Abstract
Premise of the Study
Microsatellite markers were developed for Primula sinolisteri, a perennial distylous herb belonging to section Obconicolisteri (Primulaceae), to facilitate future investigations of the population genetics and mating patterns of populations in this species.
Methods and Results
We developed 30 microsatellite markers for P. sinolisteri using HiSeq X‐Ten sequencing and measured polymorphism and genetic diversity in a sample of 36 individuals from three natural populations. The markers displayed relatively high polymorphism, with the number of observed alleles per locus ranging from one to 19 (mean = 4.42). The observed and expected heterozygosity ranged from 0–1.000 and 0.083–0.882, respectively. Twenty‐nine of the loci were also successfully amplified in homostylous P. sinolisteri var. aspera.
Conclusions
The microsatellite markers we have identified in P. sinolisteri provide powerful tools for investigating patterns of population genetic diversity and the evolutionary relationships between heterostyly and homostyly in this species.
Keywords: distyly, HiSeq, homostyly, microsatellites, Primula sinolisteri, Primulaceae
Primula sinolisteri Balf. f. var. sinolisteri (Primulaceae) is an animal‐pollinated, perennial, herbaceous species belonging to Primula L. sect. Obconicolisteri. It is restricted to northwestern Yunnan, from the Dali range to the Tibetan border (Hu and Kelso, 1996; Richards, 2003), and commonly occurs in dry rocky pastures at elevations between 2300 and 3000 m. Primula sinolisteri var. sinolisteri exhibits distyly, with populations comprising long‐styled and short‐styled floral morphs. However, P. sinolisteri var. aspera W. W. Sm. & H. R. Fletcher possesses a different floral phenotype in which stigmas and anthers occur at a similar height within flowers, a condition known as homostyly. Distyly and homostyly are widely reported in Primula (Richards, 2003). Phylogenetic reconstructions clearly indicate that the most recent common ancestor of Primula was distylous, and that homostyly has evolved repeatedly in the genus as a result of the evolutionary breakdown of heterostyly and transitions from outcrossing to selfing (Mast et al., 2006; Zhou et al., 2017).
Recent investigations of the molecular genetic architecture of the heterostyly linkage group in Primula provide an opportunity for comparative genetic analysis of the evolutionary events associated with the origin and breakdown of heterostyly (Huu et al., 2016; Li et al., 2016; Burrows and McCubbin, 2017). Therefore, because both intraspecific and interspecific variation in floral conditions occur in P. sinolisteri var. sinolisteri and closely related taxa within section Obconicolisteri, this group provides an outstanding opportunity for investigating the evolutionary relationships between distyly and homostyly and the ecological causes and population genetic consequences of mating system transitions.
Next‐generation sequencing technology is now widely used in many areas of evolutionary biology, including the development of microsatellite markers for population genetic studies. Highly polymorphic microsatellite markers are useful tools for measuring the genetic diversity and structure of plant populations as well as patterns of mating (e.g., Matheny et al., 2013; Zhou et al., 2015, 2017; Yuan et al., 2017). Here, we used next‐generation sequencing to develop a set of variable microsatellite markers in P. sinolisteri var. sinolisteri.
METHODS AND RESULTS
We isolated total genomic DNA from leaf tissue of one P. sinolisteri var. sinolisteri individual from the population SIN_QBX (Appendix 1) following a modified version of the cetyltrimethylammonium bromide (CTAB) protocol (Doyle and Doyle, 1987). We prepared a library using a NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, Massachusetts, USA). We performed sequencing on a HiSeq X‐Ten sequencer (Illumina, San Diego, California, USA) using 2 × 150 bp read length. Raw reads were obtained and deposited in the National Center for Biotechnology Information Sequence Read Archive (BioProject ID PRJNA485859; accession no. SRP157868). Using Geneious version 6.0 (Biomatters, Auckland, New Zealand), the resulting 10,687,169 raw reads were quality filtered by trimming adapter sequences and by removing reads with quality scores <10. Using the built‐in Geneious assembler, the cleaned reads were then assembled into 55,878 contigs with high sensitivity/medium for the sensitivity setting. Plastome contigs were identified using BLASTX against GenBank and were excluded.
We used the MIcroSAtellite identification tool (MISA; Thiel et al., 2003) to identify unique reads containing microsatellites based on the following criteria: more than five repeats for dinucleotides to hexanucleotides and 100 bp for the maximal number of bases between two adjacent microsatellites. Minimum product size was set to 100 bp. A total of 3264 contigs contained at least one microsatellite. Two hundred simple sequence repeat (SSR) loci with di‐ or trinucleotide repeats were randomly selected for further characterization. Primers were designed for these loci using PRIMER version 5.0 (Clarke and Gorley, 2001) using the automatic search model to detect paired PCR primers of 24 bp in length. We used a Veriti 96‐well Thermal Cycler Gradient PCR Machine (Applied Biosystems, Foster City, California, USA) to test and optimize these primers initially.
Preliminary amplification tests were carried out with four individuals of P. sinolisteri var. sinolisteri from the SIN_QBX population (Appendix 1). We performed PCR amplification using the following protocol: 20‐μL total reaction volume containing 10 μL of Master Mix (Tiangen Biotech, Beijing, China; including 3 mmol∙L−1 MgCl2, 100 mmol∙L−1 KCl, 0.5 mmol∙L−1 of each dNTP, 20 mmol∙L−1 Tris‐HCl [pH 8.3], and 0.1 units Taq polymerase), 0.6 μmol∙L−1 of each primer, 8.4 μL of deionized water, and 30–50 ng of genomic DNA. We conducted PCR amplification under the following conditions: 95°C for 3 min followed by 30 to 35 cycles at 95°C for 30 s, at the annealing temperature for each specific primer (optimized for each locus; Table 1) for 30 s, 72°C for 30 s for extension, and a final extension step at 72°C for 5 min. We separated and visualized PCR products using a QIAxcel capillary gel electrophoresis system (QIAGEN, Valencia, California, USA) with an internal 10–300‐bp size standard. Out of the 200 primer pairs that we tested, 30 microsatellite loci amplified successfully with suitable fragment lengths and showed polymorphism (Table 1).
Table 1.
Characteristics of 30 microsatellite loci isolated from Primula sinolisteri var. sinolisteri
| Locus | Primer sequences (5′–3′) | Repeat motif | Fragment size range (bp) | T a (°C) | GenBank accession no. |
|---|---|---|---|---|---|
| PROB15 | F: ATTGCCAGACAGAAAAAGGC | (AT)7 | 295–307 | 53.9 | MH180228 |
| R: CACAGTAAATTCATCACAGCAACA | |||||
| PROB29 | F: GCTTCCCAATCAAAACAATACC | (AC)11 | 151–209 | 54.7 | MH180229 |
| R: GACTCGTCGGATTTGTCCAT | |||||
| PROB46 | F: AGGCCATTACCCCCATAAAC | (CT)11 | 152–166 | 54.4 | MH180230 |
| R: TGGGCAAAGGAAGAAGAAGA | |||||
| PROB48 | F: CATTTGAATTTTGGACGCCT | (AC)7 | 256–304 | 52.3 | MH180231 |
| R: TACGGGTGAATTCGTCATTG | |||||
| PROB54 | F: CGACCAGGATTGATGTTGTG | (TG)7 | 146–156 | 55.4 | MH180232 |
| R: TGGTTCCGGAAACTACCATC | |||||
| PROB55 | F: TGTCTATCGTGGTGGGTTCA | (GA)11 | 105–121 | 54.4 | MH180233 |
| R: ATTCCGGGGTTTAATATCGG | |||||
| PROB63 | F: CCGCACCCAATCATATATCC | (AG)15 | 140–154 | 55.4 | MH180234 |
| R: GCTCAAAGATCTGCGAAACC | |||||
| PROB70 | F: TGAGGAAATTGATGGTGCAA | (AG)14 | 111–125 | 54.4 | MH180235 |
| R: GAAAGGTCAAGTGGAGCAGC | |||||
| PROB72 | F: TTTGGCCTTGCTTATTCACC | (AG)12 | 168–190 | 54.3 | MH180236 |
| R: AAATTTAGGGTGGTGGGGG | |||||
| PROB73 | F: ACCGATTTGACCTCTCATGC | (TC)6 | 95–111 | 55.4 | MH180237 |
| R: CATGCCTCTGTCATCCATTG | |||||
| PROB83 | F: TGCCAATTGCCATCCTTAAT | (TG)8 | 189–207 | 52.3 | MH180238 |
| R: TAAGTGGCAATGGTGGTGAA | |||||
| PROB100 | F: GCTTTTGTTGTTCCAGCCAT | (TCT)7 | 106–176 | 55.4 | MH180239 |
| R: AGCCCAGCAGTTCTGGAGTA | |||||
| PB01 | F: TCGTCATCATCCATTCACAA | (AG)11 | 144–172 | 50.9 | MH180240 |
| R: GATGAGATTGGGTTTGTGGC | |||||
| PB02 | F: AGCATGCTGAAGTAAGGCTTC | (AT)6 | 202–254 | 52.0 | MH180241 |
| R: GGATCGGTTTGAATGGAATG | |||||
| PB18 | F: GGGGAAATTGAGGACACAAA | (AG)10 | 228–238 | 50.9 | MH180242 |
| R: TGGATCGGTATCAGCATTGA | |||||
| PB31 | F: GCCATAAAGCAGGGTCCATA | (CT)10 | 152–174 | 55.0 | MH180243 |
| R: CTGTCGCTTGAGTAGCCGGT | |||||
| PB34 | F: TTTTTCTCCTGTGTGGGGAC | (GT)14 | 193–205 | 51.9 | MH180244 |
| R: AATCGTGCATTCGTTCCTTC | |||||
| PB35 | F: TCACCCTCTCAACAAAACCC | (GT)10 | 182–208 | 51.9 | MH180245 |
| R: GCTTTGATAAGCGGCATCAT | |||||
| PB49 | F: AAAGGGGAATGGATTGAACC | (TC)7 | 167–205 | 51.9 | MH180246 |
| R: ACCAGTGTTGGCGTTAGCTT | |||||
| PB51 | F: GAACTTCAAGGTGAGCTGCC | (GA)7 | 225–251 | 54.9 | MH180247 |
| R: GGTGGTGTTGGGTTCGTATC | |||||
| PB56 | F: GCACGAACGAGGAGTAGGAG | (GA)10 | 234–262 | 55.0 | MH180248 |
| R: AAAGCAACCAACTCCCCTCT | |||||
| PB59 | F: GGCCCCATGACAAACATATC | (TA)8 | 224–248 | 53.9 | MH180249 |
| R: GGTGAGAACCGTACTCCGAA | |||||
| PB60 | F: ATGTTTGGGAACCCATTGAA | (CA)15 | 221–233 | 49.9 | MH180250 |
| R: TCATTGAGACATGGCGAGTT | |||||
| PB61 | F: GAGACACCTGCTCACAACGA | (CT)15 | 211–221 | 53.9 | MH180251 |
| R: TCTTGCAGGCAGCTACAGAA | |||||
| PB64 | F: TATTGGATCGGAGTTGGAGC | (AC)8 | 151–171 | 51.9 | MH180252 |
| R: AGGCTTAAAAGATGCAGCCA | |||||
| PB66 | F: GAAAAGCAAAATGGAACGGA | (GA)7 | 162–174 | 50.9 | MH180253 |
| R: GCTGCCTTTCAGGTGTGTTT | |||||
| PB72 | F: CAAAGTCGATGACCGGAACT | (TC)8 | 201–209 | 53.9 | MH180254 |
| R: CCAGATCCCACGGTTAGTGT | |||||
| PB84 | F: CACTTTGGTGGGCTATGGAA | (CT)14 | 141–171 | 51.9 | MH180255 |
| R: AGCCAAGATTTGTGCAATCC | |||||
| PB85 | F: GGGCCAAAGCGAATAGACAT | (TG)17 | 164–174 | 52.9 | MH180256 |
| R: ATATACGCCGGTCTCCCTTT | |||||
| PB95 | F: TGGAGGTGAAACTGGAGGAG | (GTG)6 | 129–135 | 52.9 | MH180257 |
| R: TTTGTTAATGAGAGCGCGTG |
T a = annealing temperature.
For these 30 successful loci, we measured polymorphism in 36 individuals obtained from three natural populations of distylous P. sinolisteri var. sinolisteri and six individuals from one population of homostylous P. sinolisteri var. aspera (Appendix 1). We calculated basic population genetic parameters of diversity, including the number of alleles and observed and unbiased expected heterozygosity, using GenAlEx version 6.5 (Peakall and Smouse, 2012). We tested for deviations from Hardy–Weinberg equilibrium at each locus using GENEPOP version 4.0.7 (Rousset, 2008). Null alleles were detected by MICRO‐CHECKER (van Oosterhout et al., 2004).
The number of alleles per locus ranged from one to 19, with a mean (±SD) = 4.42 ± 1.977 (Table 2). Among polymorphic loci, the observed heterozygosity and expected heterozygosity ranged from 0–1.000 (mean ± SD = 0.564 ± 0.260) and 0.083–0.882 (0.626 ± 0.180), respectively. The inbreeding coefficient ranged from −0.599 to 1.000. Some loci deviated significantly from Hardy–Weinberg equilibrium in each population (Table 2), as a result of heterozygote deficiency. This can likely be attributed to the presence of null alleles as detected by MICRO‐CHECKER (Table 2). Among the 30 SSR markers, 29 loci were successfully amplified in P. sinolisteri var. aspera (Table 2).
Table 2.
Population genetic parameters in three populations of Primula sinolisteri var. sinolisteri and amplification tests in P. sinolisteri var. aspera.a
| Primula sinolisteri var. sinolisteri | P. sinolisteri var. aspera | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| QBX (n = 12) | JZ (n = 12) | MRS (n = 12) | TCA (n = 6) | |||||||||||
| Locus | A | H o | H e | F IS | A | H o | H e | F IS | A | H o | H e | F IS | Total A | Size range (bp) |
| PROB15 | 3 | 0.250 | 0.351c | 0.287 | 2 | 0.545 | 0.496 | −0.100 | 3 | 0.250 | 0.601c | 0.584 | 5 | 305 |
| PROB29 | 7 | 0.900 | 0.790 | −0.139 | 7 | 0.818 | 0.661 | −0.238 | 11 | 0.917 | 0.882 | −0.040 | 19 | 203 |
| PROB46 | 3 | 0.583 | 0.469 | −0.244 | 5 | 0.833 | 0.712c | −0.171 | 5b | 0.417 | 0.601c | 0.306 | 6 | 154 |
| PROB48 | 3 | 0.667 | 0.497 | −0.343 | 1 | NA | NA | NA | 1 | NA | NA | NA | 3 | 256 |
| PROB54 | 3 | 0.500 | 0.403 | −0.241 | 2 | 0.545 | 0.397 | −0.375 | 3 | 0.500 | 0.663c | 0.246 | 4 | 154–158 |
| PROB55 | 7b | 0.500 | 0.799c | 0.374 | 5 | 0.750 | 0.781c | 0.040 | 7 | 0.750 | 0.851 | 0.118 | 9 | 105–107 |
| PROB63 | 4 | 0.545 | 0.550c | 0.008 | 5 | 0.750 | 0.726 | −0.033 | 5b | 0.333 | 0.590c | 0.435 | 7 | 168 |
| PROB70 | 7b | 0.500 | 0.802c | 0.377 | 6 | 0.833 | 0.767 | −0.086 | 6b | 0.500 | 0.788 | 0.366 | 8 | 117 |
| PROB72 | 8 | 0.909 | 0.826 | −0.100 | 6b | 0.417 | 0.715 | 0.417 | 5 | 0.667 | 0.750 | 0.111 | 9 | 186 |
| PROB73 | 3 | 0.455 | 0.483 | 0.060 | 3 | 0.333 | 0.538c | 0.381 | 3 | 0.333 | 0.611c | 0.455 | 5 | 97–101 |
| PROB83 | 6 | 0.667 | 0.740 | 0.099 | 5 | 0.833 | 0.736c | −0.132 | 6b | 0.455 | 0.727 | 0.375 | 8 | 205 |
| PROB100 | 3 | 0.583 | 0.594 | 0.019 | 1 | NA | NA | NA | 7 | 0.917 | 0.813 | −0.128 | 9 | 110–112 |
| PB01 | 6b | 0.455 | 0.769 | 0.408 | 4b | 0.417 | 0.719c | 0.420 | 4 | 0.500 | 0.705 | 0.291 | 10 | 146 |
| PB02 | 5b | 0.167 | 0.632c | 0.736 | 6 | 0.917 | 0.767c | −0.196 | 5 | 0.667 | 0.681 | 0.020 | 8 | 204 |
| PB18 | 5 | 0.750 | 0.712 | −0.054 | 4 | 0.750 | 0.656 | −0.143 | 1 | NA | NA | NA | 6 | 232 |
| PB31 | b | 0.750 | 0.833c | 0.100 | 7 | 1.000 | 0.844 | −0.185 | 7 | 0.667 | 0.819 | 0.186 | 9 | 162 |
| PB34 | 1 | NA | NA | NA | 6 | 0.833 | 0.781c | −0.067 | 1 | NA | NA | NA | 6 | — |
| PB35 | 7 | 0.917 | 0.795 | −0.153 | 4b | 0.083 | 0.358c | 0.768 | 5 | 0.750 | 0.701 | −0.069 | 10 | 196–198 |
| PB49 | 6 | 0.750 | 0.767 | 0.022 | 5 | 1.000 | 0.722c | −0.385 | 5 | 0.583 | 0.642c | 0.092 | 9 | 171–173 |
| PB51 | 2 | 0.000 | 0.153c | 1.000 | 2 | 0.080 | 0.083 | 0.036 | 2 | 0.250 | 0.330 | 0.242 | 3 | 227 |
| PB56 | 4 | 0.417 | 0.413 | −0.010 | 4 | 0.583 | 0.660 | 0.117 | 8b | 0.417 | 0.674c | 0.381 | 8 | 238 |
| PB59 | 3b | 0.250 | 0.455c | 0.451 | 3 | 0.750 | 0.594 | −0.263 | 3 | 0.167 | 0.156 | −0.067 | 4 | 264–266 |
| PB60 | 5 | 0.750 | 0.681 | −0.101 | 4 | 0.667 | 0.694c | 0.039 | 2 | 0.091 | 0.087 | −0.048 | 7 | 223 |
| PB61 | 4b | 0.083 | 0.615c | 0.865 | 1 | NA | NA | NA | 5b | 0.364 | 0.702 | 0.482 | 5 | 235 |
| PB64 | 6 | 0.583 | 0.771c | 0.244 | 4 | 0.250 | 0.295c | 0.153 | 6 | 0.750 | 0.792 | 0.053 | 9 | 151–153 |
| PB66 | 3 | 0.333 | 0.288 | −0.156 | 4 | 0.333 | 0.545 | 0.389 | 4b | 0.167 | 0.573 | 0.709 | 6 | 168 |
| PB72 | 5 | 0.917 | 0.788 | −0.164 | 4 | 0.636 | 0.680 | 0.065 | 1 | NA | NA | NA | 5 | 205 |
| PB84 | 5 | 0.667 | 0.767 | 0.130 | 3 | 0.083 | 0.226c | 0.633 | 6b | 0.500 | 0.743 | 0.327 | 6 | 161–163 |
| PB85 | 5 | 0.583 | 0.757 | 0.239 | 2 | 0.512 | 0.417 | −0.228 | 4 | 0.417 | 0.663c | 0.372 | 6 | 172 |
| PB95 | 2 | 0.750 | 0.469c | −0.599 | 2b | 0.000 | 0.500c | 1.000 | 2 | 0.333 | 0.278 | −0.200 | 3 | 129–132 |
| Mean | 4.633 | 0.558 | 0.620 | 0.107 | 3.900 | 0.576 | 0.595 | 0.069 | 4.433 | 0.416 | 0.547 | 0.218 | 7.067 | — |
— = unsuccessful PCR amplification; A = number of alleles per locus; F IS = inbreeding coefficient; H e = expected heterozygosity; H o = observed heterozygosity; n = number of individuals; NA = not applicable.
Voucher and locality information are provided in Appendix 1.
Significant frequency of null alleles (P < 0.05).
Significant deviation from Hardy–Weinberg equilibrium (P < 0.05).
CONCLUSIONS
The microsatellite markers that we have isolated in P. sinolisteri var. sinolisteri will provide a valuable resource for investigating mating systems, population genetic structure, and phylogeography in P. sinolisteri and its varieties. It will be of particular interest to investigate the evolutionary relationships between distylous and homostylous populations and determine the number of transitions from outcrossing to selfing and their genetic consequences. The high discriminatory power of the microsatellite markers that we have identified will also be useful for parentage analysis and measures of disassortative mating in populations and should provide opportunities to evaluate the potential influence of ecological, demographic, and reproductive factors on mating patterns.
DATA ACCESSIBILITY
Raw reads were submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (BioProject ID PRJNA485859; accession no. SRP157868). Sequence information for the developed primers has been deposited to NCBI; GenBank accession numbers are provided in Table 1.
ACKNOWLEDGMENTS
This research was funded by the National Natural Science Foundation of China (31570384, 31770417), the Joint Fund of National Natural Science Foundation of China–Yunnan Province (U1502261), and Light of West China Program of the Chinese Academic of Sciences. The authors are grateful to J. B. Yang and Z. R. Zhang for technical assistance. Laboratory work was performed at the Laboratory of Molecular Biology at the Germplasm Bank of Wild Species, Kunming Institute of Botany, Chinese Academy of Sciences.
Appendix 1. Locality and voucher information for populations of Primula sinolisteri var. sinolisteri and P. sinolisteri var. aspera used in this study. Voucher specimens have been deposited at the herbarium of the Kunming Institute of Botany (KUN), Kunming, Yunnan, China.
| Species | Population code | Floral morph structure | Voucher no. | Location | Geographic coordinates | Elevation (m) | n |
|---|---|---|---|---|---|---|---|
| Primula sinolisteri Balf. f. var. sinolisteri | SIN_QBX | Distyly | Z. Wei 123 | Dali, China | 25°64.386′N, 100°13.554′E | 2743 | 12 |
| Primula sinolisteri var. sinolisteri | SIN_JZ | Distyly | Z. Wei 112 | Jinzhan, China | 25°80.183′N, 99°99.014′E | 2736 | 12 |
| Primula sinolisteri var. sinolisteri | SIN_MRS | Distyly | Z. Wei 118 | Heqing, China | 25°25.829′N, 100°128.13′E | 2934 | 12 |
| Primula sinolisteri var. aspera W. W. Sm. & H. R. Fletcher | ASP_TCA | Homostyly | Z. Wei 203 | Gaoligong Mountain, China | 25°17.27′N, 98°43.50′E | 2963 | 6 |
Wang, X. , Zhong L., Wu Z., Sun H., Wang H., Li D., Barrett S. C. H., and Zhou W.. 2019. Characterization of 30 microsatellite markers in distylous Primula sinolisteri (Primulaceae) using HiSeq sequencing. Applications in Plant Sciences 7(1): e1208.
Note
n = number of individuals sampled.
LITERATURE CITED
- Burrows, B. A. , and McCubbin A. G.. 2017. Sequencing the genomic regions flanking S‐linked PvGLO sequences confirms the presence of two GLO loci, one of which lies adjacent to the style‐length determinant gene CYP734A50 . Plant Reproduction 30: 53–67. [DOI] [PubMed] [Google Scholar]
- Clarke, K. R. , and Gorley R. N.. 2001. Primer v5: User Manual/Tutorial. Primer‐E Ltd., Plymouth, United Kingdom. [Google Scholar]
- Doyle, J. J. , and Doyle J. L.. 1987. A rapid DNA isolation procedure for small amounts of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. [Google Scholar]
- Hu, C. M. , and Kelso S.. 1996. Primulaceae In Wu Z. Y., and Raven P. H. [eds.], Flora of China, vol. 15: 119–120. Science Press, Beijing, China, and Missouri Botanical Garden Press, St. Louis, Missouri, USA. [Google Scholar]
- Huu, C. N. , Kappel C., Keller B., Sicard A., Takebayashi Y., Breuninger H., Nowak M. D., et al. 2016. Presence versus absence of CYP734A50 underlies the style‐length dimorphism in primroses. eLife 5: e17956. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li, J. , Cocker J. M., Wright J., Webster M. A., McMullan M., Dyer S., Swarbreck D., et al. 2016. Genetic architecture and evolution of the S locus supergene in Primula vulgaris . Nature Plants 2: 16188. [DOI] [PubMed] [Google Scholar]
- Mast, A. R. , Kelso S., and Conti E.. 2006. Are any primroses (Primula) primitively monomorphic? New Phytologist 171: 605–616. [DOI] [PubMed] [Google Scholar]
- Matheny, H. , Edwards J., and Maroja L. S.. 2013. High‐throughput microsatellite marker development for the distylous herb Primula mistassinica (Primulaceae). Applications in Plant Sciences 1(8): 1300002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peakall, P. , and Smouse P.. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research–An update. Bioinformatics 19: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Richards, A. J. 2003. Primula. Timber Press, Portland, Oregon, USA. [Google Scholar]
- Rousset, F. 2008. GENEPOP'007: A complete reimplementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103–106. [DOI] [PubMed] [Google Scholar]
- Thiel, T. , Michalek W., Varshney R. K., and Graner A.. 2003. Exploiting EST databases for the development and characterization of gene‐derived SSR‐markers in barley (Hordeum vulgare L.). Theoretical and Applied Genetics 106: 411–422. [DOI] [PubMed] [Google Scholar]
- van Oosterhout, C. , Hutchinson W. F., Wills D. P. M., and Shipley P.. 2004. MICRO‐CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535–538. [Google Scholar]
- Yuan, S. , Barrett S. C. H., Duan T. T., Qian X., Shi M. M., and Zhang D. X.. 2017. Ecological correlates and genetic consequences of evolutionary transitions from distyly to homostyly. Annals of Botany 120: 775–789. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou, W. , Barrett S. C. H., Wang H., and Li D. Z.. 2015. Reciprocal herkogamy promotes disassortative mating in a distylous species with intramorph compatibility. New Phytologist 206: 1503–1512. [DOI] [PubMed] [Google Scholar]
- Zhou, W. , Barrett S. C. H., Li H. D., Wu Z. K., Wang X. J., Wang H., and Li D. Z.. 2017. Phylogeographic insights on the evolutionary breakdown of heterostyly. New Phytologist 214: 1368–1380. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Raw reads were submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (BioProject ID PRJNA485859; accession no. SRP157868). Sequence information for the developed primers has been deposited to NCBI; GenBank accession numbers are provided in Table 1.