Abstract
Lens ion homeostasis is crucial in maintaining water content and, in turn, refractive index and transparency of the multicellular syncytium-like structure. New information is emerging on the regulation of ion transport in the lens by mechanisms that rely on transient receptor potential vanilloid (TRPV) ion channels. We found recently that TRPV1 activation leads to Ca2+/PKC-dependent ERK1/2 signaling. Here, we show that the TRPV1 agonist capsaicin (100 nM) and hyperosmotic solution (350 vs. 300 mosM) each caused an increase of bumetanide-inhibitable Rb uptake by intact porcine lenses and Na-K-2Cl cotransporter 1 (NKCC1) phosphorylation in the lens epithelium. The TRPV1 antagonist A889425 (1 µM) abolished the increases of Rb uptake and NKCC1 phosphorylation in response to hyperosmotic solution. Exposing lenses to hyperosmotic solution in the presence of MEK/ERK inhibitor U0126 (10 µM) or the with-no-lysine kinase (WNK) inhibitor WNK463 (1 µM) also prevented NKCC1 phosphorylation and the Rb uptake responses to hyperosmotic solution. WNK463 did not prevent the increase in ERK1/2 phosphorylation that occurs in response to capsaicin or hyperosmotic solution, suggesting that ERK1/2 activation occurs before WNK activation in the sequence of signaling events. Taken together, the evidence indicates that activation of TRPV1 is a critical early step in a signaling mechanism that responds to a hyperosmotic stimulus, possibly lens shrinkage. By activating ERK1/2 and WNK, TRPV1 activation leads to NKCC1 phosphorylation and stimulation of NKCC1-mediated ion transport.
Keywords: hyperosmotic solution, Na-K-2Cl cotransporter 1, porcine lens, Rb uptake, transient receptor potential vanilloid 1
INTRODUCTION
Lens ion homeostasis is crucial in maintaining water content of the multicellular syncytium-like structure. This is of interest because water content affects the transparency and refractive index of the lens cortex and nucleus. New information is emerging on the regulation of ion transport in the lens by mechanisms that rely on transient receptor potential vanilloid (TRPV) ion channels. Lenses of various species, including human, have been found to express TRPV4, TRPV1, and transient receptor potential melastatin 3 (TRPM3) (6, 22, 25, 32), although the presence of other TRP channels cannot be ruled out. TRPV4 ion channels have been found to play critical a role in the lens response to osmotic swelling (31, 32). When the lens is immersed in hyposmotic bathing solution, TRPV4 activation is an early step in a response that ultimately leads to stimulation of Na-K-ATPase activity (30, 32). Less is known about TRPV1 in the lens, but studies thus far have shown that it appears to be involved in the response to a hyperosmotic challenge. Exposing the lens to hyperosmotic solution was found to cause signaling responses that could be prevented by a TRPV1 antagonist or mimicked by a TRPV1 agonist capsaicin (21).
In various species, the lens has been shown to express Na-K-2Cl cotransporter (NKCC) as well as potassium cloride cotransporters (KCC) and sodium chloride cotransporters (NCC) (3, 7, 19, 37). As in other tissues, these transporters are known to influence volume homeostasis (15, 16). NKCC1 has been detected in both types of lens cell, the epithelium monolayer that covers the anterior surface and fibers that make up the outer cortex (3, 7, 34). In rabbit and bovine lenses, bumetanide-sensitive potassium (86Rb) fluxes were found to be small or undetectable under isosmotic conditions and increased when the lens was exposed to hyperosmotic medium, suggesting NKCC stimulation in response to osmotic shrinkage (2, 3). Recently, hypertonic conditions were found to cause phosphorylation of NKCC1 in bovine lens (34). Here, we provide evidence that activation of TRPV1 is a critical early step in a signaling mechanism that causes NKCC1 phosphorylation and stimulation of bumetanide-sensitive transport when the porcine lens is placed in hyperosmotic solution. In fact, a similar increase of NKCC-mediated transport could be elicited by treating the lens with the TRPV1 agonist capsaicin. The NKCC responses were linked to TRPV1-dependent extracellular signal-regulated kinase (ERK)1/2 signaling that has been reported recently (21).
MATERIALS AND METHODS
Materials.
General chemicals as well as bumetanide, capsaicin, rubidium chloride, mannitol, and DMSO were purchased from Sigma (St. Louis, MO). A889425 was purchased from Alomone Laboratory (Hadassah Ein Kerem, Jerusalem BioPark, Israel). with-no-lysine kinase (WNK)463 was purchased from Sellekchem (Houston, TX). Rabbit monoclonal anti-NKCC1 (D13A9) antibody (cat. no. 8351); rabbit polyclonal anti-β-actin antibody (cat. no. 4967), rabbit polyclonal anti-p44/42 MAP kinase antibody (cat. no. 4695), and mouse monoclonal anti-phospho-p44/42 MAP kinase (Thr202/Tyr204) antibody (cat. no. 9106) were obtained from Cell Signaling Technology (Danvers, MA). Rabbit polyclonal anti-phospho-NKCC1 (Thr212/217) antibody (cat. no. ABS1004) was purchased from Millipore Sigma (Burlington, MA). Goat anti-rabbit secondary antibody conjugated with IRDye 680 (cat. no. 926-68071) and goat anti-mouse secondary antibody conjugated with IRDye 800 (cat. no. 926-32210) were obtained from LICOR Biosciences (Lincoln, NE). Prestained SDS-PAGE broad range standards (cat. no. 161-0318) was purchased from Bio-Rad Laboratories (Hercules, CA). Sense and antisense primers for human and porcine NKCC1 and NKCC2 were obtained from Integrated DNA Technologies, (Coralville, IA).
Krebs solution.
Lenses were incubated in Krebs solution that contained (in mM) 119 NaCl, 4.7 KCl, 1.2 KH2PO4, 25 NaHCO3, 2.5 CaCl2, 1 MgCl2, and 5.5 glucose. The solution was adjusted to pH 7.4 and 300 mosM and was equilibrated with 5% CO2 at 37°C for at least 40 min. In specified experiments, the osmolarity of the Krebs solution was increased to 350, 400, and 450 mosM by adding mannitol. In Rb-containing Krebs solution, KCl and KH2PO4 were replaced with equivalent amounts of RbCl and NaH2PO4, respectively. Osmolarity of the solutions was measured with an osmometer (5004 Micro-Osmette; Precision Systems, Natick, MA) and adjusted if needed.
Intact lenses.
Eyes were obtained from domestic pigs (Sus scrofa) of American Yorkshire breed, males and females aged 4–8 mo, provided by the University of Arizona Meat Science Laboratory or from West Valley Processing Meat Processors (Buckeye, AZ). The use of porcine tissue was approved by the University of Arizona Institutional Animal Care and Use Committee and conformed to the ARVO Resolution for the Use of Animals in Ophthalmic and Vision Research. As described below, rubidium (Rb) uptake was confirmed to be identical in male vs. female lenses, so both sexes were used at random. Human donor eyes were purchased from the National Disease Research Interchange (Philadelphia, PA), and their use was approved by the Institutional Review Board of the University of Arizona. The eyes were dissected open at the posterior pole by two cross-incisions made with a surgical blade. The cut scleral flaps were everted by pulling backward and at the same time gently pushing the cornea inward with the index finger. This causes the vitreous to protrude with its base still attached to the pars plana of the ciliary body. One side of the vitreous was then pushed aside from the pars plana by using curved forceps, and the vitreous body was gently separated from the eye. The eye was placed under dissecting microscope, and the zonular fibers were cut using a curved iris spring scissors. The attachment-free lens was then gently lifted free using curved forceps and placed in Krebs solution at 37°C.
Rb uptake.
Intact lenses were immersed in 8.0 ml Krebs solution in a six-well plate at 37°C in a CO2 incubator. Freshly isolated lenses were allowed to recover for 3 h before use and then were carefully transferred to Krebs solution containing test agents. For Rb uptake, lenses were placed in RbCl-containing Krebs solution, generally for 10 min. At the end of the Rb uptake period, lenses were washed briefly with ice-cold isotonic (100 mM) MgCl2 solution containing 2.0 mM BaCl2. Then each lens was blotted gently on moistened filter paper, placed in a tube, and weighed. The lenses were then dried at 45°C for 7 days and weighed again for water content determination by weight loss. Dried lenses were then digested in 2.5 ml of 30% nitric acid in a water bath at 50°C for 24 h. The digest was centrifuged at 1,507 g for 15 min. The supernatant was diluted as necessary, and Rb was measured using an atomic absorption spectrophotometer (AAnalyst 100; PerkinElmer, Waltham, MA). Rb uptake was expressed as mmol/kg lens water. Rb uptake was compared in intact lenses obtained either from male or female animals. In normal Krebs solution (300 mosM), Rb uptake was 0.64 ± 0.02 (n = 5) mmol·kg lens water−1·10 min−1 in males vs. 0.65 ± 0.02 mmol·kg lens water−1·10 min−1 (n = 7) in females. In hyperosmotic Krebs solution (350 mosM), Rb uptake was 0.81 ± 0.02 (n = 5) mmol·kg lens water−1·10 min−1 in males vs. 0.83 ± 0.02 mmol·kg lens water−1·10 min−1 (n = 8) in females.
Na-K-ATPase activity.
Na-K-ATPase activity was measured by homogenizing the lens capsule-epithelium then determining difference between ATP hydrolysis in the presence and in the absence of ouabain (30, 31). Na-K-ATPase activity values are presented as nmoles ATP hydrolyzed per milligram protein per 30 min.
RNA isolation.
An RNeasy Mini kit (Qiagen, Valencia, CA) was used to isolate total RNA according gthe manufacturer’s protocol. In brief, the freshly isolated lens capsule-epithelium was homogenized in 600 µl of RLT buffer containing 1% β-mercaptoethanol and using a battery-operated handheld Kimble Kontes tissue homogenizer (DWK Life Sciences, Millville, NJ). The tissue lysate was centrifuged at 21,000 g for 2 min by loading onto a QIAshredder column. Then an equal volume of 70% ethanol was added to the eluent and mixed gently using a pipette. The mixture was loaded onto an RNeasy Mini column and centrifuged at 10,000 g for 15 s in order for RNA to bind to the filter cartridge. Following a washing, DNAse treatment, and further washing, RNA was eluted from the filter using 50 μl of RNase-free water. The RNA amount was quantified using a ND-1000 spectrophotometer (λ = 260/280 nm; NanoDrop Technologies, Wilmington, DE).
RT-PCR.
RT-PCR was conducted using a previously published procedure (24). In brief, reverse transcription of total RNA into complementary DNA (cDNA) was performed using SuperScript III Reverse Transcriptase (Thermo Scientific, Waltham, MA) in an Applied Biosystem Gene Amp PCR System (Model 9700; Thermo Scientific) according to the manufacturer’s protocol. cDNA (5.0 µl) was used for the PCR reaction and gene amplification using Platinum Pfx DNA Polymerase kit (Thermo Scientific) according to the manufacturer’s recommended protocol. Primers for porcine NKCC1 [NCBI reference sequence (Ref.) XM_003123899.5] and NKCC2 (NCBI Ref. XM_005654446.3) were custom designed using Primer 3 (18, 27). Forward and reverse primer sequences for NKCC1 were CGTTGAGTATTGCAGTTGCTG and CAAACAACTTTTCCAGGCATT (NCBI Ref. XM_003123899.5), respectively. Forward and reverse primer sequences for porcine NKCC2 were CCCATGAAAGCCATCAACTT and TCAGAACGCCAAGCCTAATC (NCBI Ref. XM_005654446.3), respectively. Human NKCC1 forward and reverse primer sequences were CCATGGCATTTGACAGTTCA3 and GCAGATAATCATCCACCAGAGC (NCBI Ref. NM_001046.2), respectively. Human NKCC2 forward and reverse primer sequences were CCCCCTCAGAGGCTTATACC and TACTTTTCAGGCAGCAGCAA (NCBI Ref. NM_000338.2), respectively. Custom-designed primers were purchased from Integrated DNA Technologies (Coralville, IA). A cycling program of 2-min hold at 94°C and 35 cycles of denaturing at 94°C for 30 s, annealing at 55°C for 30 s, and an extension at 72°C for 1 min was used. PCR product was subjected to agarose gel (2%) electrophoresis containing ethidium bromide (0.2 µg/ml). φX174 DNA Marker Hae III Digest was used as base pair standards. Signals were visualized by UV exposure employing a benchtop UV Trans illuminator (UVP, Upland, CA). Images were captured using a high-resolution camera.
Western blottng.
Western blot analysis was carried out using a previously published procedure (31, 32). The capsule-epithelium was removed from the lens and homogenized in 400 µl of ice-cold RIPA buffer (pH 7.5) that contained (in mM) 50 HEPES, 150 NaCl, 1 EDTA, 10 sodium fluoride, 10 sodium pyrophosphate, 2 sodium orthovanadate, 10% glycerol, 1% Triton X-100, 1% sodium deoxycholate, a protease inhibitor cocktail (Thermo Fisher Scientific, Rockford, IL) and phosphatase inhibitor cocktails 1 and 2 (EMD Millipore, Burlington, MA) diluted 1:100. The sample was sonicated using a Misonix S3000 (Misonix, Farmingdale, NY) for 1 min (4 strokes of 15 s at 5-s interval) then centrifuged for 30 min at 13,000 g to remove nuclei and large debris. Protein concentration in the supernatant was measured using a Micro BCA Assay Kit (Thermo Scientific Pierce). Proteins in the supernatant were separated by electrophoresis on 7.5% SDS-PAGE and then transferred to nitrocellulose membrane that was kept overnight at 4°C in blocking buffer (AquaBlock, East Coast Biologics, North Berwick, ME). The membrane was then treated overnight at 4°C with primary antibody: rabbit polyclonal anti p44/42 MAP kinase antibody (1:1,000; ERK1/2); mouse monoclonal anti-phospho-p44/42 MAP kinase (Thr202/Tyr204) antibody, rabbit polyclonal anti-phospho-NKCC1 (Thr212/217) antibody (1:1,000), rabbit monoclonal anti-NKCC1 (D13A9) antibody (1:2,000) or rabbit polyclonal anti-β-actin antibody (1:5,000). The membrane was then washed three times with a mixture of Tris-buffered saline and Tween-20 to remove unbound primary antibody. The nitrocellulose membrane was then incubated at room temperature for 60–90 min with goat anti-rabbit secondary antibody conjugated with IRDye 680 or goat anti-mouse secondary antibody conjugated with IRDye 800 (1:20,000; LI-COR, Lincoln, NE). After this, the membrane was washed two times with Tris-buffered saline-Tween-20 and then two times with PBS. Protein bands were detected and quantified using a LI-COR Odyssey infrared scanner. The rabbit polyclonal anti-phospho-NKCC1 (Thr212/217) consistently produced doublet bands, and analysis was carried out by lumping both bands together for quantification. Using secondary antibodies detectable at 680 or 800 nm wavelengths, measure band densities of a phosphorylated and nonphosphorylated (total) protein were measured simultaneously, e.g., total (t)ERK1/2 or phospho-ERK1/2. The band density of phosphorylated ERK1/2 (pERK1/2) was normalized to the nonphosphorylated ERK1/2 (tERK1/2) protein band density. However, the non-phospho-specific NKCC1 (tNKCC1) antibody produced a rather diffuse broad band, and this introduced unacceptable error in the calculation of band density ratio. Thus, band density of active (phosphorylated) NKCC1 (pNKCC1) was normalized to β-actin band density.
Statistical analysis.
Results are expressed as means ± SE of data from a specified number of independent experiments. Using GraphPad Prism, treatment groups were compared by one-way analysis of variance (ANOVA) followed by Bonferroni’s post hoc multiple comparison test. A probability (P) value of <0.05 was considered significant. One-way ANOVA was used, since we had to compare data from more than two treatment groups, specifically among four groups. Then we used Bonferroni’s multiple comparison test to determine differences between two particular sets of treatments.
RESULTS
Bumetanide-sensitive potassium (Rb) uptake.
Rubidium (Rb) uptake was used to gauge the effect of hyperosmotic solution on potassium uptake by the intact porcine lens. When lenses were exposed for 10 min to 350 mosM bathing solution that contained RbCl in place of KCl, there was a significant increase in Rb uptake compared with lenses kept in control (300 mosM) conditions. Rb uptake increases of greater magnitude were observed in response to 400 and 450 mosM solution (Fig. 1A). Rb uptake was determined to be linear for at least 25 min (Fig. 1B), and the rate calculated by linear regression analysis was 0.07 mmol·kg lens water−1·min−1 in 350 mosM solution compared with 0.05 mmol·kg lens water−1·min−1 in control (300 mosM) solution. Subsequent studies were done by using a 350 mosM hyperosmotic test solution and 10 min uptake duration.
Fig. 1.
Effect of hyperosmotic solution on rubidium (Rb) uptake by intact porcine lenses. A: Rb uptake by lenses incubated for 10 min in control (300 mosM) or hyperosmotic (350, 400, or 450 mosM) Krebs solution. Krebs solutions were modified to contain RbCl (4.7 mM) in place of KCl, and Rb uptake was measured by AA spectrophotometry. B: time course of Rb uptake by lenses in 300 and 350 mosM Krebs solution. Each value is the mean ± SE of results from 5–6 lenses. **P < 0.01 and ***P < 0.001 indicate significant differences from control (300 mosM). Linear regression analysis (lines in B) indicated uptake rates of 0.05 and 0.07 mmol·kg lens water−1·min−1 in 300 and 350 mosM conditions; r2 values were 0.9940 and 0.9946, respectively.
The Na-K-ATPase-mediated component of Rb uptake was determined by measuring uptake with and without ouabain (0.1 mM). Ouabain-sensitive Rb uptake was 0.39 ± 0.05 (n = 4) mmol·kg lens water−1·10 min−1 in control lenses, which was not significantly different from the value of 0.39 ± 0.03 mmol·kg lens water−1·10 min−1 (n = 4) in lenses exposed to hyperosmotic solution. Also, there was no significant difference between Na-K-ATPase activity measured as ouabain-sensitive ATP hydrolysis in the epithelium of lenses that had been exposed for 10 min to 350 mosM solution vs. 300 mosM solution, 81.5 ± 4.2 (n = 5) vs 67.3 ± 3.5 (n = 6) nmol ATP hydrolyzed·min−1·mg protein−1).
To determine the contribution of NKCC cotransport to the hyperosmotic response, lenses were exposed to 350 mosM solution in the presence of bumetanide (10 µM). Under these conditions, the Rb uptake response to hyperosmotic solution was abolished (Fig. 2A). The TRPV1 antagonist A889425 (1 µM) also abolished the Rb uptake response to hyperosmotic solution (Fig. 2B). Baseline Rb uptake in isosmotic (300 mosM) solution was not altered by either bumetanide or A889425.
Fig. 2.
Effect of Na-K-2Cl cotransporter (NKCC) inhibitor bumetanide (Bum; A) and transient receptor potential vanilloid 1 (TRPV1) antagonist A889425 (A88; B) on the Rb uptake response to hyperosmotic solution. Intact lenses were preincubated 20 min with or without bumetanide (10 µM) or A889425 (1.0 µM) in isosmotic Krebs solution and then transferred to RbCl-containing control (300 mosM) or hyperosmotic (350 mosM) Krebs solution for 10 min in the continued presence or absence (Control, Con, of bumetanide or A889425. Each value is the mean ± SE of results from 5–6 lenses. ***Significant difference (P < 0.001) from Control.
The ability of A889425 to prevent the increase in bumetanide-sensitive Rb uptake caused by hyperosmotic solution implies a role for TRPV1. Therefore, studies were carried out to examine the response to capsaicin, a TRPV1 agonist. A 10-min exposure of lenses to 100 nM capsaicin caused Rb uptake to increase by ~50% (Fig. 3A). Importantly, bumetanide eliminated the capsaicin-induced increase in Rb uptake (Fig. 3A). The TRPV1 antagonist A889425 also abolished the Rb uptake response to capsaicin (Fig. 3B). The magnitude of the increase in Rb uptake was similar in capsaicin-treated and hyperosmotic solution-treated lenses, and it is noteworthy that the responses were not additive (Fig. 3B). The potassium (Rb) uptake findings are consistent with stimulation of NKCC cotransport following TRPV1 activation.
Fig. 3.
Effect of Na-K-2Cl cotransporter (NKCC) inhibitor bumetanide (Bum; A) and transient receptor potential vanilloid 1 (TRPV1) antagonist A889425 (A88; B) on the Rb uptake response to capsaicin (Cap, 100nM). Intact lenses were preincubated 20 min with or without bumetanide (10 µM) or A889425 (1.0 µM) in isosmotic Krebs solution and then transferred to RbCl-containing Krebs solution with or without (Control, Con) capsaicin for 10 min in the continued presence or absence of bumetanide or A889425. Each value is the mean ± SE of results from 5–6 lenses. ***P < 0.001 and **P < 0.01 indicate a significant difference from Control.
NKCC expression.
RT-PCR studies showed robust expression of NKCC1 mRNA in the epithelium of porcine as well as human lens (Fig. 4A). NKCC1 protein was evident by Western blot analysis (Fig. 4B). NKCC2 was not detected at either the mRNA or protein level in porcine or human lens epithelium (data not shown).
Fig. 4.
Na-K-2Cl cotransporter 1 (NKCC1) mRNA and protein expression in lens epithelium. A: RT-PCR detection of NKCC1 mRNA in porcine (left) and in human (right) lens epithelium. B: Western blot detection of NKCC1 protein in porcine (left) and in human (right) lens epithelium. The rabbit monoclonal anti-NKCC1 antibody (D13A9) recognizes total NKCC1. Porcine and human retinas were used as positive controls, and cultured porcine lens epithelium (32) was used for comparison. pRet, pig retina; hRet, human retina; NpL epi, native pig lens epithelium; CpL epi, cultured pig lens epithelium; hL epi, human lens epithelium.
NKCC1 phosphorylation.
An increase in NKCC1 phosphorylation was evident in the epithelium of intact lenses that had been exposed to either hyperosmotic solution or capsaicin. The increase in phosphorylation was transient. The response was maximal at 5 min in hyperosmotic solution-treated lenses (Fig. 5A) and 2.5 min in capsaicin-treated lenses (Fig. 5B). The TRPV1 antagonist A889425 prevented the NKCC1 phosphorylation responses to hyperosmotic solution (Fig. 6A) and capsaicin (Fig. 6B).
Fig. 5.
Effect of hyperosmotic (350 mosM) solution (A) and transient receptor potential vanilloid 1 (TRPV1) agonist capsaicin (B) on Na-K-2Cl cotransporter 1 (NKCC1) phosphorylation. Intact lenses were exposed to capsaicin (100 nM) or hyperosmotic (350 mosM) Krebs solution for up to 10 min, and then the epithelium was removed for Western blot analysis. Figures show bands for phospho-(p)NKCC1 detected using a rabbit polyclonal anti-phospho-NKCC1 (Thr212/217) antibody; figures also show bands for β-actin. Band density of active (phosphorylated) NKCC1 was normalized to β-actin band density. In each panel a representative blot is presented alongside a bar graph that shows densitometric analysis (means ± SE) of results from 3 independent experiments. ***P < 0.001 and *P < 0.05, significant difference from Control.
Fig. 6.
Effect of transient receptor potential vanilloid 1 (TRPV1) antagonist A889425 (A88) on the Na-K-2Cl cotransporter 1 (NKCC1) phosphorylation response to hyperosmotic solution (Hyper; A) and capsaicin (Cap; B). Intact lenses were preincubated in Krebs solution (300 mosM) with or without A889425 (1 µM) for 20 min and then exposed to capsaicin (100 nM) or hyperosmotic solution (350 mosM) for 10 min in the continued presence or absence of A889425. The capsule epithelium was then removed for Western blot analysis. Figures show bands for phospho-(p)NKCC1 detected using a rabbit polyclonal anti-phospho-NKCC1 (Thr212/217) antibody; figures also show bands for β-actin. Band density of active (phosphorylated) NKCC1 was normalized to β-actin band density. In each panel a representative blot is presented along with a bar graph that shows densitometric analysis (means ± SE) of results from 3 independent experiments. *Significant difference (P < 0.05) from Control.
ERK1/2 and WNK.
Recently, we showed that TRPV1 activation leads to calcium-dependent activation of ERK1/2 in the lens epithelium (21). To examine the functional role of TRPV1-dependent ERK1/2 signaling, intact lenses were exposed to hyperosmotic solution in the presence of U0126 (10 µM). This prevented NKCC1 phosphorylation (Fig. 7A) as well as the hyperosmotic solution-induced increase in Rb uptake (Fig. 7B).
Fig. 7.
Effect of mitogen-activated protein kinase kinase-extracellular signal-regulated kinase (MEK/ERK) inhibitor U0126 (U0) on Na-K-2Cl cotransporter 1 (NKCC1) phosphorylation (A) and Rb uptake (B) responses to hyperosmotic solution. Intact lenses were preincubated in Krebs solution with or without U0126 (10 µM) for 20 min and then exposed to control or hyperosmotic solution (350 mosM) for 10 min in the continued presence or absence of U0126. The capsule-epithelium was then removed for Western blot analysis. Figures show bands for phospho-(p)NKCC1 detected using a rabbit polyclonal anti-phospho-NKCC1 (Thr212/217) antibody; figures also show bands for β-actin. Band density of active (phosphorylated) NKCC1 was normalized to β-actin band density. A representative blot is presented along with a bar graph that shows densitometric analysis (means ± SE) of results from 3 independent experiments. For Rb uptake, intact lenses were preincubated 20 min with or without U0126 and then transferred to RbCl-containing control (300 mosM) or hyperosmotic (350 mosM) Krebs solution for 10 min in the continued presence or absence (Control) of U0126. Each value is the mean ± SE of results from 5–6 lenses. ***Significant difference (P < 0.001) from Control.
There have been reports that the WNK-SPAK/OSR1 kinase complex serves as the master controller of NKCC1 and that hyperosmotic solution causes WNK (with no lysine) kinase activation. To test whether WNK kinase is involved in the lens NKCC1 activation response, we exposed lenses to hyperosmotic solution in the presence of the WNK kinase inhibitor WNK463 (1 µM). The hyperosmotic solution-induced increases in NKCC1 phosphorylation (Fig. 8A) and Rb uptake (Fig. 8B) both were eliminated by WNK463. Importantly, WNK463 did not prevent the ERK1/2 phosphorylation response to hyperosmotic solution (Fig. 9), suggesting that ERK1/2 activation occurs before WNK activation in the sequence of signaling events.
Fig. 8.
Effect of with-no-lysine kinase (WNK) kinase inhibitor WNK463 (WNK) on Na-K-2Cl cotransporter 1 (NKCC1) phosphorylation (A) and Rb uptake (B) responses to hyperosmotic solution. Intact lenses were preincubated in Krebs solution with or without WNK463 (1 µM) for 30 min and then exposed to control or hyperosmotic solution (350 mosM) for 10 min in the continued presence or absence of WNK463. The capsule-epithelium was then removed for Western blot analysis. Figures show bands for phospho-(p)NKCC1 detected using a rabbit polyclonal anti-phospho-NKCC1 (Thr212/217) antibody (see materials and methods); figures also show bands for β-actin. Band density of active (phosphorylated) NKCC1 was normalized to β-actin band density. A representative blot is presented along with a bar graph that shows densitometric analysis (means ± SE) of results from 3 independent experiments. For Rb uptake, intact lenses were preincubated for 20 min with or without WNK463 and then transferred to RbCl-containing control (300 mosM) or hyperosmotic (350 mosM) Krebs solution for 10 min in the continued presence or absence (Control) of WNK463. Each value is the mean ± SE of results from 5–6 lenses. ***Significant difference (P < 0.001) from Control.
Fig. 9.
Effect of with-no-lysine kinase (WNK) kinase inhibitor WNK463 (WNK) on extracellular signal-regulated kinase (ERK)1/2 phosphorylation responses to hyperosmotic solution (Hyper; A) and capsaicin (Cap; B). Intact lenses were preincubated in Krebs solution with or without WNK463 (1 µM) for 30 min and then exposed to capsaicin (100 nM) or hyperosmotic solution (350 mosM) for 10 min in the continued presence or absence of WNK463. The capsule-epithelium was then removed for Western blot analysis. Figures show bands for phospho-(p)ERK1/2 as well as total (t)ERK1/2. Band density of active (phosphorylated) ERK1/2 was normalized to tERK1/2 band density. In each panel a representative blot is presented along with a bar graph that shows densitometric analysis (means ± SE) of results from 3 independent experiments. ***Significant difference (P < 0.001) from Control.
DISCUSSION
Our findings indicate that TRPV1 activation initiates a signaling cascade that sequentially activates ERK1/2, WNK kinase, and NKCC1 in the epithelium of lenses exposed to hyperosmotic solution. Based on the ability of bumetanide to abolish the responses, stimulation of NKCC1 accounts entirely for the observed increase in Rb uptake in lenses exposed to either hyperosmotic solution or capsaicin. The findings suggest that TRPV1 acts as part of a hyperosmotic stress-induced regulatory volume increase (RVI) mechanism that increases ion uptake by stimulating NKCC1. The findings align with a recent study in which we showed that hyperosmotic solution causes rapid activation of TRPV1 and subsequent calcium-dependent and PKC-mediated ERK1/2 activation (21). The present experiments describe the functional consequences of TRPV1-dependent ERK1/2 activation on inwardly directed ion uptake by NKCC1. In some respects, the lens is similar to human tracheal epithelium, which responds to hyperosmotic solution by increasing bumetanide-sensitive chloride and Rb uptake through ERK-mediated activation of NKCC1 (20). The novelty here is that the lens response to hyperosmotic solution depends on activation of TRPV1, an ion channel that is located in the epithelial monolayer at the anterior lens surface (22).
NKCC1 is expressed in both the lens epithelium and the outer cortex (3, 7, 34). In the rabbit, hypertonic stress causes increased NKCC-mediated potassium transport across the anterior and equatorial lens surfaces but not the posterior surface (3). This could reflect the greater relative importance of ion transport by NKCC1 in the epithelium monolayer, which covers the anterior and equatorial surfaces but is absent at the posterior surface (22). On the other hand, there is good reason to believe that fiber cell NKCC is functional and subject to regulation, since epithelial cells as well as fibers both display evident responses to hyperosmotic perturbation medium (34). Here, we report NKCC1 phosphorylation in the epithelium, but NKCC1 phosphorylation also occurs in fiber cells harvested from the outer cortex of lenses incubated in hypertonic medium (34). Regardless of the proportional contribution of NKCC1 in epithelium vs. fibers, the overall functional contribution of NKCC1-mediated ion transport to regulation of lens volume is not in doubt. This has far-reaching implications, because lens transparency and refractive index depend on careful control of intracellular and extracellular water distribution (9). Therefore, it is noteworthy that the NKCC1 response depends on TRPV1 activation.
TRPV1 expression is observed not only in lens but also in corneal epithelium, the basal layer of conjunctiva, ciliary epithelium, lacrimal gland, and retina (22, 23, 29). Accordingly, many of these tissues react to capsaicin, in many instances with an inflammatory or pain response (5, 35). To our knowledge, the earliest report of a capsaicin response in the lens was a study in the mouse by Gao and workers (12). Capsaicin was found to elicit a rapid transient increase in intracellular hydrostatic pressure of mouse lens surface cells measured using a microelectrode/manometer approach. A response in the opposite direction was elicited by a TRPV4 agonist GSK1016790A, which caused a transient hydrostatic pressure decrease. The findings were interpreted on the basis of a model in which TRPV1 and TRPV4 channels act as sensors in two opposite arms of a feedback control system for intracellular hydrostatic pressure in the mouse lens surface cells. It was proposed that TRPV1 might sense negative pressure and activate a phosphatidylinositol 3 (PI3)-kinase and Akt signaling pathway that ultimately inhibits Na-K-ATPase activity (12). In the present study on porcine lens, we found no detectable effect of TRPV1 activation on Na-K-ATPase activity; nor was there evidence of Akt activation (data not shown). In fact, TRPV1 activation and hyperosmotic stress were both observed to increase potassium (Rb) uptake by porcine lens in a response that could be fully accounted for by ERK1/2- and WNK-dependent stimulation of bumetanide-sensitive, NKCC1-mediated, cotransport. We speculate that the apparently different capsaicin responses in mouse and porcine lens might reflect species differences or patterns of ion transporter regulation that are different in small vs. large lenses. NKCC stimulation is a well-known regulatory volume increase (RVI) response to hyperosmotic solution-induced shrinkage in many cell types, because it brings about the net influx of osmotically active ions (14, 15, 20, 28). Inwardly directed transport by NKCC is energetically dependent on the sodium gradient established by Na-K-ATPase. If a circumstance occurs where Na-K-ATPase is impaired, the subsequent rise in cytoplasmic sodium diminishes the driving force for NKCC. It remains to be determined whether the inhibitory influence PI3-kinase and Akt signaling on Na-K-ATPase activity in the phosphatase and tensin homolog knockout mouse lens (12) might have been enough to suppress the contribution of NKCC to the capsaicin response.
As mentioned above we found no detectable inhibitory effect of hyperosmotic solution on Na-K-ATPase in porcine lens. Indeed, ouabain-sensitive Rb uptake was the same in hyperosmotic treated vs. control lenses. In a way, this is puzzling, because one might expect to see an increase of Na-K-ATPase-mediated transport due to the increase of cytoplasmic sodium that entered because of NKCC stimulation. We cannot rule out the possibility that Na-K-ATPase activity is, in fact, inhibited in the sense that it is prevented from increasing.
Cell volume regulation in response to swelling and shrinkage is understood to be fundamental to homeostasis. However, some aspects of how the cells sense and respond to volume change remain obscure. Our findings show that in isosmotic conditions NKCC-mediated, bumetanide-sensitive Rb uptake is quiescent. The response to osmotic shrinkage is triggered by activation of TRPV1 and culminates with phosphorylation/stimulation of NKCC1. It is well established that phosphorylation of NKCC is an important activation method of this cotransporter (10, 11, 13, 17), but the link to TRPV1 has not been explored in great depth. In the present study, TRPV1 blockade was found to prevent the NKCC phosphorylation as well as the increase in potassium (Rb) uptake caused by hyperosmotic solution. Moreover, capsaicin and hyperosmotic solution were shown to elicit the same pattern of responses. Consistent with activation of a single mechanism, the Rb uptake responses to capsaicin and hyperosmotic solution were not additive.
Activation of NKCC1 by the WNK-SPAK/OSR1 signaling pathway has been studied in some detail (1, 8, 17, 33). There have also been reports that show activation of NKCC1 by ERK1/2 MAPK signaling (4, 14, 20, 36). A noteworthy aspect of the present investigation is that pathways appear connected (Fig. 10), based on the evidence that ERK1/2 inhibition and WNK kinase inhibition both prevented NKCC1 phosphorylation and the hyperosmotic solution-induced Rb uptake response. The results are consistent with the notion that ERK1/2 and WNK kinase each are part of the same signaling pathway that activates lens NKCC1 (Fig. 10). The observation that WNK kinase inhibition failed to inhibit hyperosmotic solution-induced ERK1/2 phosphorylation suggests that ERK1/2 is an upstream kinase required for activation of WNK kinase (Fig. 10).
Fig. 10.
Schematic diagram of the lens response to hyperosmotic solution. Calcium dependence of the response and the role of PKC were described in an earlier study on ERK1/2 activation (21). TRPV1, transient receptor potential vanilloid 1; ERK1/2, extracellular signal-regulated kinase 1/2; NKCC1, Na-K-2Cl cotransporter 1.
In summary, we demonstrate a functional role for TRPV1 ion channels in the lens. TRPV1 is involved in the response of lenses exposed to hyperosmotic solution, presumably an osmotic shrinkage response. The expression of TRPV1 causes the lens to be sensitive to capsaicin. In humans, dietary ingestion of capsaicin is common, and therapeutic use of capsaicin and related compounds is increasing. Since capsaicin readily crosses into the brain (26), it is possible that it also enters the aqueous humor, although It remains to be determined whether this occurs to an extent that affects the lens. The expression of TRPV1 in the lens epithelium was made clear several years ago (22), but it came to light only recently that that TRPV1 activation leads to multiple calcium-dependent signaling responses, including ERK1/2 activation. Here, we were able to demonstrate a functional impact on NKCC1. Since TRPV1 appears to be activated by osmotic shrinkage, its link to NKCC1 phosphorylation is an example of a lens transporter being effectively mechanosensitive. TRPV4 channels have also been recognized as having a mechanosensitive role in regulating transport function in lens.
GRANTS
This research was supported by National Eye Institute Grant EY-009532.
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
AUTHOR CONTRIBUTIONS
M.S. and N.A.D. conceived and designed research; M.S. and A.M. performed experiments; M.S. and A.M. analyzed data; M.S., A.M., and N.A.D. interpreted results of experiments; M.S. prepared figures; M.S. drafted manuscript; M.S. and N.A.D. edited and revised manuscript; M.S. and N.A.D. approved final version of manuscript.
ACKNOWLEDGMENTS
The authors are grateful to the University of Arizona Meat Science Laboratory and West Valley Processing Meat Processors (Buckeye, AZ) for the supply of porcine eyes.
REFERENCES
- 1.Alessi DR, Zhang J, Khanna A, Hochdörfer T, Shang Y, Kahle KT. The WNK-SPAK/OSR1 pathway: master regulator of cation-chloride cotransporters. Sci Signal 7: re3, 2014. doi: 10.1126/scisignal.2005365. [DOI] [PubMed] [Google Scholar]
- 2.Alvarez LJ, Candia OA. Na+-Cl−-K+ cotransport activity in cultured bovine lens epithelial cells and its absence in intact bovine lenses. Exp Eye Res 58: 479–490, 1994. doi: 10.1006/exer.1994.1041. [DOI] [PubMed] [Google Scholar]
- 3.Alvarez LJ, Candia OA, Turner HC, Polikoff LA. Localization of a Na+-K+-2Cl− cotransporter in the rabbit lens. Exp Eye Res 73: 669–680, 2001. doi: 10.1006/exer.2001.1075. [DOI] [PubMed] [Google Scholar]
- 4.Andersen GØ, Skomedal T, Enger M, Fidjeland A, Brattelid T, Levy FO, Osnes JB. α1-AR-mediated activation of NKCC in rat cardiomyocytes involves ERK-dependent phosphorylation of the cotransporter. Am J Physiol Heart Circ Physiol 286: H1354–H1360, 2004. doi: 10.1152/ajpheart.00549.2003. [DOI] [PubMed] [Google Scholar]
- 5.Belmonte C, Acosta MC, Merayo-Lloves J, Gallar J. What causes eye pain? Curr Ophthalmol Rep 3: 111–121, 2015. doi: 10.1007/s40135-015-0073-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Bennett TM, Mackay DS, Siegfried CJ, Shiels A. Mutation of the melastatin-related cation channel, TRPM3, underlies inherited cataract and glaucoma. PLoS One 9: e104000, 2014. doi: 10.1371/journal.pone.0104000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Chee KN, Vorontsova I, Lim JC, Kistler J, Donaldson PJ. Expression of the sodium potassium chloride cotransporter (NKCC1) and sodium chloride cotransporter (NCC) and their effects on rat lens transparency. Mol Vis 16: 800–812, 2010. [PMC free article] [PubMed] [Google Scholar]
- 8.de Los Heros P, Alessi DR, Gourlay R, Campbell DG, Deak M, Macartney TJ, Kahle KT, Zhang J. The WNK-regulated SPAK/OSR1 kinases directly phosphorylate and inhibit the K+-Cl− co-transporters. Biochem J 458: 559–573, 2014. doi: 10.1042/BJ20131478. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 9.Donaldson PJ, Chee K-SN, Lim JC, Webb KF. Regulation of lens volume: implications for lens transparency. Exp Eye Res 88: 144–150, 2009. doi: 10.1016/j.exer.2008.05.011. [DOI] [PubMed] [Google Scholar]
- 10.Flatman PW. Regulation of Na-K-2Cl cotransport by phosphorylation and protein-protein interactions. Biochim Biophys Acta 1566: 140–151, 2002. doi: 10.1016/S0005-2736(02)00586-2. [DOI] [PubMed] [Google Scholar]
- 11.Flemmer AW, Giménez I, Dowd BFX, Darman RB, Forbush B. Activation of the Na-K-Cl cotransporter NKCC1 detected with a phospho-specific antibody. J Biol Chem 277: 37551–37558, 2002. doi: 10.1074/jbc.M206294200. [DOI] [PubMed] [Google Scholar]
- 12.Gao J, Sun X, White TW, Delamere NA, Mathias RT. Feedback regulation of intracellular hydrostatic pressure in surface cells of the lens. Biophys J 109: 1830–1839, 2015. doi: 10.1016/j.bpj.2015.09.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Giménez I. Molecular mechanisms and regulation of furosemide-sensitive Na-K-Cl cotransporters. Curr Opin Nephrol Hypertens 15: 517–523, 2006. doi: 10.1097/01.mnh.0000242178.44576.b0. [DOI] [PubMed] [Google Scholar]
- 14.Gosmanov AR, Schneider EG, Thomason DB. NKCC activity restores muscle water during hyperosmotic challenge independent of insulin, ERK, and p38 MAPK. Am J Physiol Regul Integr Comp Physiol 284: R655–R665, 2003. doi: 10.1152/ajpregu.00576.2002. [DOI] [PubMed] [Google Scholar]
- 15.Hoffmann EK, Lambert IH, Pedersen SF. Physiology of cell volume regulation in vertebrates. Physiol Rev 89: 193–277, 2009. doi: 10.1152/physrev.00037.2007. [DOI] [PubMed] [Google Scholar]
- 16.Hoffmann EK, Pedersen SF. Cell volume homeostatic mechanisms: effectors and signalling pathways. Acta Physiol (Oxf) 202: 465–485, 2011. doi: 10.1111/j.1748-1716.2010.02190.x. [DOI] [PubMed] [Google Scholar]
- 17.Kahle KT, Rinehart J, Lifton RP. Phosphoregulation of the Na-K-2Cl and K-Cl cotransporters by the WNK kinases. Biochim Biophys Acta 1802: 1150–1158, 2010. doi: 10.1016/j.bbadis.2010.07.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Koressaar T, Remm M. Enhancements and modifications of primer design program Primer3. Bioinformatics 23: 1289–1291, 2007. doi: 10.1093/bioinformatics/btm091. [DOI] [PubMed] [Google Scholar]
- 19.Lauf PK, Warwar R, Brown TL, Adragna NC. Regulation of potassium transport in human lens epithelial cells. Exp Eye Res 82: 55–64, 2006. doi: 10.1016/j.exer.2005.05.002. [DOI] [PubMed] [Google Scholar]
- 20.Liedtke CM, Cole TS. Activation of NKCC1 by hyperosmotic stress in human tracheal epithelial cells involves PKC-delta and ERK. Biochim Biophys Acta 1589: 77–88, 2002. doi: 10.1016/S0167-4889(01)00189-6. [DOI] [PubMed] [Google Scholar]
- 21.Mandal A, Shahidullah M, Delamere NA. TRPV1-dependent ERK1/2 activation in porcine lens epithelium. Exp Eye Res 172: 128–136, 2018. doi: 10.1016/j.exer.2018.04.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Martínez-García MC, Martínez T, Pañeda C, Gallego P, Jimenez AI, Merayo J. Differential expression and localization of transient receptor potential vanilloid 1 in rabbit and human eyes. Histol Histopathol 28: 1507–1516, 2013. doi: 10.14670/HH-28.1507. [DOI] [PubMed] [Google Scholar]
- 23.Mergler S, Valtink M, Takayoshi S, Okada Y, Miyajima M, Saika S, Reinach PS. Temperature-sensitive transient receptor potential channels in corneal tissue layers and cells. Ophthalmic Res 52: 151–159, 2014. doi: 10.1159/000365334. [DOI] [PubMed] [Google Scholar]
- 24.Pelis RM, Shahidullah M, Ghosh S, Coca-Prados M, Wright SH, Delamere NA. Localization of multidrug resistance-associated protein 2 in the nonpigmented ciliary epithelium of the eye. J Pharmacol Exp Ther 329: 479–485, 2009. doi: 10.1124/jpet.108.149625. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Reinach PS, Mergler S, Okada Y, Saika S. Ocular transient receptor potential channel function in health and disease. BMC Ophthalmol 15, Suppl 1: 153, 2015. doi: 10.1186/s12886-015-0135-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Rollyson WD, Stover CA, Brown KC, Perry HE, Stevenson CD, McNees CA, Ball JG, Valentovic MA, Dasgupta P. Bioavailability of capsaicin and its implications for drug delivery. J Control Release 196: 96–105, 2014. doi: 10.1016/j.jconrel.2014.09.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Rozen S, Skaletsky H. Primer3 on the WWW for General Users and for Biologist Programmers. In: Bioinformatics Methods and Protocols, edited by Misener S, Krawetz SA. Totowa, NJ: Humana, 1999, p. 365–386. doi: 10.1385/1-59259-192-2:365. [DOI] [PubMed] [Google Scholar]
- 28.Russell JM. Sodium-potassium-chloride cotransport. Physiol Rev 80: 211–276, 2000. doi: 10.1152/physrev.2000.80.1.211. [DOI] [PubMed] [Google Scholar]
- 29.Sappington RM, Sidorova T, Ward NJ, Chakravarthy R, Ho KW, Calkins DJ. Activation of transient receptor potential vanilloid-1 (TRPV1) influences how retinal ganglion cell neurons respond to pressure-related stress. Channels (Austin) 9: 102–113, 2015. doi: 10.1080/19336950.2015.1009272. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Shahidullah M, Mandal A, Beimgraben C, Delamere NA. Hyposmotic stress causes ATP release and stimulates Na,K-ATPase activity in porcine lens. J Cell Physiol 227: 1428–1437, 2012. doi: 10.1002/jcp.22858. [DOI] [PubMed] [Google Scholar]
- 31.Shahidullah M, Mandal A, Delamere NA. Damage to lens fiber cells causes TRPV4-dependent Src family kinase activation in the epithelium. Exp Eye Res 140: 85–93, 2015. doi: 10.1016/j.exer.2015.08.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Shahidullah M, Mandal A, Delamere NA. TRPV4 in porcine lens epithelium regulates hemichannel-mediated ATP release and Na-K-ATPase activity. Am J Physiol Cell Physiol 302: C1751–C1761, 2012. doi: 10.1152/ajpcell.00010.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Thastrup JO, Rafiqi FH, Vitari AC, Pozo-Guisado E, Deak M, Mehellou Y, Alessi DR. SPAK/OSR1 regulate NKCC1 and WNK activity: analysis of WNK isoform interactions and activation by T-loop trans-autophosphorylation. Biochem J 441: 325–337, 2012. doi: 10.1042/BJ20111879. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Vorontsova I, Donaldson PJ, Kong Z, Wickremesinghe C, Lam L, Lim JC. The modulation of the phosphorylation status of NKCC1 in organ cultured bovine lenses: Implications for the regulation of fiber cell and overall lens volume. Exp Eye Res 165: 164–174, 2017. doi: 10.1016/j.exer.2017.08.009. [DOI] [PubMed] [Google Scholar]
- 35.Wang Z, Yang Y, Yang H, Capó-Aponte JE, Tachado SD, Wolosin JM, Reinach PS. NF-κB feedback control of JNK1 activation modulates TRPV1-induced increases in IL-6 and IL-8 release by human corneal epithelial cells. Mol Vis 17: 3137–3146, 2011. [PMC free article] [PubMed] [Google Scholar]
- 36.Wong JA, Gosmanov AR, Schneider EG, Thomason DB. Insulin-independent, MAPK-dependent stimulation of NKCC activity in skeletal muscle. Am J Physiol Regul Integr Comp Physiol 281: R561–R571, 2001. doi: 10.1152/ajpregu.2001.281.2.R561. [DOI] [PubMed] [Google Scholar]
- 37.Ye J, Zadunaisky JA. Study of the Ca2+/Na+ exchange mechanism in vesicles isolated from apical membranes of lens epithelium of spiny dogfish (Squalus acanthias) and bovine eye. Exp Eye Res 55: 243–250, 1992. doi: 10.1016/0014-4835(92)90188-X. [DOI] [PubMed] [Google Scholar]










