Skip to main content
Iranian Journal of Microbiology logoLink to Iranian Journal of Microbiology
. 2018 Oct;10(5):294–299.

Distribution of extended-spectrum β-lactamases (ESBLs) among Salmonella serogroups isolated from pediatric patients

Reza Ranjbar 1,*, Mehrdad Ardashiri 1, Sakineh Samadi 2, Davoud Afshar 3
PMCID: PMC6340002  PMID: 30675325

Abstract

Background and Objectives:

Extended-spectrum β-lactamases (ESBLs) and fluoroquinolones are generally used to treat invasive Salmonella infections, but emergence of antibiotic-resistant strains are increasing worldwide. This study was aimed to investigate the distribution of ESBLs among Salmonella serogroups isolated from pediatric patients in Tehran, Iran.

Materials and Methods:

The study included all Salmonella isolates recovered from pediatric patients admitted to Children’s Medical Center, Tehran, Iran during 2015–2016. Bacterial isolation and identification were performed by standard biochemical and agglutination tests. Antimicrobial susceptibility testing was done according to the Clinical and Laboratory Standards Institute (CLSI). Polymerase chain reaction was used to identify the genetic determinants responsible for ESBL phenotypes.

Results:

A total of 138 S. enterica serovars were isolated from stool specimens, including serogroup A (1), serogroup B (18), serogroup C (41) and serogroup D (78). Forty isolates out of 138 Salmonella strains had shown ESBL-positive phenotype. All ESBL-positive isolates showed multiple resistant phenotype. Resistance to more than 3 antimicrobial agents was observed among ESBL-positive strains. The frequency of Salmonella strains carrying the blaCTX, blaTEM and blaSHV genes was 17 (12.3%), 40 (29.9%) and 4 (2.89%) respectively.

Conclusion:

The high rates of ESBLs positive-Salmonella strains recovered from pediatric patients is alarming and indicates a necessity to substitute the cephalosporins with a proper alternative.

Keywords: Salmonella, Extended-spectrum beta-lactamases, Ciprofloxacin resistance

INTRODUCTION

Gastroenteritis, also known as infectious diarrhea, accounts for the most important health problems worldwide, particularly in developing countries (1, 2). Salmonella is considered as one of the most common bacterial causes of acute gastroenteritis and food-borne infections worldwide (3). Salmonella gastroenteritis is usually a self-limiting disease. Salmonella species are prevalent throughout the world including Iran (4).

Extensive use of antibiotics in humans leads to antibiotic resistance among some bacterial species (5). Application of antibiotics in animal feeds, especially in poultry industry, also led to increased antibiotics resistance (6). Salmonella enterica serovars are associated with poultry settings and therefore, the consumption of their products may increase the risk of antibiotic-resistance distribution to humans (7). The resistant strains are now common worldwide and it is believed that they acquire their resistance in the animal hosts (8).

Antibiotic resistance among Salmonella enterica serovars has been increasing (9, 10) and existence of isolates with resistance to several antibiotics is also a concern in treatment of salmonellosis. Resistance to antibiotics due to production of β-lactamase enzymes is common among Salmonella strains and other gram negative bacilli. Recent studies show that Salmonella enterica strains isolated from different countries, carry the extended-spectrum β-lactamases (ESBLs) such as CTX-M, SHV, TEM and ACC-1 enzymes (11, 12).

There is limited data about the prevalence of Salmonella producing ESBLs in Iran (13, 14), however, it seems to be more than what is reported in the published literatures. The aim of the present study was to characterize the β-lactamase–producing Salmonella isolates recovered from pediatric patients with diarrhea in Tehran, Iran over a 2-year period.

MATERIALS AND METHODS

Bacterial culture and isolation.

The study included all Salmonella isolates recovered from pediatrics patients admitted to Children’s Medical Center, Tehran, Iran from Jan. 2015 to Dec. 2016. The stool specimens were transferred into Selenite-F Broth and incubated at 37°C for 6 h. These cultures were again sub-cultured on Salmonella-Shigella agar and Bismuth sulphite agar (Merck, Germany) and finally, single colonies were identified using standard biochemical tests (15). Then, Salmonella isolates were serogrouped by commercial typing anti-sera.

Antibiotic susceptibility testing and ESBL screening.

Antibiotic susceptibility was determined according to the Clinical and Laboratory Standard Institute (CLSI) standards using antibiotic discs (MAST UK). The antibiotics selected for the panel were the following: ampicillin (AMP 10 μg), ciprofloxacin (CIP, 5 μg), ceftriaxone (CRO, 30 μg), cefotaxim (CTX, 30 μg) and ceftazidime (CAZ 30 μg). Briefly, bacterial suspensions were provided from overnight cultures, adjusted to the 0.5 McFarland turbidity standard and then, the organisms were evenly spread on the surface of a 10×150 mm Muller Hinton agar (Difco, USA) plate using a cotton swab. After about 15 min, the disks were applied to the plates and incubated at 37°C for 18h. Finally, the diameter of the inhibition zone was measured using a ruler.

The double-disk synergy method was used by applying of ceftriaxone (CRO, 30 μg), cefotaxim (CTX, 30 μg) and ceftazidime (CAZ 30 μg) next to (25 mm) a disc of augmentin (amoxicillin 20 μg + clavulanate 10 μg). The zone of inhibition greater than 5 mm of cephalosporin toward the augmentin disc was interpreted as positive for ESBL production.

pCR.

ESBL positive isolates were cultured on LB broth and incubated at 37°C for 24 hr. The cultures were centrifuged at 9000 RPM for 3 min and genomic DNA was extracted using QIAamp DNA Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions. The concentration of extracted DNA was calculated by an ND-1000 spectrophotometer (Nano Drop, Wilmington, DE, USA).

For each blaTEM, blaSHV and blaCTX-M gene, polymerase chain reaction was carried out in a final 25 ul reaction mixture containing 12.5 μL of 2×PCR Master Mix, 10 pmol of both forward and reverse primers (Bioneer, Korea) (Table 1) and 50 ng DNA.

Table 1.

Primers used in this study.

Target gene Primer name Primer sequence (5′→3′) Amplicon size (bp) Reference
bla TEM TEM-F ATGAGTATTCAACATTTCCG 867 (16)
TEM-R CTGACAGTTACCAATGCTTA
bla SHV SHV-F TTAACTCCCTGTTAGCCA 796 (17)
SHV-R GATTGCTGATTTCGCCC
bla CTX-M CTX-F CGCTTTGCGATGTGCAG 550 (17)
CTX-R ACCGCGATATCGTTGGT

The PCR was run at the following temperatures cycles: initial denaturation at 94°C, 5 min; 30 cycles of 94°C for 30 s, [60°C for 45 s (CTX-M), 54°C for 30 s (SHV), 52.2°C for 60 s (TEM)], and 72°C for 1 min; and final extension at 72°C for 10 min using a thermocycler (Eppendorf (W/V) agarose gel, stained with a DNA Safe Stain (CinnaGen, Iran) and finally visualized under a gel documentation system (Bio-Rad, Germany).

RESULTS

A total of 2,200 stool specimens were obtained from patients with diarrhea. One hundred- thirty-eight S. enterica serovars were isolated from stool specimens, that included serogroup A (n=1), serogroup B (n=18), serogroup C (n=41) and serogroup D (n=78). Disk diffusion testing showed Salmonella serogroup A strains were susceptible to ampicillin, ceftriaxone, cefotaxime, ciprofloxacin and ceftazidime while other serogroups had resistance phenotypes (Table 2). As show in Table 2, all strains were susceptible to ciprofloxacin.

Table 2.

Susceptibility of Salmonella serogroups to antibiotics

Antibiotics* Group A Group B Group C Group D Total
AMP (10 μg) - 2 6 3 11
CTX (30 μg) - - 4 2 6
CRO (30 μg) - 6 14 20 40
CAZ (30 μg) - 6 14 20 40
CIP (5 μg) - - - - 0
n=1 n=18 n=41 n=78 n=138
*

AMP, ampicillin; CRO, ceftriaxone; CTX, cefotaxime; CAZ, ceftazidime; CIP, ciprofloxacin

According to results of antibiotic susceptibility testing, four resistance profiles were obtained as follows: 1) AMP resistance, 2) CRO, CAZ resistance, 3) CRO, CAZ, AMP resistance and 4) CTX, CRO, CAZ, AMP, CIP resistance (Table 3).

Table 3.

Antibiotic resistance profiles among Salmonella serogroups.

Profiles number Antibiotics resistance profile Serogroup (number of isolates)
1 AMP B (1), C (1) and D (1)
2 CRO, CAZ B (5), C (9) and D (17)
3 CRO, CAZ, AMP B (1), C (2) and D (1)
4 CTX, CRO, CAZ, AMP C (4) and D (2)

ESBLs screening test.

In this study, the blaCTX, blaTEM and blaSHV β-lactamse genes were detected among isolates using the double disc synergy method and also confirmed by PCR (Figs. 13). Forty strains (28.98%) of 138 isolates were positive for ESBL genes belonging to ESBL-CTX (n=17, 12.3%), ESBL-TEM (n=40, 29.9%) and ESBL-SHV (n=4, 2.89%) β-lactamase.

Fig. 1.

Fig. 1.

Electrophoresis of TEM amplicons (867 bp) on agarose gel 1%. Lane M, DNA marker, lane 1–9, PCR products from Salmonella isolates.

Fig. 3.

Fig. 3.

Electrophoresis of blaSHV gene amplicons (7796 bp) on agarose gel 1%. Lane PC, positive control; lane M, DNA marker; lane 1–4 PCR, product from Salmonella isolate.

Fig. 2.

Fig. 2.

Electrophoresis of blaCTX gene amplicons (519 bp) on agarose gel 1%. Lane PC, positive control; lane M, DNA marker; lane 1–4PCR, products from Salmonella isolates.

DISCUSSION

Antibiotic resistance among Salmonella species is a major challenge in public health and is rapidly increasing (18). Recently, multidrug resistant strains of Salmonella have also been reported (1923). These strains cause high mortality and morbidity and in most cases, leading to bloodstream infections and patient hospitalization (24). Multidrug resistant strains are common among animal populations and spreading worldwide (25). Although this phenotype has been reported in S. enterica serovar. Typhimurium, S. enterica serovar. Paratyphi and S. enterica serovar. Agona (26, 27), it may exist in other serotypes such as S. enterica serovar. Enteritidis (28, 29). Recently, resistance to ampicillin, chloramphenicol, trimethoprim/sulfamethoxazole, quinolones and cephalosporins have also been reported among Salmonella strains (30).

Cephalosporins are commonly used to treat Salmonella infections. However, in our study, resistance to cephalosporins was observed in two serogroups, indicating high prevalence of cephalosporins resistance among Iranian isolates. These results are similar to other studies reporting resistance to cephalosporins in S. enterica serovars isolated from other countries. Rotimi et al. found that from a total of 407 isolates, 116 isolates possessed the ESBL resistance phenotypes (12.1% CTX-M-15; 24.6% TEM (31). The high rates of multidrug resistance and ESBL positive Salmonella have also been observed in China. Yu et al. found that most S. enterica serovar. Typhimurium isolates had a resistance phenotype to multiple antimicrobial agents, including tetracycline, trimethoprim/sulfamethoxazole, ampicillin, chloramphenicol and cefotaxime and also a total of 79.0% of S. enterica serovar. Typhimurium isolates harbor blaTEM-1b (32). According to above data and emergence of ESBL producing Salmonellae strains, the effectiveness of cephalosporins may be challengeable against Salmonella infections.

In present study, all isolates were found to be susceptible to ciprofloxacin. The result is inconsistent with other reports worldwide (3335). Cui et al. showed that the high prevalence of resistance to fluoroquinolone among S. Typhimurium isolates may be affected by various factors such as hospitalization (36). Using livestock products is also another way of acquisition of ciprofloxacin-resistant S. Typhimurium for the reason that livestock products are a common source of salmonellosis (37). Susceptibility to ciprofloxacin among other strains such as S. enterica serovar. Typhi has also been identified (38). It seems that ciprofloxacin can be considered as the drug of choice in treating Salmonella infections in Iran (39).

In conclusion, our study showed high rates of ESBL positive-Salmonella strains isolated from pediatric patients, suggesting a necessity to substitute the cephalosporins with a proper alternative. Although all of isolates in our study were found to be susceptible to ciprofloxacin, it is better to perform antibiotic susceptibility testing before treatment of Salmonella infections.

ACKNOWLEDGEMENTS

We would like to thank the “Clinical Research Development Center of Baqiyatallah hospital” for their kind cooperation. This study was financially supported in part by “Clinical Research Development Center of Baqiyatallah hospital”.

REFERENCES

  • 1.Ranjbar R, Salimkhani E, Sadeghifard N, Yazdi J, Morovvati S, Jonaidi N, et al. An outbreak of gastroenteritis of unknown origin in Tehran, July 2003. Pak J Biol Sci 2007;10:1138–1140. [DOI] [PubMed] [Google Scholar]
  • 2.Ranjbar R, Naghoni A, Afshar D, Nikkhahi F, Mohammadi M. Rapid molecular approach for simultaneous detection of Salmonella spp., Shigella spp., and Vibrio cholera. Osong Public Health Res Perspect 2016;7:373–377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Octavia S, Lan R. Multiple-locus variable-number tandem-repeat analysis of Salmonella enterica serovar typhi. J Clin Microbiol 2009; 47: 2369–2376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Naghoni A, Ranjbar R, Tabaraie B, Farshad S, Owlia P, Safiri Z, et al. High prevalence of integron-mediated resistance in clinical isolates of Salmonella enterica. Jpn J Infect Dis 2010;63:417–421. [PubMed] [Google Scholar]
  • 5.Bada-Alambedji R, Fofana A, Seydi M, Akakpo AJ. Antimicrobial resistance of Salmonella isolated from poultry carcasses in Dakar (Senegal). Braz J Microbiol 2006;37:510–515. [Google Scholar]
  • 6.Landers TF, Cohen B, Wittum TE, Larson EL. A review of antibiotic use in food animals: perspective, policy, and potential. Public Health Rep 2012;127:4–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Firoozeh F, Zahraei-Salehi T, Shahcheraghi F, Karimi V, Aslani MM. Characterization of class I integrons among Salmonella enterica serovar Enteritidis isolated from humans and poultry. FEMS Immunol Med Microbiol 2012;64:237–243. [DOI] [PubMed] [Google Scholar]
  • 8.Threlfall EJ. Antimicrobial drug resistance in Salmonella: problems and perspectives in food-and water-borne infections. FEMS Microbiol Rev 2002;26:141–148. [DOI] [PubMed] [Google Scholar]
  • 9.Hendriksen RS, Vieira AR, Karlsmose S, Lo Fo Wong DM, Jensen AB, Wegener HC, et al. Global monitoring of Salmonella serovar distribution from the World Health Organization Global Foodborne Infections Network Country Data Bank: results of quality assured laboratories from 2001 to 2007. Foodborne Pathog Dis 2011;8:887–900. [DOI] [PubMed] [Google Scholar]
  • 10.Ranjbar R, Giammanco GM, Farshad S, Owlia P, Aleo A, Mammina C. Serotypes, antibiotic resistance, and class 1 integrons in Salmonella isolates from pediatric cases of enteritis in Tehran, Iran. Foodborne Pathog Dis 2011;8:547–553. [DOI] [PubMed] [Google Scholar]
  • 11.Hasman H, Mevius D, Veldman K, Olesen I, Aarestrup FM. β-Lactamases among extended-spectrum β-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J Antimicrob Chemother 2005;56:115–121. [DOI] [PubMed] [Google Scholar]
  • 12.Archambault M, Petrov P, Hendriksen RS, Asseva G, Bangtrakulnonth A, Hasman H, et al. Molecular characterization and occurrence of extended-spectrum β-lactamase resistance genes among Salmonella enterica serovar Corvallis from Thailand, Bulgaria, and Denmark. Microb Drug Resist 2006;12:192–198. [DOI] [PubMed] [Google Scholar]
  • 13.Hamidian M, Tajbakhsh M, Walther-Rasmussen J, Zali M-R. Emergence of extended-spectrum beta-lactamases in clinical isolates of Salmonella enterica in Tehran, Iran. Jpn J Infect Dis 2009;62:368–371. [PubMed] [Google Scholar]
  • 14.Jazayeri Moghadas A, Irajian G, Ranjbar R. Detection of extended spectrum beta lactamase producing Salmonella spp. and multidrug resistance pattern. Iran J Pathol 2009;4:128–132. [Google Scholar]
  • 15.Das D, Panda SK, Jena B, Nanda H. Conventional and molecular detection of Salmonella species in backyard poultry of Odisha state in India. J Entomol Zool Stud 2017; 5: 837–840. [Google Scholar]
  • 16.Cho S-H, Han SY, Kang Y-H. Possibility of CTX-M-14 Gene transfer from Shigella sonnei to a commensal Escherichia coli strain of the gastroenteritis microbiome. Osong Public Health Res Perspect 2014;5:156–160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Sharma J, Sharma M, Ray P. Detection of TEM & SHV genes in Escherichia coli & Klebsiella pneumoniae isolates in a tertiary care hospital from India. Indian J Med Res 2010; 132: 332–336 [PubMed] [Google Scholar]
  • 18.DiMarzio M, Shariat N, Kariyawasam S, Barrangou R, Dudley EG. Antibiotic resistance in Salmonella enterica serovar Typhimurium associates with CRISPR sequence type. Antimicrob Agents Chemother 2013;57:4282–4289. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Glynn MK, Bopp C, Dewitt W, Dabney P, Mokhtar M, Angulo FJ. Emergence of multidrug-resistant Salmonella enterica serotype Typhimurium DT104 infections in the United States. N Engl J Med 1998;338:1333–1338. [DOI] [PubMed] [Google Scholar]
  • 20.Olsen SJ, Ying M, Davis MF, Deasy M, Holland B, Iampietro L, et al. Multidrug-resistant Salmonella typhimurium infection from milk contaminated after pasteurization. Emerg Infect Dis 2004;10:932–935. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Gupta A, Fontana J, Crowe C, Bolstorff B, Stout A, Duyne SV, et al. Emergence of multidrug-resistant Salmonella enterica serotype Newport infections resistant to expanded-spectrum cephalosporins in the United States. J Infect Dis 2003;188:1707–1716. [DOI] [PubMed] [Google Scholar]
  • 22.Gal-Mor O, Valinsky L, Weinberger M, Guy S, Jaffe J, Schorr YI, et al. Multidrug-resistant Salmonella enterica serovar Infantis, Israel. Emerg Infect Dis 2010;16:1754–1757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Rabatsky-Ehr T, Whichard J, Rossiter S, Holland B, Stamey K, Headrick ML, et al. Multidrug-resistant strains of Salmonella enterica Typhimurium, United States, 1997–1998. Emerg Infect Dis 2004;10:795–801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Varma JK, Mølbak K, Barrett TJ, Beebe JL, Jones TF, Rabatsky-Ehr T, et al. Antimicrobial-resistant nontyphoidal Salmonella is associated with excess bloodstream infections and hospitalizations. J Infect Dis 2005;191:554–561. [DOI] [PubMed] [Google Scholar]
  • 25.Adhikari B, Besser T, Gay J, Fox L, Davis M, Cobbold R, et al. Introduction of new multidrug-resistant Salmonella enterica strains into commercial dairy herds. J Dairy Sci 2009;92:4218–4228. [DOI] [PubMed] [Google Scholar]
  • 26.Boyd D, Peters GA, Cloeckaert A, Boumedine KS, Chaslus-Dancla E, Imberechts H, et al. Complete nucleotide sequence of a 43-kilobase genomic island associated with the multidrug resistance region of Salmonella enterica serovar Typhimurium DT104 and its identification in phage type DT120 and serovar Agona. J Bacteriol 2001;183:5725–5732. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Meunier D, Boyd D, Mulvey MR, Baucheron S, Mammina C, Nastasi A, et al. Salmonella enterica serotype Typhimurium DT 104 antibiotic resistance Genomic Island I in serotype Paratyphi B. Emerg Infect Dis 2002;8:430–433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lu Y, Zhao H, Sun J, Liu Y, Zhou X, Beier RC, et al. Characterization of multidrug-resistant Salmonella enterica serovars Indiana and Enteritidis from chickens in Eastern China. PLoS One 2014;9(5):e96050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ranjbar R, Naghoni A, Yousefi S, Ahmadi A, Jonaidi N, Panahi Y. The study of genetic relationship among third generation cephalosporin-resistant Salmonella enterica strains by ERIC-PCR. Open Microbiol J 2013;7:142–145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Bhutta ZA. Current concepts in the diagnosis and treatment of typhoid fever. BMJ 2006;333:78–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Rotimi VO, Jamal W, Pal T, Sovenned A, Albert MJ. Emergence of CTX-M-15 type extended-spectrum β-lactamase-producing Salmonella spp. in Kuwait and the United Arab Emirates. J Med Microbiol 2008; 57:881–886. [DOI] [PubMed] [Google Scholar]
  • 32.Yu F, Chen Q, Yu X, Li Q, Ding B, Yang L, et al. High prevalence of extended-spectrum beta lactamases among Salmonella enterica Typhimurium isolates from pediatric patients with diarrhea in China. PLoS One 2011;6(3):e16801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Kuang D, Zhang J, Xu X, Shi W, Chen S, Yang X, et al. Emerging high-level ciprofloxacin resistance and molecular basis of resistance in Salmonella enterica from humans, food and animals. Int J Food Microbiol 2018; 280:1–9. [DOI] [PubMed] [Google Scholar]
  • 34.Mąka Ł, Maćkiw E, Stasiak M, WoŁkowicz T, Kowalska J, Postupolski J, et al. Ciprofloxacin and nalidixic acid resistance of Salmonella spp. isolated from retail food in Poland. Int J Food Microbiol 2018;276:1–4. [DOI] [PubMed] [Google Scholar]
  • 35.Bhagra S, Sood A, Singh D, Kanga A. Increased resistance to nalidixic acid and ciprofloxacin in Salmonella isolates from the Sub Himalayan region. Int J Res Med Sci 2017;5:4025–4029. [Google Scholar]
  • 36.Cui S, Li J, Sun Z, Hu C, Jin S, Guo Y, et al. Ciprofloxacin-resistant Salmonella enterica serotype Typhimurium, China. Emerg Infect Dis 2008;14:493–495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Galanis E, Wong DMLF, Patrick ME, Binsztein N, Cieslik A, Chalermchaikit T, et al. Web-based surveillance and global Salmonella distribution, 2000–2002. Emerg Infect Dis 2006;12:381–388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Khanal B, Sharma SK, Bhattacharya SK, Bhattarai NR, Deb M, Kanungo R. Antimicrobial susceptibility patterns of Salmonella enterica serotype Typhi in eastern Nepal. J Health Popul Nutr 2007;25:82–87. [PMC free article] [PubMed] [Google Scholar]
  • 39.Rizi KS, Peerayeh SN, Bakhshi B, Rahbar M. Prevalence of the blaCTX-M-1 group and their transferability in resistant clinical isolates of Salmonella serogroups from several hospitals of Tehran. Iran J Microbiol 2015;7:203–207. [PMC free article] [PubMed] [Google Scholar]

Articles from Iranian Journal of Microbiology are provided here courtesy of Tehran University of Medical Sciences

RESOURCES