaction mixture [600 mM ethanol, 0.5 mM 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyl tetrazolium bromide, 2 mM phenazine ethosulfate, 5 mM EDTA, 1 mg·mL−1 of BSA and 120 mM bicine, pH 7.8] and incubated for 5 min at 37°C. The reaction was initiated by the addition of 25 mL of alcohol dehydrogenase (0.5 mg·mL−1 in 100 mM bicine, pH 7.8) and stopped by addition of 250 mL of 12 mM iodoacetate after incubation for 20 min at 37°C. The absorbance of the reaction mixture was read at 570 nm. The NAD content was calculated from the standard curve and normalized to the protein content of the sample.

Measurement of cell surface area

Cardiomyocytes, seeded in 48‐well plates, were fixed with 4% paraformaldehyde for 10 min at room temperature, and further incubated with 0.3% TritonX‐100 for 10 min, and then incubated with 0.1% rhodamine phalloidin for 1 h. After washing with PBS, the cells were incubated with DAPI (Cell Signaling Technology, Cat# 4083) and assessed by High Content Screening System (Thermo, Arrayscan VTi 600 Plus, USA). The cell surface area from randomly selected fields (50 for each group) was measured.

Western blot assay

Western blot assays were performed as previously described (Huang et al., 2017). Cardiomyocytes or heart tissues were harvested and lysed for extracting proteins. Equal amounts of protein (40 μg of total protein and 15 μg of nuclear protein) were separated by 8% SDS‐PAGE and then transferred onto PVDF membranes (Millipore, USA). The membranes were incubated at 4°C with primary antibodies overnight. After incubation, the membranes were washed with 0.1% Tween‐20/TBS and incubated with the second antibodies at room temperature for 1 h. The signals of protein level were visualized by Image Quant LAS 4000 mini produced by GE healthcare (Waukesha, WI, USA) and analysed using the Quantity One Protein Analysis Software (Bio‐Rad Laboratories, Hercules, CA, USA) (Version 4.6.2, RRID:SCR_016622).

Immunoprecipitation assay

A total of 200 μg protein was incubated with anti‐SIRT1 (mouse, diluted 1:100) or anti‐PKC‐ζ (diluted 1:50) antibodies overnight (normal IgG was used as control) and incubated with protein A/G‐agarose beads (Pierce) at 4°C for 4 h. The immunoprecipitated proteins were assayed by Western blotting, as described above.

Quantitative real‐time PCR (qRT‐PCR)

Total RNA was extracted from rat cardiac tissues or primary cultures of cells with Trizol reagent (Takara Biotechnology, Dalian, China), and 2 μg of total RNA was reversely transcribed to cDNA using Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA). The mRNA levels were determined using SYBR‐Green Quantitative PCR kit (TOYOBO, Japan) by iCycler iQ system (iCycler, Bio‐Rad). The amplification conditions were as follows: 5 min at 95°C, followed by 40 cycles of 30 s at 95°C, 1 min at 55°C and 30 s at 72°C. Rat‐specific primers for ANF, BNP, β‐MHC and SIRT1 were synthesized by Sangon (Supporting Information Table S2). mRNA levels of target genes were measured by qRT‐PCR and quantified with respect to the β‐actin housekeeping gene. The fold increase or decrease relative to control cells presented was calculated by the 2−ΔΔCt method.

Nuclear protein extraction and EMSA

The DNA binding activity of NF‐κB was determined by EMSA according to manufacturer's instruction using a Nuclear Extract Kit (Active Motif, Rixensart, Belgium). The sequences of the biotin‐labelled oligonucleotide probes for NF‐κB were 5′‐AGTTGAGGGGACTTTCCCAGGC‐3′, 3′‐TCAACTCCCCTGAAAGGGTCCG‐5′. Five micrograms of nuclear protein was incubated with the mixture [50 ng·mL−1 poly (dIdC), 0.05% Nonidet P‐40, 5 mM MgCl2 and 2.5% glycerol] for 10 min and then incubated with NF‐κB probes for 20 min at room temperature. The mixtures were separated by non‐denaturing PAGE and transferred to nylon membrane for DNA‐protein crosslinks. After blocking for 1 h, the membrane was incubated with HRP‐conjugated streptavidin antibodies (1:300) for 15 min and then visualized by Image Quant LAS 4000 mini.

Data and statistical analysis

The data and statistical analysis in this study comply with the recommendations on experimental design and analysis in pharmacology (Curtis et al., 2018).The data are presented as mean ± SEM. Statistical analyses between two groups were performed with unpaired Student's t‐test. Differences among groups were assessed by one‐way ANOVA with the Bonferroni post hoc test. In all cases, a value of P < 0.05 was considered statistically significant.

Materials

Phenylephrine was purchased from Tocis Bioscience (Bristol, UK) (Tocris Bioscience Cat# 2838). DMEM (Thermo Fisher Scientific Cat# 41965062), FBS (Thermo Fisher Scientific Cat# 10099141), RNAiMAX transfection reagent (Thermo Fisher Scientific Cat# 13778075) and LTX reagent with PLUS™ reagent (Thermo Fisher Scientific Cat# 15338030) were purchased from Life Technologies (Grand Island, NY, USA). Primary antibodies against SIRT1 (mouse, diluted 1:1000), SIRT1 (rabbit, diluted 1:1000), p65 (rabbit, diluted 1:1000) (Abcam Cat# ab16502, RRID:AB_443394), phospho‐ERK1/2 (Thr202/Tyr204) (rabbit, diluted 1:2000) (Cell Signaling Technology Cat# 4370, RRID:AB_2315112), ERK1/2 (rabbit, diluted 1:1000) (Cell Signaling Technology Cat# 9102, RRID:AB_330744), phospho‐ERK5 (rabbit, diluted 1:1000) (Cell Signaling Technology Cat# 3371S, RRID:AB_2140426), acetylated‐Lysine (rabbit, diluted 1:1000) (Cell Signaling Technology Cat# 9441, RRID:AB_331805), phospho‐PDK‐1 (rabbit, diluted 1:1000) (Cell Signaling Technology Cat# 3061S, RRID:AB_2161919) and PDK‐1 (rabbit, diluted 1:1000) (Cell Signaling Technology Cat# 3062, RRID:AB_2236832) were purchased from Cell Signaling Technology (Boston, USA). Resveratrol was purchased from Aladdin (Shanghai, China). Isoprenaline(Sigma‐Aldrich, Cat# I5627), EX527 (selisistat; Sigma‐Aldrich, Cat# E7034) and antibodies against phospho‐PKC‐ζ (Thr410) (rabbit, diluted 1:1000) (Sigma‐Aldrich, Cat# SAB4503773, RRID:AB_2750603), β‐MHC (mouse, diluted 1:10000) (Sigma‐Aldrich Cat# M8421, RRID:AB_477248) and α‐tubulin (mouse, diluted 1:1000) (Sigma‐Aldrich Cat# T8203, RRID:AB_1841230) and NAD (Sigma‐Aldrich, Cat# NAD100‐RO) were obtained from Sigma‐Aldrich Corporation (St. Louis, MO, USA). Antibodies against Lamin B1 (rabbit, diluted 1:1000) (Abcam Cat# ab133741, RRID:AB_2616597) and ERK5 (rabbit, diluted 1:1000) (Abcam Cat# ab40809, RRID:AB_732214) were purchased from Abcam (Cambridge, MA, USA). Antibody against total PKC‐ζ (mouse, diluted 1:500) and ANF (mouse, diluted 1:500) (Santa Cruz Biotechnology Cat# sc‐80686, RRID:AB_2155598) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). GSK2334470 was purchased from Selleckchem (USA).

Nomenclature of targets and ligands

Key protein targets and ligands in this article are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Harding et al., 2018), and are permanently archived in the Concise Guide to PHARMACOLOGY 2017/18 (Alexander et al., 2017a, 2017b).

Results

SIRT1 blocked AAC‐induced cardiac hypertrophic response in rat model

To explore the role of SIRT1 in cardiac hypertrophy, we employed an in vivo AAC model of cardiac hypertrophy and the SIRT1 activator resveratrol (Biala et al., 2010). The hearts of AAC rats were clearly larger than those of sham‐operated animals (sham) and presented with typical hypertrophic changes as demonstrated by gross morphologic examination, HE staining and echocardiography (Figure 1A–J). Echocardiography revealed a tendency for increases in interventricular septum, left ventricular posterior wall thickness, ejection fraction (%) and fractional shortening (%), as well as a tendency for reduced left ventricular internal diameter in isoprenaline‐treated rats (Figure 1E–J). The heart weight‐to‐body weight (HW/BW) ratio and heart weight‐to‐tibial length (HW/TL) ratio were both enhanced by AAC surgery (Figure 1K,L). In addition, the levels of hypertrophic marker β‐MHC and ANF were markedly elevated in the hearts of the AAC group (Figure 1M). These results indicated the successful induction of cardiac hypertrophy by AAC surgery. Rats were treated with resveratrol (150 mg·kg−1·day−1, intragastric) for 4 weeks after AAC surgery. As shown in Figure 1A–M, resveratrol protected the rats against AAC‐induced cardiac hypertrophy. Also, the acetylation and phosphorylation of PKC‐ζ was increased by AAC but inhibited by treatment with resveratrol (Figure 1N,O). In summary, these results demonstrated the protective role of SIRT1 in cardiac hypertrophy induced by AAC surgery, and that PKC‐ζ may be modulated by SIRT1 in this process.

Figure 1.

Figure 1

Open in a new tab

SIRT1 blocked AAC‐induced cardiac hypertrophy in vivo. SD rats were treated with AAC surgery with 8 weeks for recovery, followed by treatment with the SIRT1 activator reseveratrol (RSV; 150 mg·kg−1·day−1, i.g.) for 4 weeks. (A–J) Hypertrophic changes of the hearts were observed by gross morphologic examination (A), HE staining (B, C) and echocardiography (D–J). Scale bar: 5 mm (B), 50 μm (C). (K, L) The HW/BW and HW/TL ratios were calculated. (M, O) The protein expression of β‐MHC, ANF, phosphorylated PKC‐ζ (p‐PKC‐ζ‐Thr410) and total PKC‐ζ were measured by Western blotting. (N) Immunoprecipitation analysis showed the acetylation level of PKC‐ζ. Data are presented as means ± SEM. *P < 0.05, significantly different from sham + CMC‐Na group; # P < 0.05, significantly different from AAC + CMC‐Na group, n = 8. CMC‐Na, carboxymethyl cellulose sodium. EF, ejection fraction; FS, fractional shortening; IVS, interventricular septum; LVPW, left ventricular posterior wall thickness.

SIRT1 negatively regulated isoprenaline‐induced cardiac hypertrophy in vivo

We further determined whether SIRT1 overexpression in rat hearts could rescue cardiac function in vivo. Adenovirus encoding SIRT1 (Ad‐SIRT1) and mutant‐SIRT1 (Ad‐H363Y), which lacked deacetylase activity, were introduced into the rat left ventricle via intramyocardial injection. Then SD rats were injected with isoprenaline (1.5 mg·kg−1·day−1 ; s.c.) for 7 days. As shown in Figure 2A–M, the delivery of Ad‐SIRT1 markedly repressed isoprenaline‐induced cardiac hypertrophy in vivo. However, the delivery of Ad‐H363Y failed to repress isoprenaline‐induced cardiac hypertrophy in vivo (Supporting Information Figure S1A–N). These results implied that overexpression of SIRT1 protected rats from cardiac hypertrophy induced by isoprenaline treatment in vivo and this protective effect depended on the deacetylase activity of SIRT1.

Figure 2.

Figure 2

Open in a new tab

SIRT1 negatively regulated isoprenaline‐induced cardiac hypertrophy in vivo. SD rats received intramyocardial injections of adenovirus encoding SIRT1 (Ad‐SIRT1, 1010 particles), the control animals received GFP (Ad‐GFP, 1010 particles), followed by isoprenaline injections (1.5 mg·kg−1·d−1, s.c., 7 days) or an equal volume of normal saline (NS). (A–D and F–K) Hypertrophic changes of the hearts were observed by gross morphologic examination (A), HE staining (B, C) and echocardiography (D and F–K). (E) The protein expression of SIRT1 was shown by IHC staining. Scale bar: 5 mm (B), 50 μm (C), 50 μm (E). (L) The HW/BW ratio was calculated. (M, O) The protein expression of β‐MHC, phosphorylated PKC‐ζ (p‐PKC‐ζ‐Thr410) and total PKC‐ζ were measured by Western blotting. (N) Immunoprecipitation analysis showed the acetylation level of PKC‐ζ. Data are presented as means ± SEM. *P < 0.05, significantly different from Ad‐GFP + NS group; # P < 0.05, significantly different from Ad‐GFP + ISO group, n = 6. EF, ejection fraction; FS, fractional shortening; IVS, interventricular septum; LVPW, left ventricular posterior wall thickness.

Furthermore, PKC‐ζ acetylation and PKC‐ζ phosphorylation (Thr410) were increased by isoprenaline treatment and such increases were suppressed by Ad‐SIRT1 treatment (Figure 2N,O). These results demonstrated that SIRT1 negatively regulated the modulation of the acetylation and phosphorylation of PKC‐ζ in cardiac hypertrophy in vivo.

PKC‐ζ was required for hypertrophic response in vivo

Tthe acetylation and phosphorylation (Thr410) of PKC‐ζ was increased in cardiac hypertrophy in vivo and this increased was blocked by SIRT1 activation or Ad‐SIRT1 treatment. To investigate the involvement of PKC‐ζ in cardiac hypertrophy, adeno‐associated virus encoding the si‐RNA sequence of PKC‐ζ (AAV‐si‐PKC‐ζ) was introduced into the rat left ventricle via intramyocardial injection. As shown, the delivery of AAV‐si‐PKC‐ζ clearly attenuated the hypertrophic response, as demonstrated by gross morphologic examination, HE staining, echocardiography (Figure 3A–J), the HW/BW and HW/TL ratios and the expression of hypertrophic marker genes (Figure 3K–M). Taken together, our results showed that PKC‐ζ was required for cardiac hypertrophy.

Figure 3.

Figure 3

Open in a new tab

PKC‐ζ was required for the hypertrophic response in vivo. SD rats received intramyocardial injections of adeno‐associated virus encoding si‐PKC‐ζ (AAV‐si‐PKC‐ζ, 1012 particles), the control animals received si‐NC (AAV‐si‐NC, 1012 particles), followed by isoprenaline injection (1.5 mg·kg−1·day−1, s.c., 7 days) or an equal volume of normal saline (NS). (A–J) Hypertrophic changes of the hearts were observed by gross morphologic examination (A), HE staining (B, C) and echocardiography (D–J). Scale bar: 5 mm (B), 50 μm (C). (K, L) The HW/BW and HW/TL ratios were calculated. (M) The protein expressions of β‐MHC, ANF and PKC‐ζ were measured by Western blotting. Data are presented as means ± SEM. *P < 0.05, significantly different from AAV‐si‐NC + NS group; # P < 0.05, significantly different from AAV‐si‐NC + ISO group, n = 8. AAV‐si‐P, AAV‐si‐PKC‐ζ. EF, ejection fraction; FS, fractional shortening; IVS, interventricular septum; LVPW, left ventricular posterior wall thickness.

PKC‐ζ activation was elevated and SIRT1 enzyme activity was suppressed in phenylephrine‐induced cardiomyocyte hypertrophy

Phenylephrine has been widely utilized as a stimulus of cardiac hypertrophy (Liu et al., 2015). Cultures of NRCMs were incubated with 100 μM phenylephrine for the times indicated. Cardiomyocyte hypertrophy was induced by treatment with phenylephrine for 24 h, as indicated by the increased cardiomyocyte surface area (Figure 4A) and the mRNA levels of the hypertrophic markers, including ANF and BNP (Figure 4B). In these hypertrophic cardiomyocytes, PKC‐ζ phosphorylation (Thr410) was significantly elevated, and there was no visible change on total PKC‐ζ expression (Figure 4C), indicating that PKC‐ζ activity was augmented in response to phenylephrine stimulation.

Figure 4.

Figure 4

Open in a new tab

PKC‐ζ activation was elevated, and SIRT1 enzyme activity was suppressed in cardiomyocyte hypertrophy, induced by phenylephrine (PE). Cultured NRCMs were incubated with 100 μM phenylephrine for the indicated durations. (A) Cell surface area was measured by rhodamine‐phalloidin staining. Scale bar: 20 μm. (B, D) The mRNA levels of hypertrophic biomarkers (ANF and BNP) and SIRT1 were detected by qRT‐PCR. (C, E) The protein expressions of phosphorylated PKC‐ζ (p‐PKC‐ζ‐Thr410), total PKC‐ζ and SIRT1 were measured by Western blotting. (F, G) The SIRT1 deacetylase activity (F) and intracellular NAD contents (G) were measured, in primary NRCMs stimulated with phenylephrine (100 μM) for the indicated times. (H) The SIRT1 deacetylase activity was measured in primary NRCMs pretreated with NAD (50 mM) for 1 h followed by treatment with phenylephrine (100 μM) for 24 h. Data are presented as means ± SEM. *P < 0.05, significantly different from control (CON), n = 5.

The expression of SIRT1 was determined by qRT‐PCR and Western blotting. As shown in Figure 4D,E, the mRNA and protein levels of SIRT1 were significantly increased by phenylephrine treatment, compared to the control, while its deacetylase activity was markedly decreased by phenylephrine treatment in a time‐dependent manner (Figure 4F). Phenylephrine treatment also significantly reduced the NAD content of cardiomyocytes in a time‐dependent manner (Figure 4G). To explore the effect of NAD on deacetylase activity of SIRT1, primary cultures of NRCMs were preincubated with 50 mM NAD followed by treatment with or without 100 μM phenylephrine for 24 h. The results showed that the phenylephrine‐induced decrease in SIRT1 deacetylase activity was partly blocked by NAD supplementation (Figure 4H). These observations suggested that PKC‐ζ was activated when SIRT1 activity was repressed in phenylephrine‐induced cardiomyocyte hypertrophy, and the reduction of deacetylase activity of SIRT1 may be attributed to the decline of NAD in cardiac hypertrophy. The up‐regulation of SIRT1 induced by phenylephrine may be a compensatory mechanism and counteracted by reduced enzyme activity.

PKC‐ζ was required for hypertrophic response in cardiomyocytes induced by phenylephrine

To study the role of PKC‐ζ in the cardiomyocytes, we examined the effect of PKC‐ζ on the hypertrophic response in NRCMs. NRCMs were transfected with Ad‐PKC‐ζ or an empty vector for 48 h with or without phenylephrine treatment (Figure 5A). The cardiomyocyte hypertrophy was monitored by measuring cell surface area and the mRNA levels of ANF and BNP, which are biomarkers of the hypertrophic response (Du, 2007). As shown in Figure 5B,C, the cell surface area and the mRNA levels of ANF and BNP were significantly elevated by Ad‐PKC‐ζ and phenylephrine stimulation. Data showed that both Ad‐PKC‐ζ and phenylephrine stimulation increased nuclear p65 protein level (Figure 5D), promoted the binding activity of NF‐κB to target probes (Figure 5E) and up‐regulated the levels of phosphorylated ERK1/2 and ERK5 (Figure 5F,G). Taken together, these results indicated that overexpression of PKC‐ζ increased cardiomyocyte hypertrophy, enhanced NF‐κB activity and activated ERK1/2 and ERK5 signal pathways in NRCMs. These effects were enhanced when Ad‐PKC‐ζ and phenylephrine were used concurrently.

Figure 5.

Figure 5

Open in a new tab

PKC‐ζ overexpression enhanced hypertrophic response in primary NRCMs. Cardiomyocytes were infected with Ad‐PKC‐ζ or an empty vector for 48 h with or without phenylephrine (PE) treatment. (A) The protein expression of PKC‐ζ was measured by Western blotting. (B) Cell surface area was measured by rhodamine‐phalloidin staining. Scale bar: 20 μm. (C) The mRNA levels of hypertrophic biomarkers (ANF and BNP) were detected by qRT‐PCR. (D) Western blot analysis showed the protein level of p65 in the nucleus. (E) The DNA binding activity of NF‐κB was determined by EMSA. The graph shows one representative experiment of five independent experiments. (F, G) The protein expressions of phosphorylated ERK1/2 (p‐ERK1/2), total ERK1/2, phosphorylated ERK5 (p‐ERK5) and total ERK5 were measured by Western blotting. Data are presented as means ± SEM. *P < 0.05, significantly different from Ad‐GFP, # P < 0.05, significantly different from Ad‐GFP + PE, n = 5.

To investigate the effect of endogenous PKC‐ζ on phenylephrine‐induced cardiomyocyte hypertrophy, PKC‐ζ was knocked down by RNA interference in NRCMs. In line with our previous work (Li et al., 2016), knockdown of PKC‐ζ (Figure 6A) protected cardiomyocytes from phenylephrine‐stimulated hypertrophy, as revealed by the decrease of the cell surface area (Figure 6B), as well as the mRNA levels of ANF and BNP (Figure 6C). Data showed that knockdown of PKC‐ζ clearly reversed the increase of nuclear p65 (Figure 6D), the DNA binding activity of NF‐κB (Figure 6E) and the activation of ERK1/2 and ERK5 (Figure 6F,G), as induced by treatment with phenylephrine.

Figure 6.

Figure 6

Open in a new tab

PKC‐ζ was required for hypertrophic response in cardiomyocytes induced by phenylephrine (PE). NRCMs were transfected with PKC‐ζ siRNA (si‐PKC‐ζ) or negative control (si‐NC) for 24 h and treated with or without 100 μM phenylephrine for another 24 h. (A) The protein expression of PKC‐ζ was measured by Western blotting. (B) Cell surface area was measured by rhodamine‐phalloidin staining. Scale bar: 20 μm. (C) The mRNA levels of hypertrophic biomarkers (ANF and BNP) were detected by qRT‐PCR. (D) Western blot analysis showed the protein level of p65 in the nucleus. (E) The DNA binding activity of NF‐κB was determined by EMSA. The graph shows one representative experiment of five independent experiments. (F, G) The protein expressions of phosphorylated ERK1/2 (p‐ERK1/2), total ERK1/2, phosphorylated ERK5 (p‐ERK5) and total ERK5 were measured by Western blotting. Data were presented as means ± SEM. *P < 0.05, significantly different from si‐NC, # P < 0.05, significantly different from si‐NC + PE, n = 5.

These findings suggested that PKC‐ζ increased the cardiomyocyte hypertrophic response and the mechanism(s) underlying the effect of PKC‐ζ on cardiomyocyte hypertrophy involved the regulation of NF‐κB, ERK1/2 and ERK5 signal pathways.

SIRT1 protected cardiomyocytes from cardiac hypertrophy induced by phenylephrine and regulated nuclear translocation of NF‐κB and activation of ERK1/2, ERK5 via PKC‐ζ

To confirm the role of SIRT1 in cardiomyocyte hypertrophy, NRCMs were infected with plasmid expressing wild‐type SIRT1 (SIRT1) or the catalytically inactive SIRT1 mutant plasmid (H363Y). Both the expression and deacetylase activity of SIRT1 were raised in cells transfected with wild‐type SIRT1. However, in cells transfected with the mutant H3463Y, the protein expression of SIRT1 was increased, but its deacetylase activity remained at control level (Figure 7A,B). As shown in Figure 7C,D, SIRT1 overexpression clearly attenuated the hypertrophic response triggered by phenylephrine, as demonstrated by the reduction of cell surface area and mRNA levels of ANF and BNP. However, overexpression of H363Y showed no obvious effect on hypertrophic response. To further determine the role of SIRT1 in cardiac hypertrophy, the effect of endogenous SIRT1 on the hypertrophic response was also elucidated by silencing the SIRT1 gene. As shown in Figure 7E, both phenylephrine treatment and SIRT1 knockdown significantly augmented the cell surface area in NRCMs, accompanied by increase of mRNA levels of ANF and BNP (Figure 7F). These results implied that SIRT1 protected cardiomyocytes against hypertrophy stress induced by phenylephrine treatment in vitro and this protective effect depended on the deacetylase activity of SIRT1.

Figure 7.

Figure 7

Open in a new tab

SIRT1 protected cardiomyocytes from cardiac hypertrophy induced by phenylephrine via inhibiting PKC‐ζ activation. Cardiomyocytes were transfected with plasmids expressing wild‐type SIRT1 (SIRT1), a mutant SIRT1 (H363Y) or vector for 48 h, and then whole‐cell lysates were extracted to measure the protein expression (A) and deacetylase enzyme activity (B) of SIRT1. Data are presented as means ± SEM. *P < 0.05, significantly different from Vector, # P < 0.05, significantly different from versus SIRT1, n = 5. (C) Cell surface area was measured by rhodamine‐phalloidin staining. Scale bar: 20 μm. (D) The mRNA levels of hypertrophic biomarkers (ANF and BNP) were detected by qRT‐PCR. Data were presented as means ± SEM. *P < 0.05, significantly different from Vector, # P < 0.05, significantly different from Vector + PE, n = 5. NRCMs were transfected with SIRT1 siRNA (si‐SIRT1) or negative control (si‐NC) for 24 h and treated with or without 100 μM phenylephrine for another 24 h. (E) Cell surface area was measured by rhodamine‐phalloidin staining. Scale bar: 20 μm. (F) The mRNA levels of hypertrophic biomarkers (ANF and BNP) were detected by qRT‐PCR. Data are presented as means ± SEM.*P < 0.05, significantly different from si‐NC, n = 5. NRCMs were transfected with si‐SIRT1 or (and) si‐PKC‐ζ with or without phenylephrine treatment. (G) Cell surface area was measured by rhodamine‐phalloidin staining. Scale bar: 20 μm. (H) Western blot analysis showed the protein levels of SIRT1 and PKC‐ζ. (I) The mRNA levels of hypertrophic biomarkers (ANF and BNP) were detected by qRT‐PCR. (J) The protein level of p65 in the nucleus was measured by Western blotting. (K) The DNA binding activity of NF‐κB was determined by EMSA. The graph showed one representative experiment of five independent experiments. (L) The protein expressions of phosphorylated ERK1/2 (p‐ERK1/2), total ERK1/2, phosphorylated ERK5 (p‐ERK5) and total ERK5 were measured by Western blotting. Data were presented as means ± SEM, *P < 0.05, significantly different from si‐NC, # P < 0.05, significantly different from si‐NC + PE, $ P < 0.05, significantly different from si‐SIRT1, & P < 0.05, significantly different from si‐SIRT1 + PE, n = 5.

Next, we analysed the role of PKC‐ζ in hypertrophic response induced by SIRT1 knockdown. Cardiomyocytes were transfected with SIRT1 siRNA (si‐SIRT1), PKC‐ζ siRNA (si‐PKC‐ζ) and negative control (si‐NC) for 48 h with or without phenylephrine treatment (Figure 7H). Si‐PKC‐ζ protected cardiomyocytes from hypertrophy induced both by phenylephrine treatment and si‐SIRT1 transfection, as revealed by the decrease of the cell surface area (Figure 7G), as well as the mRNA levels of ANF and BNP (Figure 7I). In addition, si‐PKC‐ζ clearly reversed the increase of nuclear p65 (Figure 7J), the DNA binding activity of NF‐κB (Figure 7K) and the activation of ERK1/2 and ERK5 (Figure 7L) induced by phenylephrine treatment or si‐SIRT1 transfection. These results suggested that critical signalling pathways in cardiac hypertrophy such as those involving NF‐κB, ERK1/2 and ERK5 could be regulated by PKC‐ζ and SIRT1. SIRT1 may neutralize the stimulation by PKC‐ζ of these pathways in the hypertrophic response, and this effect may indicate the mechanism underlying the protection by SIRT1 against cardiac hypertrophy.

SIRT1 mediated PKC‐ζ activity via regulating acetylation and phosphorylation of PKC‐ζ in cardiac hypertrophy

The activity of PKC‐ζ can be demonstrated by measuring phosphorylation of PKC‐ζ at threonine410 because the activation of PKC‐ζ is dependent on phosphorylation at this site (Hirai and Chida, 2003). In hypertrophic NRCMs induced by phenylephrine, the phosphorylation level of PKC‐ζ at Thr410 was significantly increased, but the protein level of total PKC‐ζ was not altered (Figure 8A,B). However, PKC‐ζ phosphorylation (Thr410) was suppressed by SIRT1 overexpression in phenylephrine‐induced hypertrophy. By contrast, the decrease of PKC‐ζ phosphorylation (Thr410) was not observed when the cells were transfected with mutant SIRT1 (H363Y) which lacked the deacetylase activity, indicating that the inhibition of PKC‐ζ by SIRT1 depended on the deacetylase activity of SIRT1.

Figure 8.

Figure 8

Open in a new tab

SIRT1 negatively regulated the phosphorylation level of PKC‐ζ (Thr410) in vitro. NRCMs were transfected with SIRT1 or H363Y for 48 h, followed by incubation with phenylephrine (100 μM for 2 h). (A, B) The protein expression of phosphorylated PKC‐ζ (p‐PKC‐ζ,‐Thr410) and total PKC‐ζ were measured by Western blotting. *P < 0.05, significantly different from Vector, # P < 0.05 , significantly different from Vector + PE, n = 5. (D, E) NRCMs were incubated with SIRT1 inhibitor EX527 (5 μM, 1 h, diluted in DMSO) or transfected with si‐SIRT1, followed by incubation with phenylephrine (100 μM for 2 h). The protein expression of p‐PKC‐ζ (Thr410) and total PKC‐ζ were measured by Western blotting. *P < 0.05, significantly different from DMSO or si‐NC. (C, F) Immunoprecipitation analysis showed the acetylation level of PKC‐ζ. Data are presented as means ± SEM, *P < 0.05, significantly different from Vector or si‐NC, # P < 0.05, significantly different from Vector + PE or si‐NC + PE, n = 5. n.s., non‐significant. n = 5. (G, H) Immunoprecipitation (G) and reverse immunoprecipitation (H) analysis showed the interaction between SIRT1 and PKC‐ζ in cardiomyocytes treated with or without PE, n = 5. Data are presented as means ± SEM, *P < 0.05, significantly different from CON, n = 5. (I) The intracellular colocalization of SIRT1 (green) and PKC‐ζ (red) in NRCMs was identified by confocal immunofluorescence microscopy. Scale bar: 10 μm.

SIRT1 is well‐known to deacetylate a series of non‐histone substrates and affect their function (Kida and Goligorsky, 2016; Karbasforooshan and Karimi, 2017). Our experiments showed that the modulation by SIRT1, of PKC‐ζ function depended on the deacetylation activity of SIRT1. We further determined whether PKC‐ζ is deacetylated by SIRT1 in NRCMs. Figure 8C showed that PKC‐ζ acetylation was increased by phenylephrine treatment and this increase was counteracted by overexpression of SIRT1. By contrast, PKC‐ζ acetylation status did not change when the cell was transfected with H363Y.

Enhancement of SIRT1 activation through overexpression indicated the inhibitory effects of SIRT1 on increased PKC‐ζ phosphorylation (Thr410). To explore the involvement of SIRT1 in the activation of PKC‐ζ, endogenous SIRT1 was inhibited with a specific inhibitor of SIRT1, EX527 (5 μM, dissolved in DMSO) (Huang et al., 2013) or knocked down with siRNA in NRCMs. As shown in Figure 8D,E, EX527 treatment and SIRT1 knockdown significantly elevated PKC‐ζ phosphorylation (Thr410), without affecting the expression of total PKC‐ζ. At the same timethe modulation by SIRT1 of PKC‐ζ acetylation was further confirmed by transfection with si‐SIRT1. As the data showed, si‐SIRT1 elevated PKC‐ζ acetylation level (Figure 8F). Thus, these results demonstrated that SIRT1 blocked the phosphorylation, acetylation and activation of PKC‐ζ, in hypertrophic cardiomyocytes and that SIRT1 insufficiency triggered cardiomyocyte hypertrophy.

Next, the interaction of SIRT1 with PKC‐ζ was assessed to elucidate the mechanism by which SIRT1 modulated the PKC‐ζ pathway. As shown in the co‐immunoprecipitation (co‐IP) (Figure 8G) and reverse co‐IP (Figure 8H) results, SIRT1 and PKC‐ζ interacted with each other under control condition, and the interaction was clearly enhanced by phenylephrine treatment. Moreover, as shown in Supporting Information Figure S3A,B, we observed a physical association between SIRT1 and PKC‐ζ both in the nucleus and in the cytoplasm of cardiomyocytes. Additionally, the intracellular co‐localization of SIRT1 (green) and PKC‐ζ (red) in NRCMs was confirmed by confocal microscopy (Figure 8I), thus providing a subcellular foundation for the interaction between SIRT1 and PKC‐ζ. These findings suggested a direct interaction between SIRT1 and PKC‐ζ in cardiomyocytes. Taken together, our data suggested that SIRT1 directly bound to PKC‐ζ protein and acted as a deacetylase.

As shown in Figures 1, 2 and 8, SIRT1 negatively regulated the phosphorylation and activation of PKC‐ζ, both in vivo and in vitro, whereas the activation of PKC‐ζ is attributable to protein–protein interactions and phosphorylation by PDK‐1 of the activation loop (Hirai and Chida, 2003). To elucidate why SIRT1 affected PKC‐ζ activation, we determined whether SIRT1 altered the association between PDK‐1 and PKC‐ζ. Co‐IP analysis revealed that endogenous PDK‐1 formed a complex with PKC‐ζ .and such interactions were attenuated by overexpression of SIRT1 (Figure 9A). Furthermore, the interaction between endogenous PDK‐1 and PKC‐ζ was reinforced by SIRT1 knockdown (Figure 9B), while neither SIRT1 overexpression nor SIRT1 knockdown altered the activity and the expression of PDK‐1 (Supporting Information Figure S4A, B). These results suggested that SIRT1 negatively regulated the interaction between PDK‐1 and PKC‐ζ without affecting their expression. Additionally, the intracellular colocalization of PDK‐1 (green) and PKC‐ζ (red) in NRCMs was confirmed by confocal microscopy (Figure 9C). Both phenylephrine stimulation and si‐SIRT1 promoted the colocalization of PDK‐1 and PKC‐ζ, whereas overexpression of SIRT1 decreased the colocalization of PDK‐1 and PKC‐ζ. The immunofluorescence results were consistent with our co‐IP results. To prove that the regulation of SIRT1 on PKC‐ζ depended on PDK‐1, PDK‐1 was knocked down by RNA interference or inhibited by GSK2334470 in NRCMs. As shown in Figure 9D,E, phenylephrine stimulation and SIRT1 knockdown significantly elevated the level of p‐PKC‐ζ (Thr410), which was reversed by PDK‐1 knockdown or PDK‐1 inhibition. Thus, the present results demonstrated that SIRT1 negatively regulated PKC‐ζ phosphorylation in cardiomyocytes via PDK‐1. Taken together, our data may reveal a new mechanism by which SIRT1 modulated PKC‐ζ through post‐translational modification. Deacetylation of PKC‐ζ by SIRT1 may attenuate the association between PDK‐1 and PKC‐ζ, thus suppressing PKC‐ζ phosphorylation and function in cardiac hypertrophy.

Figure 9.

Figure 9

Open in a new tab

SIRT1 regulated the phosphorylation level of PKC‐ζ (Thr410) through PDK‐1–PKC‐ζ interaction in cardiomyocytes. (A, B) Immunoprecipitation analysis showed the interaction between PDK‐1 and PKC‐ζ in cardiomyocytes. Data are presented as means ± SEM, *P < 0.05, significantly different from Vector or si‐NC, n = 5. (C) The intracellular colocalization of PDK‐1 (green) and PKC‐ζ (red) in NRCMs was identified by confocal immunofluorescence microscopy. Scale bar: 20 μm. NRCMs were transfected with si‐SIRT1 or (and) si‐PDK‐1 or (and) incubated with PDK‐1 inhibitor (GSK2334470) with or without phenylephrine treatment. (D, E) The protein expression of phosphorylated PKC‐ζ (p‐PKC‐ζ, Thr410) and total PKC‐ζ were measured by Western blotting. Data are presented as means ± SEM, *P < 0.05, significantly different from si‐NC, # P < 0.05, significantly different from si‐NC + PE, $ P < 0.05, significantly different from si‐SIRT1, & P < 0.05, significantly different from si‐SIRT1 + PE, n = 5.

Discussion

Seven sirtuin family proteins (SIRT1–7) have been identified as the mammalian orthologues of yeast SIR2. SIRT1 is evolutionarily close to yeast SIR2 and has been the most intensively investigated in the cardiovascular system. SIRT3 protects cardiomyocytes from ageing and oxidative stress and suppresses cardiac hypertrophy (Sundaresan et al., 2009). SIRT4 promotes hypertrophic growth, the generation of fibrosis and cardiac dysfunction by increasing ROS levels upon pathological stimulation (Luo et al., 2017). SIRT6 has also recently been demonstrated to attenuate cardiac hypertrophy (Webster, 2012), and our previous studies showed that SIRT6 suppressed cardiomyocyte hypertrophy via inhibition of NF‐κB‐dependent transcriptional activity (Yu et al., 2013). On the other hand, the roles of SIRT5 and SIRT7 in cardiac hypertrophy remain largely uncharacterized.

SIRT1, a NAD‐dependent protein deacetylase, is a member of the sirtuin family (Sosnowska et al., 2017) and this sirtuin plays an essential role in cardiac development (Cheng et al., 2003; McBurney et al., 2003; Tanno et al., 2007). SIRT1‐deficient mice rarely survive postnatally and exhibit developmental abnormalities in several organs, including the heart (Cheng et al., 2003; McBurney et al., 2003). Moreover, activation of SIRT1 prevents the pathogenesis of cardiac hypertrophy (Alcendor et al., 2007; Planavila et al., 2011; Geng et al., 2013; Yu et al., 2013). In line with these studies, we found that SIRT1 protected AAC‐induced cardiac hypertrophic response and cardiac hypertrophy in a rat model, induced by isoprenaline. It is relevant to note that cardiac function elevated in our rat model, and it is possible that the hypertrophy was still in its compensatory phase whereas in the C57 mouse model (Hua et al., 2012), the cardiac hypertrophy had already entered decompensation and the AAC procedure decreased cardiac function. This difference may reflect the different species involved in the two models.

Furthermore, our study demonstrated that overexpression of wild‐type SIRT1 prevented phenylephrine‐induced hypertrophic response in cultures of NRCMs while overexpression of mutant SIRT1 (H363Y), a mutation lacking deacetylase activity, did not affect the hypertrophic response. Moreover, the delivery of Ad‐SIRT1 markedly repressed isoprenaline‐induced cardiac hypertrophy in vivo, but the delivery of Ad‐H363Y failed to repress isoprenaline‐induced cardiac hypertrophy, implying that the protective effect of SIRT1 on cardiac hypertrophy depended on its deacetylase activity.

PKCs, a family of serine/threonine protein kinase enzymes, also play critical roles in cardiac remodelling and dysfunction in heart failure (Palaniyandi et al., 2009). PKC‐ζ is known to be activated by lipid components, such as phosphatidylinositols, phosphatidic acid, arachidonic acid and ceramide (Fox et al., 2007; Steinberg, 2012). However, relatively little is known about the endogenous negative regulators of PKC‐ζ, which may have therapeutic potential to ameliorate cardiac hypertrophy. In our study, the role of PKC‐ζ was investigated in NRCMs with hypertrophy induced by phenylephrine and the model of cardiac hypertrophy in vivo, induced by AAC or isoprenaline treatment. The activity of PKC‐ζ, which was assessed by phosphorylation of Thr410 within its activation loop (Chou et al., 1998; Hirai and Chida, 2003; Fox et al., 2007), increased significantly in these cardiac hypertrophy models (Figures 1, 2 and 8). Genetic silencing of PKC‐ζ attenuated phenylephrine‐induced cardiomyocyte hypertrophy (Li et al., 2016).

Given that both SIRT1 and PKC‐ζ participate in the regulation of cardiac hypertrophy, we hypothesized that these two proteins may coordinate with each other in this regulation. Modulation by SIRT1 of the acetylation and phosphorylation of PKC‐ζ were also observed in rat heart tissues of various models. PKC‐ζ acetylation and PKC‐ζ phosphorylation (Thr410) were increased by AAC surgery and alleviated after treatment with resveratrol. Similarly, PKC‐ζ acetylation and PKC‐ζ phosphorylation (Thr410) were markedly increased by isoprenaline treatment and alleviated by treatment with Ad‐SIRT1. Furthermore, the co‐IP and confocal microscopy results indicated a physical interaction between SIRT1 and PKC‐ζ in cardiomyocytes, which was significantly enhanced by phenylephrine treatment. Moreover, genetic silencing of SIRT1 or inhibition of SIRT1 with EX527 increased the activation of PKC‐ζ. These results supported our initial hypothesis that SIRT1 negatively regulated PKC‐ζ activation in cardiac hypertrophy and that such regulation depended on the deacetylase function of SIRT1.

The activation of PKC‐ζ relies on its interaction with PDK‐1. Following activation by binding to PIP3, PDK‐1 binds to PKC‐ζ and phosphorylates the Thr410 residue of PKC‐ζ (Chou et al., 1998; Le Good et al., 1998; Hirai and Chida, 2003). To further elucidate the mechanism by which deacetylation by SIRT1 affected PKC‐ζ phosphorylation and activation, the interactions between SIRT1, PDK‐1 and PKC‐ζ were explored in the present study. We found that, the interaction between endogenous PDK‐1 and PKC‐ζ was attenuated by SIRT1 overexpression and strengthened after SIRT1 knockdown. These findings suggested that SIRT1 negatively regulated the interaction between PDK‐1 and PKC‐ζ. Taken together, our study revealed a new mechanism by which SIRT1 could modulate PKC‐ζ through post‐translational modification. In this mechanism, SIRT1 might deacetylate PKC‐ζ, thus altering the spatial conformation of PKC‐ζ and decreasing the interaction between PDK‐1 and PKC‐ζ which would consequently block the activation of PKC‐ζ by PDK‐1. This would decrease the downstream signalling pathways activated by PKC‐ζ including those involving NF‐κB, ERK1/2 and ERK5, leading to and amelioration of the cardiac hypertrophic response.

It remains unclear how PKC‐ζ deacetylation mediated by SIRT1 affected its interaction with PDK‐1. By using the acetylation site prediction platform (PHOSIDA: http://www.phosida.com/), four potential lysine acetylation sites ‐ K136, K265, K281 and K473 ‐ were identified in PKC‐ζ. As these sites are all located in the PKC‐ζ kinase domain, which is required for the complex formation between PKC‐ζ and PDK‐1 (Le Good et al., 1998), it is possible that acetylation of these lysine residues might strengthen the binding with PDK‐1. Thus, SIRT1‐mediated deacetylation of these residues might decrease the interaction with PDK‐1.

In summary, we have identified SIRT1 as an endogenous negative regulator for PKC‐ζ and shown that SIRT1 and PKC‐ζ form a regulatory loop in cardiac hypertrophy. Mechanistically, SIRT1 could interact with PKC‐ζ physically and cause its deacetylation, thereby suppressing the interaction of PKC‐ζ and PDK‐1 and reducing the phosphorylation of PKC‐ζ at Thr410 by PDK‐1, and leading to the inhibition of the downstream signalling pathways of PKC‐ζ which are closely related to cardiac hypertrophy (Figure 10). These findings reveal that the interplay of PKC‐ζ acetylation and phosphorylation is critical in the pathogenesis of cardiac hypertrophy. Targeting SIRT1‐PKC‐ζ signalling axis may provide a novel therapeutic approach against cardiac hypertrophy.

Figure 10.

Figure 10

Open in a new tab

SIRT1 protected cardiomyocytes from cardiac hypertrophy induced by phenylephrine via PKC‐ζ. As an endogenous negative regulator for PKC‐ζ, SIRT1 interacts with PKC‐ζ physically and causes its deacetylation under a hypertrophic stimulus, subsequently suppresses the interaction of PKC‐ζ and PDK‐1 and reduces PKC‐ζ phosphorylation. Finally, the downstream signalling pathways related to cardiac hypertrophy are affected.

Author contributions

P.‐Q.L. and X.‐L.Z. conceived and designed the experiments. J.‐Y.L., J.‐Y.H., Z.G., H.G., P.‐X.W., W.‐W.L., S.‐D.C., Y.‐H.H., K.‐T.G., L.‐P.W., Z.‐Z.L. and M.‐H.W. performed the experiments. X.‐L.Z., J.‐Y.L. and Z.‐M.L. analysed the data. Z.‐M.L., H.G. and J.L. contributed reagents/materials/analysis tools. J.‐Y.L. and J.‐Y.H. wrote the paper.

Conflict of interest

The authors declare no conflicts of interest.

Declaration of transparency and scientific rigour

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research recommended by funding agencies, publishers and other organisations engaged with supporting research.

Supporting information

Table S1 Sequences of siRNAs.

Table S2 Rat‐specific primer sequences for quantitative RT‐PCR.

Figure S1 Ad‐mutant‐SIRT1 (Ad‐H363Y) failed to repress isoprenaline‐induced cardiac hypertrophy in vivo. SD rats were submitted to intramyocardial injection of adenovirus encoding mutant‐SIRT1 (Ad‐H363Y, 1010 particles), the control animals received green fluorescent protein (Ad‐GFP, 1010 particles), followed by isoprenaline injection (1.5 mg·kg−1·d−1, s.c., 7 days) or an equal volume of normal saline (NS). (A‐D and F‐K) Hypertrophic changes of the hearts were observed by gross morphologic examination (A), HE staining (B and C) and echocardiography (D and F‐K). (E) The protein expression of SIRT1 was shown by IHC staining. Scale bar: 5 mm (B), 50 μm (C), 50 μm (E). (L and M) The HW/BW and HW/TL ratios were calculated. (N) The protein expressions of beta‐MHC and ANF were measured by Western blotting. Data were presented as means ± SEM. *P < 0.05 vs Ad‐GFP + NS group, n.s., non significant., n = 6.

Figure S2 SIRT1 inhibited the nuclear translocation of NF‐κB and activation of ERK1/2, ERK5 induced by Ad‐PKC‐zeta. NRCMs were transfected with plasmid expressing wild‐type SIRT1 (SIRT1) or Ad‐PKC‐zeta. (A) Cell surface area was measured by rhodamine‐phalloidin staining. Scale bar: 20 μm. (B) The mRNA levels of hypertrophic biomarkers (ANF and BNP) were detected by qRT‐PCR. (C) Western blot analysis showed the protein level of p65 in the nucleus. (D) The DNA binding activity of NF‐κB was determined by electrophoretic mobility shift assay (EMSA). The graph showed one representative experiment of five independent experiments. (E and F) The protein expressions of phosphorylated ERK1/2 (p‐ERK1/2), total ERK1/2, phosphorylated ERK5 (p‐ERK5) and total ERK5 were measured by Western blotting. Data were presented as means ± SEM. *P < 0.05 vs Ad‐GFP + Vector, # P < 0.05 vs Ad‐PKC‐zeta + Vector, n = 5.

Figure S3 SIRT1 and PKC‐zeta interacted with each other in the nucleus and cytoplasm. (A and B) Immunoprecipitation analysis showed the interaction between SIRT1 and PKC‐zeta in the nucleus and cytoplasm in cardiomyocytes, n = 5.

Figure S4 SIRT1 did not directly alter PDK‐1 activation or expression. (A‐B) The protein expressions of phosphorylated PDK‐1 (p‐PDK‐1) and total PDK‐1 were measured by Western blotting. Data were presented as means ± SE, n = 5, n.s., non significant.

Click here for additional data file. (751.1KB, pdf)

Acknowledgements

This research was supported by grants from the 111 Project (no. B16047), National Natural Science Foundation of China (81473205, 81673433, 81803521 and 81872860), Indigenous Innovative Research Team of Guangdong Province (2017BT01Y093), National Major Special Projects for the Creation and Manufacture of New Drugs (2018ZX09301031‐001), Major Project of Platform Construction Education Department of Guangdong Province (no. 2014GKPT002), and Special Program for Applied Science and Technology of Guangdong Province (nos 2015B020232009 and 2014B020210003), National Engineering and Technology Research Center for New drug Druggability Evaluation (Seed Program of Guangdong Province, 2017B090903004), Guangzhou Science and Technology Program Project (no. 201604020121) and Medical Scientific Research Foundation of Guangdong Province (no. A2018078).

Li, J. , Huang, J. , Lu, J. , Guo, Z. , Li, Z. , Gao, H. , Wang, P. , Luo, W. , Cai, S. , Hu, Y. , Guo, K. , Wang, L. , Li, Z. , Wang, M. , Zhang, X. , and Liu, P. (2019) Sirtuin 1 represses PKC‐ζ activity through regulating interplay of acetylation and phosphorylation in cardiac hypertrophy. British Journal of Pharmacology, 176: 416–435. 10.1111/bph.14538.

Contributor Information

Xiaolei Zhang, Email: zhangxlei5@mail.sysu.edu.cn.

Peiqing Liu, Email: liupq@mail.sysu.edu.cn.

References

  1. Alcendor RR, Gao S, Zhai P, Zablocki D, Holle E, Yu X et al (2007). Sirt1 regulates aging and resistance to oxidative stress in the heart. Circ Res 100: 1512–1521. [DOI] [PubMed] [Google Scholar]
  2. Alexander SPH, Fabbro D, Kelly E, Marrion NV, Peters JA, Faccenda E et al (2017a). The Concise Guide to PHARMACOLOGY 2017/18: Enzymes. Br J Pharmacol 174: S272–S359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alexander SPH, Kelly E, Marrion NV, Peters JA, Faccenda E, Harding SD et al (2017b). The Concise Guide To PHARMACOLOGY 2017/18: Other proteins. Br J Pharmacol 174: S1–S16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Balakumar P, Jagadeesh G (2010). Multifarious molecular signaling cascades of cardiac hypertrophy: can the muddy waters be cleared? Pharmacol Res 62: 365–383. [DOI] [PubMed] [Google Scholar]
  5. Berra E, Diaz‐Meco MT, Lozano J, Frutos S, Municio MM, Sanchez P et al (1995). Evidence for a role of MEK and MAPK during signal transduction by protein kinase C ζ. EMBO J 14: 6157–6163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Biala A, Tauriainen E, Siltanen A, Shi J, Merasto S, Louhelainen M et al (2010). Resveratrol induces mitochondrial biogenesis and ameliorates Ang II‐induced cardiac remodeling in transgenic rats harboring human renin and angiotensinogen genes. Blood Press 19: 196–205. [DOI] [PubMed] [Google Scholar]
  7. Borges L, Bigarella CL, Baratti MO, Crosara‐Alberto DP, Joazeiro PP, Franchini KG et al (2008). ARHGAP21 associates with FAK and PKCζ and is redistributed after cardiac pressure overload. Biochem Biophys Res Commun 374: 641–646. [DOI] [PubMed] [Google Scholar]
  8. Bowman JC, Steinberg SF, Jiang T, Geenen DL, Fishman GI, Buttrick PM (1997). Expression of protein kinase C β in the heart causes hypertrophy in adult mice and sudden death in neonates. J Clin Invest 100: 2189–2195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cheng HL, Mostoslavsky R, Saito S, Manis JP, Gu Y, Patel P et al (2003). Developmental defects and p53 hyperacetylation in Sir2 homolog (SIRT1)‐deficient mice. Proc Natl Acad Sci U S A 100: 10794–10799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chou MM, Hou W, Johnson J, Graham LK, Lee MH, Chen CS et al (1998). Regulation of protein kinase C ζ by PI 3‐kinase and PDK‐1. Curr Biol 8: 1069–1077. [DOI] [PubMed] [Google Scholar]
  11. Curtis MJ, Alexander S, Cirino G, Docherty JR, George CH, Giembycz MA et al (2018). Experimental design and analysis and their reporting II: updated and simplified guidance for authors and peer reviewers. Brit J Pharmacol 175: 987–993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Decock JB, Gillespie‐Brown J, Parker PJ, Sugden PH, Fuller SJ (1994). Classical, novel and atypical isoforms of PKC stimulate ANF‐ and TRE/AP‐1‐regulated‐promoter activity in ventricular cardiomyocytes. FEBS Lett 356: 275–278. [DOI] [PubMed] [Google Scholar]
  13. Du XJ (2007). Divergence of hypertrophic growth and fetal gene profile: the influence of β‐blockers. Br J Pharmacol 152: 169–171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Feng XJ, Gao H, Gao S, Li ZM, Li H, Lu J et al (2015). The orphan receptor NOR1 participates in isoprenaline‐induced cardiac hypertrophy by regulating PARP‐1. Br J Pharmacol 172: 2852–2863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Finkel T, Deng CX, Mostoslavsky R (2009). Recent progress in the biology and physiology of sirtuins. Nature 460: 587–591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Fox TE, Houck KL, O'Neill SM, Nagarajan M, Stover TC, Pomianowski PT et al (2007). Ceramide recruits and activates protein kinase C ζ (PKC ζ) within structured membrane microdomains. J Biol Chem 282: 12450–12457. [DOI] [PubMed] [Google Scholar]
  17. Garcia‐Hoz C, Sanchez‐Fernandez G, Garcia‐Escudero R, Fernandez‐Velasco M, Palacios‐Garcia J, Ruiz‐Meana M et al (2012). Protein kinase C (PKC)ζ‐mediated Gαq stimulation of ERK5 protein pathway in cardiomyocytes and cardiac fibroblasts. J Biol Chem 287: 7792–7802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Geng B, Cai Y, Gao S, Lu J, Zhang L, Zou J et al (2013). PARP‐2 knockdown protects cardiomyocytes from hypertrophy via activation of SIRT1. Biochem Biophys Res Commun 430: 944–950. [DOI] [PubMed] [Google Scholar]
  19. Govindsamy A, Naidoo S, Cerf ME (2018). Cardiac development and transcription factors: insulin signalling, insulin resistance, and intrauterine nutritional programming of cardiovascular disease. J Nutr Metabol 2018 8547976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Haider AW, Larson MG, Benjamin EJ, Levy D (1998). Increased left ventricular mass and hypertrophy are associated with increased risk for sudden death. J Am Coll Cardiol 32: 1454–1459. [DOI] [PubMed] [Google Scholar]
  21. Harding SD, Sharman JL, Faccenda E, Southan C, Pawson AJ, Ireland S et al (2018). The IUPHAR/BPS Guide to PHARMACOLOGY in 2018: updates and expansion to encompass the new guide to IMMUNOPHARMACOLOGY. Nucl Acids Res 46: D1091–D1106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Heineke J, Molkentin JD (2006). Regulation of cardiac hypertrophy by intracellular signalling pathways. Nat Rev Mol Cell Biol 7: 589–600. [DOI] [PubMed] [Google Scholar]
  23. Hirai T, Chida K (2003). Protein kinase Cζ (PKCζ): activation mechanisms and cellular functions. J Biochem 133: 1–7. [DOI] [PubMed] [Google Scholar]
  24. Hua Y, Zhang Y, Ren J (2012). IGF‐1 deficiency resists cardiac hypertrophy and myocardial contractile dysfunction: role of microRNA‐1 and microRNA‐133a. J Cell Mol Med 16: 83–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Huang J, Chen Z, Li J, Chen Q, Li J, Gong W et al (2017). Protein kinase CK2α catalytic subunit ameliorates diabetic renal inflammatory fibrosis via NF‐kappaB signaling pathway. Biochem Pharmacol 132: 102–117. [DOI] [PubMed] [Google Scholar]
  26. Huang K, Huang J, Xie X, Wang S, Chen C, Shen X et al (2013). Sirt1 resists advanced glycation end products‐induced expressions of fibronectin and TGF‐β1 by activating the Nrf2/ARE pathway in glomerular mesangial cells. Free Radic Biol Med 65: 528–540. [DOI] [PubMed] [Google Scholar]
  27. Karbasforooshan H, Karimi G (2017). The role of SIRT1 in diabetic cardiomyopathy. Biomed Pharmacother 90: 386–392. [DOI] [PubMed] [Google Scholar]
  28. Katz AM (2002). Maladaptive growth in the failing heart: the cardiomyopathy of overload. Cardiovasc Drugs Ther 16: 245–249. [DOI] [PubMed] [Google Scholar]
  29. Kida Y, Goligorsky MS (2016). Sirtuins, cell senescence, and vascular aging. Can J Cardiol 32: 634–641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kilkenny C, Browne W, Cuthill IC, Emerson M, Altman DG (2010). Animal research: reporting in vivo experiments: the ARRIVE guidelines. Br J Pharmacol 160: 1577–1579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Le Good JA, Ziegler WH, Parekh DB, Alessi DR, Cohen P, Parker PJ (1998). Protein kinase C isotypes controlled by phosphoinositide 3‐kinase through the protein kinase PDK1. Science (New York, NY) 281: 2042–2045. [DOI] [PubMed] [Google Scholar]
  32. Leitges M, Sanz L, Martin P, Duran A, Braun U, Garcia JF et al (2001). Targeted disruption of the ζPKC gene results in the impairment of the NF‐kappaB pathway. Mol Cell 8: 771–780. [DOI] [PubMed] [Google Scholar]
  33. Li J, Gao H, Huang J, Wang P, Huang Y, Luo W et al (2016). PKCζ interacts with STAT3 and promotes its activation in cardiomyocyte hypertrophy. J Pharmacol Sci 132: 15–23. [DOI] [PubMed] [Google Scholar]
  34. Liu XP, Gao H, Huang XY, Chen YF, Feng XJ, He YH et al (2015). Peroxisome proliferator‐activated receptor gamma coactivator 1 α protects cardiomyocytes from hypertrophy by suppressing calcineurin‐nuclear factor of activated T cells c4 signaling pathway. Transl Res 166: 459–473.e453. [DOI] [PubMed] [Google Scholar]
  35. Lu J, Zhang R, Hong H, Yang Z, Sun D, Sun S et al (2016). The poly (ADP‐ribosyl) ation of FoxO3 mediated by PARP1 participates in isoproterenol‐induced cardiac hypertrophy. Biochim Biophys Acta 1863: 3027–3039. [DOI] [PubMed] [Google Scholar]
  36. Luo YX, Tang X, An XZ, Xie XM, Chen XF, Zhao X et al (2017). SIRT4 accelerates Ang II‐induced pathological cardiac hypertrophy by inhibiting manganese superoxide dismutase activity. Eur Heart J 38: 1389–1398. [DOI] [PubMed] [Google Scholar]
  37. McBurney MW, Yang X, Jardine K, Hixon M, Boekelheide K, Webb JR et al (2003). The mammalian SIR2α protein has a role in embryogenesis and gametogenesis. Mol Cell Biol 23: 38–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. McGrath JC, Lilley E (2015). Implementing guidelines on reporting research using animals (ARRIVE etc.): new requirements for publication in BJP. Br J Pharmacol 172: 3189–3193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Meng G, Liu J, Liu S, Song Q, Liu L, Xie L et al (2018). Hydrogen sulfide pretreatment improves mitochondrial function in myocardial hypertrophy via a SIRT3‐dependent manner. Br J Pharmacol 175: 1126–1145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Palaniyandi SS, Sun L, Ferreira JC, Mochly‐Rosen D (2009). Protein kinase C in heart failure: a therapeutic target? Cardiovasc Res 82: 229–239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Phrommintikul A, Tran L, Kompa A, Wang B, Adrahtas A, Cantwell D et al (2008). Effects of a Rho kinase inhibitor on pressure overload induced cardiac hypertrophy and associated diastolic dysfunction. Am J Physiol Heart Circ Physiol 294: H1804–H1814. [DOI] [PubMed] [Google Scholar]
  42. Planavila A, Iglesias R, Giralt M, Villarroya F (2011). Sirt1 acts in association with PPARα to protect the heart from hypertrophy, metabolic dysregulation, and inflammation. Cardiovasc Res 90: 276–284. [DOI] [PubMed] [Google Scholar]
  43. Qvit N, Mochly‐Rosen D (2010). Highly specific modulators of protein kinase C localization: applications to heart failure. Drug Discov Today Dis Mech 7: e87–e93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Simonis G, Briem SK, Schoen SP, Bock M, Marquetant R, Strasser RH (2007). Protein kinase C in the human heart: differential regulation of the isoforms in aortic stenosis or dilated cardiomyopathy. Mol Cell Biochem 305: 103–111. [DOI] [PubMed] [Google Scholar]
  45. Singh RK, Kumar S, Gautam PK, Tomar MS, Verma PK, Singh SP et al (2017b). Protein kinase C‐α and the regulation of diverse cell responses. Biomol Concepts 8: 143–153. [DOI] [PubMed] [Google Scholar]
  46. Singh RM, Cummings E, Pantos C, Singh J (2017a). Protein kinase C and cardiac dysfunction: a review. Heart Fail Rev 22: 843–859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Sosnowska B, Mazidi M, Penson P, Gluba‐Brzozka A, Rysz J, Banach M (2017). The sirtuin family members SIRT1, SIRT3 and SIRT6: their role in vascular biology and atherogenesis. Atherosclerosis 265: 275–282. [DOI] [PubMed] [Google Scholar]
  48. Steinberg SF (2012). Cardiac actions of protein kinase C isoforms. Physiology (Bethesda) 27: 130–139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Sundaresan NR, Gupta M, Kim G, Rajamohan SB, Isbatan A, Gupta MP (2009). Sirt3 blocks the cardiac hypertrophic response by augmenting Foxo3a‐dependent antioxidant defense mechanisms in mice. J Clin Invest 119: 2758–2771. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Tanno M, Sakamoto J, Miura T, Shimamoto K, Horio Y (2007). Nucleocytoplasmic shuttling of the NAD+‐dependent histone deacetylase SIRT1. J Biol Chem 282: 6823–6832. [DOI] [PubMed] [Google Scholar]
  51. Webster KA (2012). A sirtuin link between metabolism and heart disease. Nat Med 18: 1617–1619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Yu SS, Cai Y, Ye JT, Pi RB, Chen SR, Liu PQ et al (2013). Sirtuin 6 protects cardiomyocytes from hypertrophy in vitro via inhibition of NF‐κB‐dependent transcriptional activity. Br J Pharmacol 168: 117–128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zhou SG, Zhou SF, Huang HQ, Chen JW, Huang M, Liu PQ (2006). Proteomic analysis of hypertrophied myocardial protein patterns in renovascularly hypertensive and spontaneously hypertensive rats. J Proteome Res 5: 2901–2908. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1 Sequences of siRNAs.

Table S2 Rat‐specific primer sequences for quantitative RT‐PCR.

Figure S1 Ad‐mutant‐SIRT1 (Ad‐H363Y) failed to repress isoprenaline‐induced cardiac hypertrophy in vivo. SD rats were submitted to intramyocardial injection of adenovirus encoding mutant‐SIRT1 (Ad‐H363Y, 1010 particles), the control animals received green fluorescent protein (Ad‐GFP, 1010 particles), followed by isoprenaline injection (1.5 mg·kg−1·d−1, s.c., 7 days) or an equal volume of normal saline (NS). (A‐D and F‐K) Hypertrophic changes of the hearts were observed by gross morphologic examination (A), HE staining (B and C) and echocardiography (D and F‐K). (E) The protein expression of SIRT1 was shown by IHC staining. Scale bar: 5 mm (B), 50 μm (C), 50 μm (E). (L and M) The HW/BW and HW/TL ratios were calculated. (N) The protein expressions of beta‐MHC and ANF were measured by Western blotting. Data were presented as means ± SEM. *P < 0.05 vs Ad‐GFP + NS group, n.s., non significant., n = 6.

Figure S2 SIRT1 inhibited the nuclear translocation of NF‐κB and activation of ERK1/2, ERK5 induced by Ad‐PKC‐zeta. NRCMs were transfected with plasmid expressing wild‐type SIRT1 (SIRT1) or Ad‐PKC‐zeta. (A) Cell surface area was measured by rhodamine‐phalloidin staining. Scale bar: 20 μm. (B) The mRNA levels of hypertrophic biomarkers (ANF and BNP) were detected by qRT‐PCR. (C) Western blot analysis showed the protein level of p65 in the nucleus. (D) The DNA binding activity of NF‐κB was determined by electrophoretic mobility shift assay (EMSA). The graph showed one representative experiment of five independent experiments. (E and F) The protein expressions of phosphorylated ERK1/2 (p‐ERK1/2), total ERK1/2, phosphorylated ERK5 (p‐ERK5) and total ERK5 were measured by Western blotting. Data were presented as means ± SEM. *P < 0.05 vs Ad‐GFP + Vector, # P < 0.05 vs Ad‐PKC‐zeta + Vector, n = 5.

Figure S3 SIRT1 and PKC‐zeta interacted with each other in the nucleus and cytoplasm. (A and B) Immunoprecipitation analysis showed the interaction between SIRT1 and PKC‐zeta in the nucleus and cytoplasm in cardiomyocytes, n = 5.

Figure S4 SIRT1 did not directly alter PDK‐1 activation or expression. (A‐B) The protein expressions of phosphorylated PDK‐1 (p‐PDK‐1) and total PDK‐1 were measured by Western blotting. Data were presented as means ± SE, n = 5, n.s., non significant.

Click here for additional data file. (751.1KB, pdf)

Articles from British Journal of Pharmacology are provided here courtesy of The British Pharmacological Society

RESOURCES