Skip to main content
Pain Reports logoLink to Pain Reports
. 2018 Oct 5;3(6):e685. doi: 10.1097/PR9.0000000000000685

Analgesic effects of the cathepsin K inhibitor L-006235 in the monosodium iodoacetate model of osteoarthritis pain

Lilian N Nwosu a, Peter RW Gowler a, James J Burston a, Biljana Rizoska b, Karin Tunblad b, Erik Lindström b, Urszula Grabowska b, Li Li a, Dan F McWilliams c, David A Walsh c, Victoria Chapman a,*
PMCID: PMC6344135  PMID: 30706033

Supplemental Digital Content is Available in the Text.

Keywords: Osteoclast, Pain, Joint, Rat, Osteoarthritis

Abstract

Introduction:

The mounting evidence that osteoclasts play an important role in osteoarthritis (OA) pain lead us to investigate the effects of L-006235, a potent and selective inhibitor of cathepsin K, on pain behaviour and joint pathology in a model of OA pain.

Methods:

Effects of preventative (30 and 100 mg/kg) and therapeutic (100 mg/kg) oral dosing with L-006235 on weight-bearing asymmetry, hind paw withdrawal thresholds, cartilage and bone pathology, synovial inflammation, and drug exposure were studied in the monosodium iodoacetate rat model of OA pain.

Results:

Preventative L-006235 inhibited weight-bearing asymmetry from day 14, with this measure nearly abolished by the higher dose. In the same treatment setting, L-006235 prevented lowering of hind paw withdrawal thresholds from day 7. Exposure to L-006235 in plasma was higher for the 100 mg/kg dose, compared with 30 mg/kg. Therapeutic dosing with L-006235 from day 14 significantly inhibited weight-bearing asymmetry, compared with monosodium iodoacetate vehicle rats. Regression analysis revealed a significant interaction coefficient of the effects of L-006235 on weight-bearing asymmetry and synovitis score, but not for cartilage damage nor osteophyte scores.

Conclusion:

Our novel finding that cathepsin K inhibition is analgesic in a clinically relevant model of OA pain provides new evidence for the therapeutic potential of this target.

1. Introduction

Osteoarthritis (OA) is the fastest growing chronic pain disease31,46 and is the most common form of arthritis, causing disability and reducing quality of life.11 Although OA was considered to be primarily a disease of the cartilage, clinical and preclinical evidence supports bidirectional interactions between cartilage and subchondral bone turnover in OA. The contribution of subchondral bone mechanisms to the pathogenesis and progression of OA is increasingly recognised.20

Animal models mimic key aspects of OA joint pathology and pain behaviour (see references in Ref. 44). The monosodium iodoacetate (MIA) model is associated with pain behaviour on weight-bearing, lowering of distal pain pressure threshold, synovial inflammation, cartilage damage, and subchondral bone remodelling including increased osteoclast number and numbers of osteochondral channels and osteophyte formation.47 Numbers of subchondral bone osteoclasts are significantly and positively associated with pain behaviour in the MIA model.37 Cathepsin K is a cysteine protease predominantly expressed by osteoclasts and involved in bone resorption,3 under normal physiological conditions; this enzyme degrades bone matrix proteins, such as type I collagen. In OA, cathepsin K also degrades the main components of cartilage matrix, type II collagen and aggrecan.7 Expression of cathepsin K and the osteoclast marker TRAP is increased in human OA bone.27 Cathepsin K mRNA and protein expression are increased in synovial fibroblasts and CD68+ macrophages in human OA samples,8,25 and expression in chondrocytes is increased in relation to OA severity.23

Overexpression of cathepsin K leads to spontaneous synovitis and cartilage degeneration,30,33 and this enzyme has been strongly implicated in the degradation of articular cartilage in a naturally occurring equine model of OA.43 Inhibitors of cathepsin K attenuated lesion severity and biomarkers of collagen degradation in a canine model of OA.6,26 Similarly, significant protective effects of cathepsin K inhibition on subchondral bone integrity were reported in a rabbit model of OA.14,26 Although effects of cathepsin K inhibition on OA pain behaviour have yet to be reported, such a treatment reduced the mechanosensitivity of knee afferent nerve activity in a guinea pig model of spontaneous OA,29 suggesting that cathepsin K inhibition might reduce aberrant OA pain.

The aim of this study was to evaluate the effects of inhibition of cathepsin K on pain behaviour and joint pathology in a rat model of OA. L-006235 is a potent and selective cathepsin K inhibitor with oral bioavailability and more than 5000-fold selective for cathepsin K vs cathepsins B, L, and S.32 L-006235 is potent against rat cathepsin K with an IC50 of 7 nM. Previously, prophylactic L-006235 reduced histological markers of disease severity in a murine model of inflammatory arthritis.41 In this article, we have used the MIA model of OA pain to investigate the effects of L-006235 on the development of pain behaviour, joint pathology, and a spinal marker of central sensitization in the rat. Separately, the ability of L-006235 to reverse established pain behaviour in this model of OA joint pain was investigated.

2. Methods

2.1. Animals

All animal experimental procedures conducted in the United Kingdom were in accordance with UK Home Office Animals (Scientific Procedures) Act (1986) and were in line with the ARRIVE guidelines.21 Experiments were conducted in a blinded fashion. Adult male rats (96 Sprague–Dawley rats, weight 180–200 g; Charles River, Margate, United Kingdom, group housed 4 per cage) were housed in temperature-controlled (20–22°C) rooms in conventional cages under a 12-hour light–dark cycle, lights on at 7 am, and off at 7 pm. Rats were allowed free access to standard rodent chow and water throughout the day, apart from a fasting period 4 hours before blood collections.

All animal studies performed at Medivir AB were in accordance with relevant guidelines and regulations provided by the Swedish Board of Agriculture. The ethical permissions were provided by an ethical board specialized in animal experimentation (Stockholm South Animal Research Ethical Board). Adult male rats (6 Sprague–Dawley rats, 8 weeks of age; Charles River, Sulzfeld, Germany) were housed (max 4 animals/cage) in conventional cages under a 12-hour light–dark cycle. Rats were allowed standard rodent diet and water ad libitum, except for a fasting period overnight (from 17:00 in the evening to 11:00 in the morning) before dosing with compound and for an additional 3 hours after dosing (in total 18 hours of fasting).

2.2. Intra-articular injections and behavioural testing

Intra-articular injection of MIA is associated with joint pathology12,18 and pain behaviour4,22,37 comparable with clinical OA. Investigators were blinded to the model (except in the therapeutic study where all rats received intra-articular injection of MIA) and the treatments at all stages of the study. Rats were randomly allocated to treatment groups, and then matching of control measures was performed to ensure that groups were balanced. All rats were habituated to testing area and equipment for 1 day before any procedures were conducted.

Rats were briefly anesthetized (isoflurane 2.5%–3% in 100% O2), and once areflexic received a single intra-articular injection of 1 mg MIA (Sigma, Gillingham, Dorset, United Kingdom) in 50-μL saline or 50-μL saline through the infrapatellar ligament of the left knee.37 Pain behaviour was assessed at baseline before injection (day 0) and then after intra-articular injection twice weekly. Weight distribution on the left (ipsilateral) and right (contralateral) hind limb was assessed using an incapacitance tester (Linton Instrumentation Diss, Norfolk, United Kingdom) as previously described.37 Changes in hind paw withdrawal thresholds (PWTs) were assessed using von Frey monofilaments; Linton Instrumentation, Norfolk, United Kingdom (Semmes-Weinstein monofilaments of bending forces 0.4–26 g) as previously described.37

2.3. Formulation of L-006235

L-006235 was synthesized by GVK Bio (Hyderabad, India) and formulated in 20% hydroxypropyl-beta-cyclodextrin (HP-β-CD) in water at concentrations of 3 and 10 mg/mL.

2.4. Administration of L-006235 in the monosodium iodoacetate model

In the first study, the effects of preventative treatment with 30-mg/kg L-006235 were studied. In the second study, the effects of preventative treatment with 30-mg/kg and 100-mg/kg L-006235 were studied. Rats received either vehicle (20% HP-β-CD) or L-006235 starting 1 day before MIA injection. L-006235 was administered orally twice a day for a total of 28 days (day −1 to 27 after MIA injection). Pain behaviour was measured at baseline before MIA injection and then twice a week until day 27. Pain behaviour was measured before the first dose of the day and was measured 24 hours after blood sampling (see below). In the third study, L-006235 was given once pain behaviour was established in the MIA model (therapeutic protocol). In this case, all rats received oral treatment with vehicle (twice daily) for the first 14 days after intra-articular injection of MIA. On day 14, half of the rats continued receiving vehicle and the other half received L-006235 (100 mg/kg) twice daily for 27 days (day 14–41 after MIA injection). As with the preventative study, pain behaviour was measured before the MIA injection and then twice a week until day 41 after injection. Similarly, behaviour was measured before rats received the first oral dose each day and was measured 24 hours after blood sampling (see below). See Table 1 for group sizes and Figure 1 for further study design.

Table 1.

Group sizes for in vivo studies.

graphic file with name painreports-3-e685-g001.jpg

Figure 1.

Figure 1.

Study design timelines. (A) Timeline for the 2 independent preventative dosing studies. From day −1, rats received either vehicle or L-006235 (twice daily). Rats received intra-articular (I.A.) injection of 1-mg MIA or saline into the left knee joint on day 0, and pain behaviour was quantified at baseline and twice weekly. On day 26, rats received the final dose of treatment, and 24 hours later, final pain behaviour testing was conducted, and rats were humanly euthanized. (B) Timeline for the therapeutic dosing study. Rats were dosed with either L-006235 or vehicle for 27 days starting from 14 days after MIA injection.

2.5. Blood collection

Blood was collected from the L-006235–treated animals for bioanalysis of L-006235 on day 8, 22, and 27 after MIA induction in the first study, on day 9 and 27 after MIA induction in the second study and on day 40 after MIA induction in the third (therapeutic) study (app. 500 µL). Blood was collected through the tail vein at 1, 2, 3, 6, and 24 hours after the dose. In total, 1 to 3 blood samples were collected from each rat for bioanalysis of L-006235. In the first study, samples were collected on day 8 and on day 22 at 2 hours after dose, and a third sample was collected on day 27 at 24 hours after dose. In the second study, one sample was collected at 1, 3, or 6 hours after dose at the first sampling occasion (day 9), and a second sample was collected 2 hours after dose on day 27. In the third study, one sample was collected at 3, 6, or 24 hours after dose on day 40/41. Blood was collected from all animals into separate Li-heparin–coated tubes for plasma separation and placed in room temperature for at least 30 minutes and protected from light before centrifugation (10 minutes, 3600 rpm, at approximately 22°C) within 1 hour of collection. The plasma samples were immediately frozen and stored at minimum −20°C until analysis.

2.6. Bioanalysis of L-006235

Bioanalysis of L-006235 in rat plasma was performed using protein precipitation followed by liquid chromatography-tandem mass spectrometry detection. Plasma (10 µL) was mixed with 50 µL of acetonitrile containing 100 nM of losartan and indinavir as internal standards. The sample was centrifuged at 20,000g for 10 minutes at 10°C, and the supernatant was diluted 1:1 with MilliQ water. Samples (5 μL) were injected onto the liquid chromatography-tandem mass spectrometry system. The lower limit of quantification (LLOQ) was 1 nM.

Pharmacokinetic (PK) data analysis was performed using the software Phoenix WinNonlin (version 6.4; Certara). Pharmacokinetic data for L-006235 were analysed using noncompartmental methodology, and the following PK parameters were reported:

  • (1) The area under the plasma concentration vs time curve from time 0 to time 24 hours (AUC0–24) was calculated by the log/linear trapezoidal method. The last sampling time point was 24 hours after dose.

  • (2) Maximal plasma concentration (Cmax).

  • (3) Time at maximal concentration (Tmax).

2.7. Histological staining and quantification of knee joint pathology

On day 27 (preventative studies) or day 41 (therapeutic study), rats underwent a final pain behaviour assessment and then were euthanized with sodium pentobarbital and transcardially perfused with saline, followed by 4% paraformaldehyde (in 0.1-M phosphate-buffered saline). Tibiofemoral joints with the synovia attached were dissected and postfixed in paraformaldehyde for 48 hours and were then transferred into ethylenediaminetetraacetic acid (EDTA) solution for decalcification. Knees were then sectioned for staining with haematoxylin and eosin.10 The pathology scoring was performed on 3 stained sections per rat10 as previously described.37 Cartilage damage and osteophytes were scored using the Janusz method as previously described.17 Cartilage damage was evaluated from 1 (minimal superficial damage) to 5 (severe full-thickness degeneration to tidemark). This score was multiplied by the extent of cartilage area involved (1/3, 2/3 or 3/3) to give a maximum score of 15. Osteophytes were graded from 1 to 3 for mild (<40 µm), moderate (40–160 µm), or severe (>160 µm). Synovitis was scored to assess lining thickness and cellularity from a scale of 0 (lining layer, 1–2 cells thick) to 3 (lining layer >9 cells thick and/or severe increase in cellularity).2

2.8. Synovial immunohistochemistry

Perfusion-fixated knee joint sections from the second preventative experiment were labelled for the macrophage markers CD68 and CD206 (2 sections per rat). Sections were first dewaxed in xylene before being rehydrated in decreasing concentrations of ethanol (100%, 70%) before being incubated in distilled H2O. Sections were then incubated in a Tris-EDTA buffer (10-mM Tris Base, 1-mM EDTA, 0.05% Tween 20, pH 9.0) at 90°C for 20 minutes. After returning to room temperature, sections were washed in 0.05M Tris-buffered saline (TBS) before being blocked for 10 minutes with a peroxidase blocking solution (BLOXALL, Vector Labs, Burlingame, CA). Sections were washed again in 0.05M TBS before being incubated for an hour in blocking serum (made up as described in the Vectastain Elite ABC-HRP Kit [Vector Labs, PK-6200]). Sections were then incubated in either 1:400 rabbit antimannose (Abcam, Cambridge, United Kingdom: ab64693) or 1:400 mouse anti-CD68 (BioRad, Watford, United Kingdom: MCA341GA) overnight. Sections were washed in 0.05M TBS before being incubated with biotinylated secondary antibody for 45 minutes (made up as described in the Vectastain Elite ABC-HRP Kit [Vector Labs, PK-6200]). After washes in 0.05M TBS, sections were incubated in ABC reagent for 30 minutes (made up as described in the Vectastain Elite ABC-HRP Kit [Vector Labs, PK-6200]). Sections were then incubated in 3,3′- diaminobenzidine (DAB) peroxidase (Vector Labs: SK-4100) for 9 minutes. Sections were then counterstained with Harris's haematoxylin before being dehydrated in increasing concentrations of ethanol (70%, 100%). Sections were then mounted in DPX. Immunostaining was visualised using a ×40 objective (Zeiss, Oberkochen, Germany: Axioskop-50) and imaged using a camera (Zeiss: AxioCam MRc). Images used for analysis were taken from the synovial lining and sublining layers on the medial side of the joint. Images were converted to 8-bit and passed through a bandpass filter. Images were thresholded, and the number of above threshold particles was automatically counted. Counts were checked manually to ensure consistency by the automated system. The area of synovia images was calculated, and data are presented as the number of positively stained cells per square millimeter.

2.9. Spinal cord glial cell immunofluorescence

Astrogliosis was assessed in the dorsal horn of the spinal cord using perfused tissue from study 2: preventative 100-mg/kg L-006235. The lumbar region of spinal cords from MIA rats treated with either vehicle or L-006235 was sectioned (40-µm thick sections). Immunolabelling for glial fibrillary acidic protein (GFAP) was performed as previously described,35 with sections incubated with 1:100 rabbit anti-GFAP (Abcam: ab48050) overnight at room temperature. Sections were then developed after being incubated with 1:300 Alexafluor 568 conjugated goat antirabbit secondary antibody. Images were taken from the superficial laminae of both the ipsilateral and contralateral dorsal horn with a Zeiss 200M microscope using a 20 × 0.8 numerical aperture objective lens. Images were autothresholded using the Renyi entropy threshold value,19 and the suprathreshold areas of labelling were then quantified using ImageJ software.

2.10. Quantitative real-time polymerase chain reaction

A separate cohort of rats were injected with either 1-mg/50 µL MIA (n = 6) or 50-µL saline (n = 6). Twenty-eight days after injection, rats were injected with sodium pentobarbital, and the ipsilateral dorsal quadrant of the lumbar region of the spinal cord was taken for analysis. Tissue was homogenised in TriReagent, and RNA was collected (DirectZol miniprep kit; Zymo Research, Irvine, CA) according to manufacturer's instructions. After extraction, 360 ng of total RNA was reverse transcribed using AffinityScript reverse transcriptase (Agilent Technologies, Santa Clara, CA) after manufacturer's instructions. The reactions were incubated at 25°C for 10 minutes, 37°C for 50 minutes, and 70°C for 15 minutes and then cooled on ice. Expression of the cathepsin K gene was quantified as previously described.16 Primers and probes were designed using Primer Express v3 (Thermofisher, Waltham, MA) and synthesised by Eurofins Genomics (Ebersberg, Germany). Cathepsin K forward primer 5′- CAGCAGGATGTGGGTGTTCA -3′, reverse primer 5′- CACTGCGTGTCCAGCGTTT -3′, Taqman probe 5′- CTGCTACCCGTGGTGAGCTTTGCTCTATC -3′, β-actin forward primer 5′- AGCCATGTACGTAGCCATCCA -3′, reverse primer 5′- TCTCCGGAGTCCATCACAATG -3′, and Taqman probe 5′- TGTCCCTGTATGCCTCTGGTCGTACCAC -3′.

2.11. Biomarker measurements

To assess the effects of L-006235 on biomarkers of bone resorption and cartilage degradation, a single dose of L-006235 (100 mg/kg) or vehicle (20% HP-β-CD) was administered through oral gavage to a separate group of naive rats (n = 3/group), and blood (app. 100 µL) was collected at baseline (before dosing) and at 1, 3, 6, and 24 hours after dosing for biomarker analyses. Levels of CTX-I and CTX-II in rat serum were measured using commercially available kits (RatLaps [CTX-I] EIA and Serum Pre-Clinical CartiLaps [CTX-II] ELISA; IDS Nordic, Herlev, Denmark), according to the recommendations by the manufacturer.

2.12. Data analysis

Results are displayed as mean ± SEM. All statistics were calculated using Prism 5.0 or 7.0 software (Graphpad, La Jolla, CA). Weight-bearing data were analysed with a 2-way analysis of variance (ANOVA) with a Bonferroni post hoc test. Hind PWTs were log-transformed before analysis with 2-way ANOVA with a Bonferroni post hoc test. Differences between the area under the curve for weight bearing and the log-transformed PWTs were analysed using a 1-way ANOVA. Data were considered significant if P values were less than 0.05. Differences in the expression of the cathepsin K mRNA between saline and MIA-injected rats, and the differences in GFAP immunoreactivity between L-006235 and vehicle-dosed MIA rats were compared with an unpaired t test. The statistical interaction between weight bearing and each OA feature (cartilage damage, osteophytes, or synovitis) was examined using a product term for Treatment Group*OA Pathology. Statistical significance of the interaction term provides a measure of the association between weight-bearing pain behaviour and OA pathology, and the effect of L-006235 on this association.

3. Results

3.1. Preventative L-006235 attenuates osteoarthritis pain behaviour

Intra-articular injection of MIA resulted in a significant increase in weight-bearing asymmetry and a lowering of hind PWTs over the course of the model, compared with the saline-injected control rats (supplementary Figure 1, available at http://links.lww.com/PR9/A32). Two independent preventative dosing studies were performed. Twice daily oral administration of L-006235 (30 mg/kg), but not vehicle, significantly attenuated MIA-induced pain behaviour (weight-bearing asymmetry and lowered PWTs) in the first preventative study (Figs. 2A and B, supplementary Figure 1 for time course, available at http://links.lww.com/PR9/A32). In the second preventative study, effects of twice daily oral administration of 30 and 100 mg/kg L-006235 on the 2 measures of pain behaviour were compared. Time course data analysis revealed that neither dose of L-006235 altered the early peak in weight-bearing asymmetry at day 3, but both doses consistently inhibited weight-bearing asymmetry from day 14 postmodel induction onwards (Fig. 3A). The higher dose of L-006235 nearly abolished weight-bearing asymmetry, compared with the effect of vehicle treatment, at the later time points in the study (Fig. 3A). L-006235 did not alter the initial drop in hind PWTs but did prevent any further lowering in thresholds at the later time points from day 7 onwards (Fig. 3B). There was a clear dose-related effect of L-006235 for both measures of pain behaviour, which was paralleled by a higher plasma exposure after oral administration of the higher dose of L-006235 (100 mg/kg), compared with the lower dose.

Figure 2.

Figure 2.

Effect of preventative L-006235 (30 mg/kg) on MIA-induced weight-bearing asymmetry (A) and log-transformed ipsilateral hind paw withdrawal thresholds (B) (study 1, Fig. 1 for study design). Group sizes were: saline + vehicle, n = 5; saline + L-006235, n = 6; MIA + vehicle, n = 9; and MIA + L-006235, n = 10. Data are area under the curve and were analysed with a 1-way ANOVA: ****P < 0.0001 saline + vehicle vs MIA + vehicle; ###P < 0.0001, ##P < 0.01 MIA + vehicle vs MIA + L-006235. Data are presented as mean ± SEM. ANOVA, analysis of variance.

Figure 3.

Figure 3.

Dose-related effects of L-006235 on MIA-induced weight-bearing asymmetry (A) and log-transformed ipsilateral hind paw withdrawal thresholds (B). See Figure 1 for dosing details (study 2, Fig. 1 for study design). Group sizes were saline + vehicle, n = 6; MIA + vehicle, n = 10; MIA + L-006235 (30 mg/kg), n = 9; and MIA + L-006235 (100 mg/kg), n = 9. Data were analysed with a 2-way ANOVA with a Bonferroni post hoc test: #P < 0.05; ###P < 0.001, ####P < 0.0001 MIA + vehicle vs MIA + L-006235 (30 mg/kg); *P < 0.05, **P < 0.01, and ****P < 0.0001 MIA + vehicle vs MIA + L-006235 (100 mg/kg). Data are presented as mean ± SEM. ANOVA, analysis of variance.

To ascertain whether the effects of L-006235 on pain behaviour were related to effects on joint damage, histological analysis was performed. Intra-articular injection of MIA was associated with significant cartilage damage, synovitis, and osteophyte score at the end of the study (Fig. 4). Neither dose of L-006235 significantly altered the 3 parameters of joint damage studied (Figs. 4A–C, supplementary Figures 2A and B, available at http://links.lww.com/PR9/A32). However, after treatment of MIA rats with the higher dose of L-006235, synovitis scores were not significantly different compared with saline vehicle-treated rats (Fig. 4B). The higher variability in the osteophyte score in MIA vehicle-treated rats reduced the opportunity to detect any potential effects of L-006235 on this parameter (Fig. 4C). To understand the potential relationship between effects of L-006235 on pain behaviour and joint pathology, a regression analysis was performed. There was a significant interaction coefficient of the effects of L-006235 on weight-bearing asymmetry and synovitis score, but not for the cartilage damage or numbers of osteophytes (Figs. 4D–F), suggesting that the positive association between synovitis score and weight-bearing asymmetry has been weakened by L-006235.

Figure 4.

Figure 4.

(A–C) Effects of preventative L-006235 on MIA-induced cartilage damage (A), synovitis (B), and osteophyte score (C). See Figure 1 for study design. Statistical analysis with a Kruskal–Wallis test and Dunn's post hoc test: *P < 0.05, **P < 0.01, ****P < 0.0001 vs saline + vehicle. Group sizes are as follows: saline + vehicle, n = 11; MIA + vehicle, n = 18; MIA + L-006235 (30 mg/kg), n = 19; and MIA + L-006235 (100 mg/kg), n = 9. Data are presented as mean ± SEM. (D–F) Weight-bearing plotted against cartilage damage (D), synovitis (E), and osteophyte score (F). The univariate lines of best fit for MIA + vehicle (solid line) vs MIA + L-006235 (dashed line) (both doses). The statistical interaction between weight bearing and each OA pathology feature was examined using a product term for Treatment Group*OA Pathology. Statistical significance of the interaction term implies that the measured association between weight-bearing pain behaviour and cartilage damage (D) and synovitis score (E) was changed by L-006235.

To further explore the effects of L-006235 on synovial inflammation, immunohistochemistry analysis of the numbers of macrophages in the synovium was performed. There was a nonsignificant increase in the number of CD68+ cells in the synovium 27 days after MIA injection when compared with saline-injected rats (supplementary Figure 2C, available at http://links.lww.com/PR9/A32). In the group that received preventative L-006235, the number of CD68+ cells was lower compared with vehicle-treated rats (supplementary Figure 2A, available at http://links.lww.com/PR9/A32). The mannose receptor, CD206, has been used as a marker for macrophages that have a reparative phenotype.42 There was a nonsignificant increase in the number of CD206+ cells in the synovium of rats with MIA-induced joint pain, compared with saline controls (supplementary Figure 2D, available at http://links.lww.com/PR9/A32); however, there was no significant effect of L-006235 on this cell count.

To investigate any potential effects of L-006235 on spinal pain processing, expression of cathepsin K mRNA in the spinal cord was quantified. Cathepsin K mRNA was expressed to a comparable extent in the dorsal horn of the spinal cord in saline and MIA-treated rats (supplementary Figure 3A, available at http://links.lww.com/PR9/A32). Glial fibrillary acidic protein immunofluorescence in the dorsal horn of the spinal cord is a marker of mechanisms of central sensitization and is significantly increased in the MIA model of OA pain.35 Preventative L-006235 (100 mg/kg) did not alter GFAP immunolabelling in the dorsal horn of the spinal cord of rats 27 days after intra-articular injection of MIA (supplementary Figure 3B, available at http://links.lww.com/PR9/A32).

3.2. Therapeutic L-006235 attenuates osteoarthritis pain behaviour

In the final study, we investigated whether L-006235 (100 mg/kg) altered established pain behaviour in the MIA model. Time course data analysis revealed that therapeutic dosing of L-006235 (100 mg/kg) had a significant inhibitory effect on weight-bearing asymmetry, compared with MIA vehicle rats (Fig. 5A), but not on hind PWTs (supplementary Figure 4, available at http://links.lww.com/PR9/A32). Area under the curve analysis of weight-bearing asymmetry confirmed comparable weight bearing asymmetry in the 2 groups of MIA rats before L-006235 treatment (Fig. 5B) and a significant inhibitory effect of L-006235 over the period of treatment in MIA rats (Fig. 5C). At the final time point that pain behaviour was assessed (day 41), cartilage and synovitis score (Figs. 5D and E, supplementary Figure 5, available at http://links.lww.com/PR9/A32) in MIA-treated rats were consistent with levels at day 28 (Figs. 4A and B) and were significant compared with the contralateral joint. However, the osteophyte score at day 41 was lower than that evident at day 28 and not significant compared with the contralateral joint (Fig. 5F). Treatment with L-006235 from day 14 to 41 after MIA injection did not alter any of the joint features studied (Figs. 5D–F).

Figure 5.

Figure 5.

Effects of L-006235 on established MIA-induced weight-bearing asymmetry (study 3). Fourteen days after intra-articular injection of MIA rats received oral vehicle or L-006235 (100 mg/kg) twice daily until day 40 (n = 10 per group). Data are presented as a time course (A) and area under the curve analysis of the 14 days before (B) and 26 days after treatment (C). Group sizes were MIA + vehicle, n = 10 and MIA + L-006235, n = 10. Time course data were analysed with a 2-way ANOVA with a Bonferroni post hoc test: #P < 0.05, ###P < 0.001 MIA + vehicle vs MIA + L-006235. Area under the curve data were analysed with a t test *P < 0.05. Data are presented as mean ± SEM. (D–F) L-006235 treatment did not alter MIA-induced cartilage damage (D) or synovitis score (E) at day 41 after MIA injection. There was no change in osteophyte score (F) and effects of L-006235 could not be determined. Group sizes were MIA + vehicle (contralateral), n = 6; MIA + vehicle (ipsilateral), n = 10; and MIA + L-006235 (100 mg/kg) (ipsilateral), n = 8). Statistical comparison of groups used a Kruskal–Wallis test with post hoc Dunn's comparison: *P < 0.05, **P < 0.01 vs contralateral knee. Data are presented as mean ± SEM. ANOVA, analysis of variance.

3.3. Bioanalysis of L-006235 plasma concentrations

Plasma concentrations of L-006235 were assessed in the 3 studies to confirm exposure to L-006235 between the studies. The exposure to L-006235 was similar in MIA- and saline-injected rats for both preventative doses studied (Fig. 6A). Similar exposures were observed between the 2 preventative studies after administration of L-006235 at 30 mg/kg twice daily (Fig. 6B). The exposure observed after administration of L-006235 at 100 mg/kg twice daily in the therapeutic study tended to be lower than the exposure observed in the preventative study (Fig. 6C). The mean PK parameters were calculated from the second preventative study and are shown in Table 2. There was a more than dose-proportional increase in exposure when increasing the dose from 30 to 100 mg/kg (Table 2).

Figure 6.

Figure 6.

Plasma concentrations of L-006235 (µM) at 1, 3, 6, and 24 hours after dose (h.a.d). Data were collected 8 and 22 days after MIA induction in the first study, 9 and 27 days after MIA induction in the second study, and 40/41 days after MIA induction in the third study. (A) Plasma concentrations of L-006235 after dosing with 30 and 100 mg/kg in MIA- or saline-injected rats. The results for the 30- and 100-mg/kg doses are from the first and second preventative study, respectively. (B) Plasma concentrations after dosing with 30 mg/kg L-006235 in the first (gray circles) and second (black circles) preventative study. (C) Plasma concentrations after dosing with 100-mg/kg L-006235 in the second preventative study (gray squares) and in the therapeutic study (black squares). Data are presented as mean ± SEM.

Table 2.

Mean PK parameters for L-006235.

graphic file with name painreports-3-e685-g008.jpg

3.4. L-006235 attenuates serum CTX-I and II levels

Treatment of naïve rats with L-006235 (100 mg/kg) significantly reduced the serum CTX-I levels at 1 hour after dose by 20%, compared with baseline (Fig. 7A). In vehicle-treated naïve rats, serum CTX-I levels were instead increased by 6% at 1 hour, compared with baseline. The reduction in CTX-I levels by L-006235 was statistically significant vs baseline (P < 0.05) and vs vehicle (P < 0.05). No significant reductions in CTX-I were observed at 3 hours after L-006235 administration. Serum CTX-I levels are known to vary on food intake, and thus the results at 6 and 24 hours after dose (when the animals were allowed food again) were not conclusive. Similarly, serum CTX-II levels were reduced in L-006235–treated rats at 1 hour (by 42%) and 3 hours after dose (by 24%), compared with baseline (Fig. 7B). The reductions were statistically significant vs baseline (P < 0.05) at 1 hour and statistically significant vs vehicle at 1 hour (P < 0.001) and 3 hours (P < 0.05). The CTX-II levels returned to baseline at 6 hours after dose. In vehicle-treated rats, serum CTX-II levels were increased by 26% and 19%, compared with baseline, at 1 hour and 3 hours, respectively. Overall, the results indicate a significant, but transient in vivo target engagement of cathepsin K by L-006235.

Figure 7.

Figure 7.

Effect of L-006235 on serum CTX-I (A) and CTX-II (B) levels after a single dose of 100 mg/kg to naive rats. Data were analysed with a 2-way ANOVA followed by Bonferroni multiple comparison test: *P < 0.05. ***P < 0.001 L-006235 vs vehicle. Data are presented as mean ± SEM (n = 3/group). ANOVA, analysis of variance.

4. Discussion

This study reports for the first time the beneficial effects of a cathepsin K inhibitor on the development of pain behaviour in a well-established rodent model of OA pain. Oral treatment with the cathepsin K inhibitor L-006235 significantly attenuated the development of pain behaviour in the MIA model of OA pain. Inhibitory effects of L-006235 were most evident on weight-bearing asymmetry, which was significantly attenuated from day 14 and then maintained for the duration of the study. Only the higher dose of preventative L-006235 significantly blocked the lowering of hind PWTs at the final 2 time points of the study. Therapeutic treatment with L-006235 from 14 days after induction of the MIA model significantly prevented further changes in weight-bearing asymmetry; however, L-006235 did not significantly reverse the already established weight-bearing asymmetry. In addition, therapeutic treatment with L-006235 did not alter lowered hind PWTs in MIA rats, compared with vehicle. Pharmacokinetic analysis confirmed that the exposure to L-006235 was higher at the 100-mg/kg dose, compared with the 30-mg/kg dose.

The finding that L-006235 attenuates weight-bearing asymmetry in the MIA model is consistent with an earlier report that 1-month administration of another cathepsin K inhibitor (AZ12606133) reduced mechanosensitivity of joint afferent fibres to non-noxious and noxious movement in the Dunkin–Hartley guinea pig model of spontaneous OA.29 In both our behavioural study and the earlier electophysiological study, the effects of the cathepsin K inhibitor were relatively slow in onset suggestive of mechanisms other than direct antinociceptive effects on the sensory nerve responses. In our study, we also assessed potential effects of L-006235 on spinal mechanisms of central sensitization, which are known to accompany the lowered hind PWTs in the MIA model. Previously, we have reported an increase in the expression of GFAP in the dorsal horn of the spinal cord,35 which is an established marker of central sensitization.9 In this study, the higher dose of L-006235 (100 mg/kg) did not significantly alter GFAP immunofluorescence in the dorsal horn of the spinal cord, suggestive of a lack of effect on at least some aspects of central sensitization that may point to a more peripheral site of action.

Previous studies have focused on the effects of cathepsin K inhibition on joint structure rather than functional pain responses. Although the association between joint damage and pain responses is weak, there is a significant association between synovitis and human OA pain.38 In this study, the doses and treatment schedule used with L-006235 did not significantly alter cartilage damage, synovitis score, or osteophyte score in the MIA model. Regression analysis did reveal an effect of L-006235 on the relationship between changes in weight-bearing and synovitis score, which may point to an action of L-006235 on inflammatory pain mechanisms at the end of the study. Treated animals displayed less pain behaviour than would be predicted by their synovitis score, suggesting that L-006235 might reduce the pain caused by inflammation. A limitation of our study is that we did not investigate the potential effects of the treatment on the immune response, which may then influence the pain behaviour. To further explore possible direct effects of L-006235 on the inflammatory pain response at the end of the study, immunohistochemical analysis of knee joint sections quantified the numbers of CD68+ and CD206+ macrophages in the synovium of MIA vehicle vs MIA L-006235–treated rats. However, these studies were inconclusive, and we found no evidence for a significant increase in either population of cells in the synovium in the MIA model and no further change by the treatment. It is feasible that this analysis was underpowered, lack of existing data on these populations of cells in this model limited our ability to perform a power calculation. Bone marrow macrophages are known to express cathepsin K and have been implicated in tumour progression in bone.15 The contribution of macrophages in the bone to OA pain is unknown; it is feasible that these cells, or other cell types within the synovium, are a direct or indirect target of this treatment and underpin the inhibitory effects on pain behaviour. Studies using imaging methods such as SPECT/CT to study-activated macrophage involvement may shed light on the mechanisms of action of cathepsin K inhibitors in the future.45

Cathepsin K is expressed by osteoclasts and has an essential role in bone resorption in human and mice,1 and overexpression is associated with spontaneous synovitis and cartilage degeneration.30,33 Our study of the effects of L-006235 was based on the mounting evidence of a contribution of osteoclasts to OA pain behaviour. In previous work, effects of cathepsin K inhibition on bone resorption were not associated with changes in osteoclastogenesis or survival of osteoclasts,24,28 and therefore, the effects of L-006235 on the number of osteoclasts were not quantified in this study. Comparison of the different classes of drugs, which modulate osteoclast function on pain behaviour and joint pathology in models of OA and inflammatory arthritis, highlights mechanistic differences. Unlike the bisphosphonates, cathepsin K inhibitors attenuate osteoclastic activity without altering numbers of osteoclasts and do not alter bone formation.39 Bisphosphonates have beneficial effects on joint pathology and pain behaviour in models of OA. In our previous study, effects of preventative treatment with zoledronate on pain behaviour in the MIA model were comparable in magnitude with the effects of L-006235; however, therapeutic treatment was not studied.37 Significant preventative, and reversal, effects of zoledronate on pain behaviour in MIA rats were reported in a separate study.40 The time course of the effects of zoledronate on pain behaviour was similar to those of L-006235 in this study. However, there were marked differences in terms of joint endpoints; at early time points zoledronate inhibited osteoclast-mediated cartilage resorption, and at later stages of the model treatment improved subchondral bone and cartilage integrity but not synovitis.40 The bisphosphonate alendronate inhibited bone resorption and had chondroprotective effects in a surgical model of OA, although pain was not analysed.13

Previously, we reported beneficial effects of a modified version of osteoprotegerin (OPG), which acts to sequester receptor activator of nuclear factor kappa-Β ligand and inhibits the number of subchondral bone osteoclasts, in the MIA model of OA pain.37 Osteoprotegerin-Fc prevented pain behaviour in the MIA model, effects accompanied by a robust inhibition in cartilage damage and synovial inflammation, and bone features of OA (osteoclast number and osteophyte score).36 The magnitude of inhibitory effects of preventative L-006235 on pain behaviour in the MIA model presented herein were comparable with the effects of OPG-Fc.37 In addition, the ability of L-006235 to halt further progression of pain behaviour in the MIA model once treatment commenced was also consistent with the therapeutic effects of OPG-Fc in this model. However, unlike OPG-Fc, L-006235 did not alter osteophyte score in the MIA model. The findings presented herein are consistent with the lack of effect of L-006235 on bone erosion in a model of inflammatory arthritis,41 which contrast the beneficial effects of OPG-Fc on this feature in the inflammatory arthritis model.34 Overall, the differences in the effects of OPG-Fc vs L-006235 on joint features in these models of 2 different types of arthritis suggest that mechanisms additional to cathepsin K also contribute to changes in joint structure.

To date, most previous studies in OA models have focused on the potential beneficial effects of cathepsin K inhibitors on cartilage pathology. In the anterior cruciate ligament transection (ACLT) model of OA in the rabbit L-006235 (50 mg/kg/d for 7 weeks from 1 week after surgery) significantly lowered urine CTX-II levels at 3 weeks after treatment, an effect maintained until the end of the study.14 After 7 weeks of L-006235 treatment, the Mankin score of joint pathology was significantly lower and bone features were improved, compared with vehicle-treated rabbits.14 Consistent with this finding, murine cathepsin K deletion had chondroprotective effects in the ACLT model of OA compared with wild-type controls; however, there were no beneficial effects on osteophyte formation.14 Positive effects of 28 day treatment with the cathepsin K inhibitor SB-553484 on cartilage damage in a canine model of OA have also been reported.6 Similarly, prophylactic and therapeutic effects of the potent and selective cathepsin K inhibitor MIV-711 on joint pathology in the rabbit ACLT and dog partial medial meniscectomy models were also recently reported.26 In the rabbit ACLT model, MIV-711 was given once daily for 7 weeks, starting 1 week after surgery (similar protocol as for in the L-006235 study above) and in the dog partial medial meniscectomy model for 28 days, starting 1 day before surgery (similar protocol as for the SB-553484 study above).26 The effects of L-006235 on histopathology in the collagen-induced arthritis model in mice were also evaluated in both prophylactic and therapeutic settings after dosing with L-006235 at 25 mg/kg/d. Both cartilage and bone damage, and clinical score, were significantly attenuated by preventative L-006235, whereas a therapeutic treatment once clinical signs of disease were established did not have significant effects.41 On the basis of these previous studies, our PK data and the engagement of L-006235 with cathepsin K reported herein, it seems that the duration of treatment, and dose used in our study (ie, up to 100 mg/kg twice daily for 28 days) was sufficient to attenuate pain behaviour but not structural changes to the joint in this model.

Our demonstration that the cathepsin K inhibitor attenuates the development, and halts established, weight-bearing asymmetry in the MIA model of OA pain supports the further investigation of the analgesic potential of this class of drugs as well as their effects on joint structure. Although our univariate analysis indicated that L-006235 altered the association between pain behaviour and synovitis, this is likely mediated by a cell type other than CD68+ or CD206+ macrophages. It is feasible that the positive effects of L-006235 on pain behaviour arise due to off-target effects. However, the inhibitory effect of L-006235 on human cathepsin S is 8 to 10 µM, and on mouse cathepsin S is 2.4 µM,32 making this an unlikely target for the doses and exposures achieved in this study. Nevertheless, the lack of potency data for rat cathepsin S means that we cannot rule out a species-specific effect of L-006235. From a mechanistic perspective, the more limited effects of L-006235 on lowering of hind PWTs in this study is not consistent with the robust inhibitory effects of cathepsin S inhibition on measures of allodynia in models of neuropathic pain.5 Overall, our novel finding that cathepsin K inhibition is analgesic in a clinically relevant model of OA pain provides evidence for a new therapeutic target for OA pain.

Disclosures

The authors declare no conflicts of interest.

Acknowledgements

The authors acknowledge the following people for their contributions to this article. Veronica Lidell for in vivo work, Sveinn Briem, Hongyu Ren, and Emma Ulander for bioanalytical analysis. Christina Rydergård and Susanne Sedig for biomarker analysis. Sofia Magli for her help with DAB immunohistochemistry.

This work was supported by Arthritis Research UK [Grant Numbers:18769; 20777] and a donation from Medivir.

Appendix A. Supplemental digital content

Supplemental digital content associated with this article can be found online at http://links.lww.com/PR9/A32.

Footnotes

Sponsorships or competing interests that may be relevant to content are disclosed at the end of this article.

Supplemental digital content is available for this article. Direct URL citations appear in the printed text and are provided in the HTML and PDF versions of this article on the journal's Web site (www.painrpts.com).

References

  • [1].Asagiri M, Takayanagi H. The molecular understanding of osteoclast differentiation. Bone 2007;40:251–64. [DOI] [PubMed] [Google Scholar]
  • [2].Ashraf S, Mapp PI, Walsh DA. Contributions of angiogenesis to inflammation, joint damage, and pain in a rat model of osteoarthritis. Arthritis Rheum 2011;63:2700–10. [DOI] [PubMed] [Google Scholar]
  • [3].Bossard MJ, Tomaszek TA, Thompson SK, Amegadzie BY, Hanning CR, Jones C, Kurdyla JT, McNulty DE, Drake FH, Gowen M, Levyi MA. Proteolytic activity of human osteoclast cathepsin K: expression, purification, activation, and substrate identification. J Biol Chem 1996;271:12517–24. [DOI] [PubMed] [Google Scholar]
  • [4].Bove SE, Calcaterra SL, Brooker RM, Huber CM, Guzman RE, Juneau PL, Schrier DJ, Kilgore KS. Weight bearing as a measure of disease progression and efficacy of anti-inflammatory compounds in a model of monosodium iodoacetate-induced osteoarthritis. Osteoarthritis Cartilage 2003;11:821–30. [DOI] [PubMed] [Google Scholar]
  • [5].Clark AK, Yip PK, Grist J, Gentry C, Staniland AA, Marchand F, Dehvari M, Wotherspoon G, Winter J, Ullah J, Bevan S, Malcangio M. Inhibition of spinal microglial cathepsin S for the reversal of neuropathic pain. Proc Natl Acad Sci 2007;104:10655–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [6].Connor JR, LePage C, Swift BA, Yamashita D, Bendele AM, Maul D, Kumar S. Protective effects of a cathepsin K inhibitor, SB-553484, in the canine partial medial meniscectomy model of osteoarthritis. Osteoarthritis Cartilage 2009;17:1236–43. [DOI] [PubMed] [Google Scholar]
  • [7].Dejica VM, Mort JS, Laverty S, Percival MD, Antoniou J, Zukor DJ, Poole AR. Cleavage of type II collagen by cathepsin K in human osteoarthritic cartilage. Am J Pathol 2008;173:161–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [8].Dodds RA, Connor JR, Drake FH, Gowen M. Expression of cathepsin K messenger RNA in giant cells and their precursors in human osteoarthritic synovial tissues. Arthritis Rheum 1999;42:1588–93. [DOI] [PubMed] [Google Scholar]
  • [9].Gao YJ, Xu ZZ, Liu YC, Wen YR, Decosterd I, Ji RR. The c-Jun N-terminal kinase 1 (JNK1) in spinal astrocytes is required for the maintenance of bilateral mechanical allodynia under a persistent inflammatory pain condition. PAIN 2010;148:309–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [10].Gerwin N, Bendele AM, Glasson S, Carlson CS. The OARSI histopathology initiative—recommendations for histological assessments of osteoarthritis in the rat. Osteoarthritis Cartilage 2010;18:S24–34. [DOI] [PubMed] [Google Scholar]
  • [11].Glyn-Jones S, Palmer AJR, Agricola R, Price AJ, Vincent TL, Weinans H, Carr AJ. Osteoarthritis. Lancet 2015;386:376–87. [DOI] [PubMed] [Google Scholar]
  • [12].Guzman RE, Evans MG, Bove S, Morenko B, Kilgore K. Mono-iodoacetate-induced histologic changes in subchondral bone and articular cartilage of rat femorotibial joints: an animal model of osteoarthritis. Toxicol Pathol 2003;31:619–24. [DOI] [PubMed] [Google Scholar]
  • [13].Hayami T, Pickarski M, Wesolowski GA, Mclane J, Bone A, Destefano J, Rodan GA, Duong LT. The role of subchondral bone remodeling in osteoarthritis: reduction of cartilage degeneration and prevention of osteophyte formation by alendronate in the rat anterior cruciate ligament transection model. Arthritis Rheum 2004;50:1193–206. [DOI] [PubMed] [Google Scholar]
  • [14].Hayami T, Zhuo Y, Wesolowski GA, Pickarski M, Duong LT. Inhibition of cathepsin K reduces cartilage degeneration in the anterior cruciate ligament transection rabbit and murine models of osteoarthritis. Bone 2012;50:1250–9. [DOI] [PubMed] [Google Scholar]
  • [15].Herroon MK, Rajagurubandara E, Rudy DL, Chalasani A, Hardaway AL, Podgorski I. Macrophage cathepsin K promotes prostate tumor progression in bone. Oncogene 2013;32:1580–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Huang J, Burston JJ, Li L, Ashraf S, Mapp PI, Bennett AJ, Ravipati S, Pousinis P, Barrett DA, Scammell BE, Chapman V. Targeting the D Series resolvin receptor system for the treatment of osteoarthritis pain. Arthritis Rheumatol 2017;69:996–1008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Janusz MJ, Bendele AM, Brown KK, Taiwo YO, Hsieh L, Heitmeyer SA. Induction of osteoarthritis in the rat by surgical tear of the meniscus: inhibition of joint damage by a matrix metalloproteinase inhibitor. Osteoarthritis Cartilage 2002;10:785–91. [DOI] [PubMed] [Google Scholar]
  • [18].Janusz MJ, Hookfin EB, Heitmeyer SA, Woessner JF, Freemont AJ, Hoyland JA, Brown KK, Hsieh LC, Almstead NG, De B, Natchus MG, Pikul S, Taiwo YO. Moderation of iodoacetate-induced experimental osteoarthritis in rats by matrix metalloproteinase inhibitors. Osteoarthritis Cartilage 2001;9:751–60. [DOI] [PubMed] [Google Scholar]
  • [19].Kapur JN, Sahoo PK, Wong AKC. A new method for gray-level picture thresholding using the entropy of the histogram. Comput Vis Graph Image Process 1985;29:273–85. [Google Scholar]
  • [20].Karsdal MA, Bay-Jensen AC, Lories RJ, Abramson S, Spector T, Pastoureau P, Christiansen C, Attur M, Henriksen K, Goldring SR, Kraus V. The coupling of bone and cartilage turnover in osteoarthritis: opportunities for bone antiresorptives and anabolics as potential treatments? Ann Rheum Dis 2014;73:336–48. [DOI] [PubMed] [Google Scholar]
  • [21].Kilkenny C, Browne WJ, Cuthill IC, Emerson M, Altman DG. Improving bioscience Research reporting: The ARRIVE Guidelines for Reporting Animal Research. PLoS Biol 2010;8:e1000412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [22].Kobayashi K, Imaizumi R, Sumichika H, Tanaka H, Goda M, Fukunari A, Komatsu H. Sodium iodoacetate-induced experimental osteoarthritis and associated pain model in rats. J Vet Med Sci 2003;65:1195–9. [DOI] [PubMed] [Google Scholar]
  • [23].Konttinen YT, Mandelin J, Li TF, Salo J, Lassus J, Liljeström M, Hukkanen M, Takagi M, Virtanen I, Santavirta S. Acidic cysteine endoproteinase cathepsin K in the degeneration of the superficial articular hyaline cartilage in osteoarthritis. Arthritis Rheum 2002;46:953–60. [DOI] [PubMed] [Google Scholar]
  • [24].Leung P, Pickarski M, Zhuo Y, Masarachia PJ, Duong LT. The effects of the cathepsin K inhibitor odanacatib on osteoclastic bone resorption and vesicular trafficking. Bone 2011;49:623–35. [DOI] [PubMed] [Google Scholar]
  • [25].Li Z, Hou WS, Escalante-Torres CR, Gelb BD, Bromme D. Collagenase activity of cathepsin K depends on complex formation with chondroitin sulfate. J Biol Chem 2002;277:28669–76. [DOI] [PubMed] [Google Scholar]
  • [26].Lindström E, Rizoska B, Tunblad K, Edenius C, Bendele AM, Maul D, Larson M, Shah N, Yoder Otto V, Jerome C, Grabowska U. The selective cathepsin K inhibitor MIV-711 attenuates joint pathology in experimental animal models of osteoarthritis. J Transl Med 2018;16:56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [27].Logar DB, Komadina R, Preželj J, Ostanek B, Trošt Z, Marc J. Expression of bone resorption genes in osteoarthritis and in osteoporosis. J Bone Miner Metab 2007;25:219–25. [DOI] [PubMed] [Google Scholar]
  • [28].Masarachia PJ, Pennypacker BL, Pickarski M, Scott KR, Wesolowski GA, Smith SY, Samadfam R, Goetzmann JE, Scott BB, Kimmel DB, Duong LT. Odanacatib reduces bone turnover and increases bone mass in the lumbar spine of skeletally mature ovariectomized rhesus monkeys. J Bone Miner Res 2012;27:509–23. [DOI] [PubMed] [Google Scholar]
  • [29].McDougall JJ, Schuelert N, Bowyer J. Cathepsin K inhibition reduces CTXII levels and joint pain in the Guinea pig model of spontaneous osteoarthritis. Osteoarthritis Cartilage 2010;18:1355–7. [DOI] [PubMed] [Google Scholar]
  • [30].Morko J, Kiviranta R, Joronen K, Säämänen AM, Vuorio E, Salminen-Mankonen H. Spontaneous development of synovitis and cartilage degeneration in transgenic mice overexpressing cathepsin K. Arthritis Rheum 2005;52:3713–17. [DOI] [PubMed] [Google Scholar]
  • [31].Murray CJL, Barber RM, Foreman KJ, Ozgoren AA, Abd-Allah F, Abera SF, Aboyans V, Abraham JP, Abubakar I, Abu-Raddad LJ, Abu-Rmeileh NM, Achoki T, Ackerman IN, Ademi Z, Adou AK, Adsuar JC, Afshin A, Agardh EE, Alam SS, Alasfoor D, Albittar MI, Alegretti MA, Alemu ZA, Alfonso-Cristancho R, Alhabib S, Ali R, Alla F, Allebeck P, Almazroa MA, Alsharif U, Alvarez E, Alvis-Guzman N, Amare AT, Ameh EA, Amini H, Ammar W, Anderson HR, Anderson BO, Antonio CAT, Anwari P, Arnlöv J, Arsenijevic VSA, Artaman A, Asghar RJ, Assadi R, Atkins LS, Avila MA, Awuah B, Bachman VF, Badawi A, Bahit MC, Balakrishnan K, Banerjee A, Barker-Collo SL, Barquera S, Barregard L, Barrero LH, Basu A, Basu S, Basulaiman MO, Beardsley J, Bedi N, Beghi E, Bekele T, Bell ML, Benjet C, Bennett DA, Bensenor IM, Benzian H, Bernabé E, Bertozzi-Villa A, Beyene TJ, Bhala N, Bhalla A, Bhutta ZA, Bienhoff K, Bikbov B, Biryukov S, Blore JD, Blosser CD, Blyth FM, Bohensky MA, Bolliger IW, Başara BB, Bornstein NM, Bose D, Boufous S, Bourne RRA, Boyers LN, Brainin M, Brayne CE, Brazinova A, Breitborde NJK, Brenner H, Briggs AD, Brooks PM, Brown JC, Brugha TS, Buchbinder R, Buckle GC, Budke CM, Bulchis A, Bulloch AG, Campos-Nonato IR, Carabin H, Carapetis JR, Cárdenas R, Carpenter DO, Caso V, Castañeda-Orjuela CA, Castro RE, Catalá-López F, Cavalleri F, Çavlin A, Chadha VK, Chang JC, Charlson FJ, Chen H, Chen W, Chiang PP, Chimed-Ochir O, Chowdhury R, Christensen H, Christophi CA, Cirillo M, Coates MM, Coffeng LE, Coggeshall MS, Colistro V, Colquhoun SM, Cooke GS, Cooper C, Cooper LT, Coppola LM, Cortinovis M, Criqui MH, Crump JA, Cuevas-Nasu L, Danawi H, Dandona L, Dandona R, Dansereau E, Dargan PI, Davey G, Davis A, Davitoiu DV, Dayama A, De Leo D, Degenhardt L, Del Pozo-Cruz B, Dellavalle RP, Deribe K, Derrett S, Des Jarlais DC, Dessalegn M, Dharmaratne SD, Dherani MK, Diaz-Torné C, Dicker D, Ding EL, Dokova K, Dorsey ER, Driscoll TR, Duan L, Duber HC, Ebel BE, Edmond KM, Elshrek YM, Endres M, Ermakov SP, Erskine HE, Eshrati B, Esteghamati A, Estep K, Faraon EJA, Farzadfar F, Fay DF, Feigin VL, Felson DT, Fereshtehnejad SM, Fernandes JG, Ferrari AJ, Fitzmaurice C, Flaxman AD, Fleming TD, Foigt N, Forouzanfar MH, Fowkes FGR, Paleo UF, Franklin RC, Fürst T, Gabbe B, Gaffikin L, Gankpé FG, Geleijnse JM, Gessner BD, Gething P, Gibney KB, Giroud M, Giussani G, Dantes HG, Gona P, González-Medina D, Gosselin RA, Gotay CC, Goto A, Gouda HN, Graetz N, Gugnani HC, Gupta R, Gupta R, Gutiérrez RA, Haagsma J, Hafezi-Nejad N, Hagan H, Halasa YA, Hamadeh RR, Hamavid H, Hammami M, Hancock J, Hankey GJ, Hansen GM, Hao Y, Harb HL, Haro JM, Havmoeller R, Hay SI, Hay RJ, Heredia-Pi IB, Heuton KR, Heydarpour P, Higashi H, Hijar M, Hoek HW, Hoffman HJ, Hosgood HD, Hossain M, Hotez PJ, Hoy DG, Hsairi M, Hu G, Huang C, Huang JJ, Husseini A, Huynh C, Iannarone ML, Iburg KM, Innos K, Inoue M, Islami F, Jacobsen KH, Jarvis DL, Jassal SK, Jee SH, Jeemon P, Jensen PN, Jha V, Jiang G, Jiang Y, Jonas JB, Juel K, Kan H, Karch A, Karema CK, Karimkhani C, Karthikeyan G, Kassebaum NJ, Kaul A, Kawakami N, Kazanjan K, Kemp AH, Kengne AP, Keren A, Khader YS, Khalifa SEA, Khan EA, Khan G, Khang YH, Kieling C, Kim D, Kim S, Kim Y, Kinfu Y, Kinge JM, Kivipelto M, Knibbs LD, Knudsen AK, Kokubo Y, Kosen S, Krishnaswami S, Defo BK, Bicer BK, Kuipers EJ, Kulkarni C, Kulkarni VS, Kumar GA, Kyu HH, Lai T, Lalloo R, Lallukka T, Lam H, Lan Q, Lansingh VC, Larsson A, Lawrynowicz AEB, Leasher JL, Leigh J, Leung R, Levitz CE, Li B, Li Y, Li Y, Lim SS, Lind M, Lipshultz SE, Liu S, Liu Y, Lloyd BK, Lofgren KT, Logroscino G, Looker KJ, Lortet-Tieulent J, Lotufo PA, Lozano R, Lucas RM, Lunevicius R, Lyons RA, Ma S, Macintyre MF, Mackay MT, Majdan M, Malekzadeh R, Marcenes W, Margolis DJ, Margono C, Marzan MB, Masci JR, Mashal MT, Matzopoulos R, Mayosi BM, Mazorodze TT, Mcgill NW, Mcgrath JJ, Mckee M, Mclain A, Meaney PA, Medina C, Mehndiratta MM, Mekonnen W, Melaku YA, Meltzer M, Memish ZA, Mensah GA, Meretoja A, Mhimbira FA, Micha R, Miller TR, Mills EJ, Mitchell PB, Mock CN, Ibrahim NM, Mohammad KA, Mokdad AH, Mola GLD, Monasta L, Hernandez JCM, Montico M, Montine TJ, Mooney MD, Moore AR, Moradi-Lakeh M, Moran AE, Mori R, Moschandreas J, Moturi WN, Moyer ML, Mozaffarian D, Msemburi WT, Mueller UO, Mukaigawara M, Mullany EC, Murdoch ME, Murray J, Murthy KS, Naghavi M, Naheed A, Naidoo KS, Naldi L, Nand D, Nangia V, Narayan KMV, Nejjari C, Neupane SP, Newton CR, Ng M, Ngalesoni FN, Nguyen G, Nisar MI, Nolte S, Norheim OF, Norman RE, Norrving B, Nyakarahuka L, Oh IH, Ohkubo T, Ohno SL, Olusanya BO, Opio JN, Ortblad K, Ortiz A, Pain AW, Pandian JD, Panelo CIA, Papachristou C, Park EK, Park JH, Patten SB, Patton GC, Paul VK, Pavlin BI, Pearce N, Pereira DM, Perez-Padilla R, Perez-Ruiz F, Perico N, Pervaiz A, Pesudovs K, Peterson CB, Petzold M, Phillips MR, Phillips BK, Phillips DE, Piel FB, Plass D, Poenaru D, Polinder S, Pope D, Popova S, Poulton RG, Pourmalek F, Prabhakaran D, Prasad NM, Pullan RL, Qato DM, Quistberg DA, Rafay A, Rahimi K, Rahman SU, Raju M, Rana SM, Razavi H, Reddy KS, Refaat A, Remuzzi G, Resnikoff S, Ribeiro AL, Richardson L, Richardus JH, Roberts DA, Rojas-Rueda D, Ronfani L, Roth GA, Rothenbacher D, Rothstein DH, Rowley JT, Roy N, Ruhago GM, Saeedi MY, Saha S, Sahraian MA, Sampson UKA, Sanabria JR, Sandar L, Santos IS, Satpathy M, Sawhney M, Scarborough P, Schneider IJ, Schöttker B, Schumacher AE, Schwebel DC, Scott JG, Seedat S, Sepanlou SG, Serina PT, Servan-Mori EE, Shackelford KA, Shaheen A, Shahraz S, Levy TS, Shangguan S, She J, Sheikhbahaei S, Shi P, Shibuya K, Shinohara Y, Shiri R, Shishani K, Shiue I, Shrime MG, Sigfusdottir ID, Silberberg DH, Simard EP, Sindi S, Singh A, Singh JA, Singh L, Skirbekk V, Slepak EL, Sliwa K, Soneji S, Søreide K, Soshnikov S, Sposato LA, Sreeramareddy CT, Stanaway JD, Stathopoulou V, Stein DJ, Stein MB, Steiner C, Steiner TJ, Stevens A, Stewart A, Stovner LJ, Stroumpoulis K, Sunguya BF, Swaminathan S, Swaroop M, Sykes BL, Tabb KM, Takahashi K, Tandon N, Tanne D, Tanner M, Tavakkoli M, Taylor HR, Te Ao BJ, Tediosi F, Temesgen AM, Templin T, Ten Have M, Tenkorang EY, Terkawi AS, Thomson B, Thorne-Lyman AL, Thrift AG, Thurston GD, Tillmann T, Tonelli M, Topouzis F, Toyoshima H, Traebert J, Tran BX, Trillini M, Truelsen T, Tsilimbaris M, Tuzcu EM, Uchendu US, Ukwaja KN, Undurraga EA, Uzun SB, Van Brakel WH, Van De Vijver S, van Gool CH, Van Os J, Vasankari TJ, Venketasubramanian N, Violante FS, Vlassov VV, Vollset SE, Wagner GR, Wagner J, Waller SG, Wan X, Wang H, Wang J, Wang L, Warouw TS, Weichenthal S, Weiderpass E, Weintraub RG, Wenzhi W, Werdecker A, Westerman R, Whiteford HA, Wilkinson JD, Williams TN, Wolfe CD, Wolock TM, Woolf AD, Wulf S, Wurtz B, Xu G, Yan LL, Yano Y, Ye P, Yentür GK, Yip P, Yonemoto N, Yoon SJ, Younis MZ, Yu C, Zaki ME, Zhao Y, Zheng Y, Zonies D, Zou X, Salomon JA, Lopez AD, Vos T. Global, regional, and national disability-adjusted life years (DALYs) for 306 diseases and injuries and healthy life expectancy (HALE) for 188 countries, 1990–2013: quantifying the epidemiological transition. Lancet 2015;386:2145–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [32].Palmer JT, Bryant C, Wang DX, Davis DE, Setti EL, Rydzewski RM, Venkatraman S, Tian ZQ, Burrill LC, Mendonca RV, Springman E, McCarter J, Chung T, Cheung H, Janc JW, McGrath M, Somoza JR, Enriquez P, Yu ZW, Strickley RM, Liu L, Venuti MC, Percival MD, Falgueyret JP, Prasit P, Oballa R, Riendeau D, Young RN, Wesolowski G, Rodan SB, Johnson C, Kimmel DB, Rodan G. Design and synthesis of tri-ring P 3 benzamide-containing aminonitriles as potent, selective, orally effective inhibitors of cathepsin K. J Med Chem 2005;48:7520–34. [DOI] [PubMed] [Google Scholar]
  • [33].Pelletier JP, Kapoor M, Fahmi H, Lajeunesse D, Blesius A, Maillet J, Martel-Pelletier J. Strontium ranelate reduces the progression of experimental dog osteoarthritis by inhibiting the expression of key proteases in cartilage and of IL-1β in the synovium. Ann Rheum Dis 2013;72:250–7. [DOI] [PubMed] [Google Scholar]
  • [34].Romas E, Sims NA, Hards DK, Lindsay M, Quinn JWM, Ryan PFJ, Dunstan CR, Martin TJ, Gillespie MT. Osteoprotegerin reduces osteoclast numbers and prevents bone erosion in collagen-induced arthritis. Am J Pathol 2002;161:1419–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [35].Sagar D, Burston J, Hathway G, Woodhams S. The contribution of spinal glial cells to chronic pain behaviour in the monosodium iodoacetate model of osteoarthritic pain. Mol Pain 2011;7:88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [36].Sagar DR, Ashraf S, Xu L, Burston JJ, Menhinick MR, Poulter CL, Bennett AJ, Walsh DA, Chapman V. Osteoprotegerin reduces the development of pain behaviour and joint pathology in a model of osteoarthritis. Ann Rheum Dis 2014;73:1558–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [37].Sagar DR, Staniaszek LE, Okine BN, Woodhams S, Norris LM, Pearson RG, Garle MJ, Alexander SPH, Bennett AJ, Barrett DA, Kendall DA, Scammell BE, Chapman V. Tonic modulation of spinal hyperexcitability by the endocannabinoid receptor system in a rat model of osteoarthritis pain. Arthritis Rheum 2010;62:3666–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [38].Sellam J, Berenbaum F. The role of synovitis in pathophysiology and clinical symptoms of osteoarthritis. Nat Rev Rheumatol 2010;6:625–35. [DOI] [PubMed] [Google Scholar]
  • [39].Soung DY, Gentile MA, Duong LT, Drissi H. Effects of pharmacological inhibition of cathepsin K on fracture repair in mice. Bone 2013;55:248–55. [DOI] [PubMed] [Google Scholar]
  • [40].Strassle BW, Mark L, Leventhal L, Piesla MJ, Jian Li X, Kennedy JD, Glasson SS, Whiteside GT. Inhibition of osteoclasts prevents cartilage loss and pain in a rat model of degenerative joint disease. Osteoarthritis Cartilage 2010;18:1319–28. [DOI] [PubMed] [Google Scholar]
  • [41].Svelander L, Erlandsson-Harris H, Astner L, Grabowska U, Klareskog L, Lindstrom E, Hewitt E. Inhibition of cathepsin K reduces bone erosion, cartilage degradation and inflammation evoked by collagen-induced arthritis in mice. Eur J Pharmacol 2009;613:155–62. [DOI] [PubMed] [Google Scholar]
  • [42].Tiemessen MM, Jagger AL, Evans HG, van Herwijnen MJC, John S, Taams LS. CD4+CD25+Foxp3+ regulatory T cells induce alternative activation of human monocytes/macrophages. Proc Natl Acad Sci U S A 2007;104:19446–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [43].Vinardell T, Dejica V, Poole AR, Mort JS, Richard H, Laverty S. Evidence to suggest that cathepsin K degrades articular cartilage in naturally occurring equine osteoarthritis. Osteoarthritis Cartilage 2009;17:375–83. [DOI] [PubMed] [Google Scholar]
  • [44].Vincent TL, Williams RO, Maciewicz R, Silman A, Garside P, Bevan S, Chanalaris A, Chapman V, Cope A, Cruwys S, Dell'Accio F, Gaskin P, Gilroy D, Glasson S, Hegen M, McDougall J, Moore A, du Sert NP, Perretti M, Pitsillides A, Robinson V, Seed M, Thompson S, Walsh DA, Williams N. Mapping pathogenesis of arthritis through small animal models. Rheumatology (Oxford) 2012;51:1931–41. [DOI] [PubMed] [Google Scholar]
  • [45].de Visser HM, Korthagen NM, Müller C, Ramakers RM, Krijger GC, Lafeber FPJG, Beekman FJ, Mastbergen SC, Weinans H. Imaging of folate receptor expressing macrophages in the rat groove model of osteoarthritis: using a new DOTA-folate conjugate. Cartilage 2018;9:183–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [46].Vos T, Flaxman AD, Naghavi M, Lozano R, Michaud C, Ezzati M, Shibuya K, Salomon JA, Abdalla S, Aboyans V, Abraham J, Ackerman I, Aggarwal R, Ahn SY, Ali MK, Alvarado M, Anderson HR, Anderson LM, Andrews KG, Atkinson C, Baddour LM, Bahalim AN, Barker-Collo S, Barrero LH, Bartels DH, Basáñez MG, Baxter A, Bell ML, Benjamin EJ, Bennett D, Bernabé E, Bhalla K, Bhandari B, Bikbov B, Bin Abdulhak A, Birbeck G, Black JA, Blencowe H, Blore JD, Blyth F, Bolliger I, Bonaventure A, Boufous S, Bourne R, Boussinesq M, Braithwaite T, Brayne C, Bridgett L, Brooker S, Brooks P, Brugha TS, Bryan-Hancock C, Bucello C, Buchbinder R, Buckle G, Budke CM, Burch M, Burney P, Burstein R, Calabria B, Campbell B, Canter CE, Carabin H, Carapetis J, Carmona L, Cella C, Charlson F, Chen H, Cheng AT, Chou D, Chugh SS, Coffeng LE, Colan SD, Colquhoun S, Colson KE, Condon J, Connor MD, Cooper LT, Corriere M, Cortinovis M, de Vaccaro KC, Couser W, Cowie BC, Criqui MH, Cross M, Dabhadkar KC, Dahiya M, Dahodwala N, Damsere-Derry J, Danaei G, Davis A, De Leo D, Degenhardt L, Dellavalle R, Delossantos A, Denenberg J, Derrett S, Des Jarlais DC, Dharmaratne SD, Dherani M, Diaz-Torne C, Dolk H, Dorsey ER, Driscoll T, Duber H, Ebel B, Edmond K, Elbaz A, Ali SE, Erskine H, Erwin PJ, Espindola P, Ewoigbokhan SE, Farzadfar F, Feigin V, Felson DT, Ferrari A, Ferri CP, Fèvre EM, Finucane MM, Flaxman S, Flood L, Foreman K, Forouzanfar MH, Fowkes FG, Franklin R, Fransen M, Freeman MK, Gabbe BJ, Gabriel SE, Gakidou E, Ganatra HA, Garcia B, Gaspari F, Gillum RF, Gmel G, Gosselin R, Grainger R, Groeger J, Guillemin F, Gunnell D, Gupta R, Haagsma J, Hagan H, Halasa YA, Hall W, Haring D, Haro JM, Harrison JE, Havmoeller R, Hay RJ, Higashi H, Hill C, Hoen B, Hoffman H, Hotez PJ, Hoy D, Huang JJ, Ibeanusi SE, Jacobsen KH, James SL, Jarvis D, Jasrasaria R, Jayaraman S, Johns N, Jonas JB, Karthikeyan G, Kassebaum N, Kawakami N, Keren A, Khoo JP, King CH, Knowlton LM, Kobusingye O, Koranteng A, Krishnamurthi R, Lalloo R, Laslett LL, Lathlean T, Leasher JL, Lee YY, Leigh J, Lim SS, Limb E, Lin JK, Lipnick M, Lipshultz SE, Liu W, Loane M, Ohno SL, Lyons R, Ma J, Mabweijano J, MacIntyre MF, Malekzadeh R, Mallinger L, Manivannan S, Marcenes W, March L, Margolis DJ, Marks GB, Marks R, Matsumori A, Matzopoulos R, Mayosi BM, McAnulty JH, McDermott MM, McGill N, McGrath J, Medina-Mora ME, Meltzer M, Mensah GA, Merriman TR, Meyer AC, Miglioli V, Miller M, Miller TR, Mitchell PB, Mocumbi AO, Moffitt TE, Mokdad AA, Monasta L, Montico M, Moradi-Lakeh M, Moran A, Morawska L, Mori R, Murdoch ME, Mwaniki MK, Naidoo K, Nair MN, Naldi L, Narayan KM, Nelson PK, Nelson RG, Nevitt MC, Newton CR, Nolte S, Norman P, Norman R, O'Donnell M, O'Hanlon S, Olives C, Omer SB, Ortblad K, Osborne R, Ozgediz D, Page A, Pahari B, Pandian JD, Rivero AP, Patten SB, Pearce N, Padilla RP, Perez-Ruiz F, Perico N, Pesudovs K, Phillips D, Phillips MR, Pierce K, Pion S, Polanczyk GV, Polinder S, Pope CA, III, Popova S, Porrini E, Pourmalek F, Prince M, Pullan RL, Ramaiah KD, Ranganathan D, Razavi H, Regan M, Rehm JT, Rein DB, Remuzzi G, Richardson K, Rivara FP, Roberts T, Robinson C, De Leòn FR, Ronfani L, Room R, Rosenfeld LC, Rushton L, Sacco RL, Saha S, Sampson U, Sanchez-Riera L, Sanman E, Schwebel DC, Scott JG, Segui-Gomez M, Shahraz S, Shepard DS, Shin H, Shivakoti R, Singh D, Singh GM, Singh JA, Singleton J, Sleet DA, Sliwa K, Smith E, Smith JL, Stapelberg NJ, Steer A, Steiner T, Stolk WA, Stovner LJ, Sudfeld C, Syed S, Tamburlini G, Tavakkoli M, Taylor HR, Taylor JA, Taylor WJ, Thomas B, Thomson WM, Thurston GD, Tleyjeh IM, Tonelli M, Towbin JA, Truelsen T, Tsilimbaris MK, Ubeda C, Undurraga EA, van der Werf MJ, van Os J, Vavilala MS, Venketasubramanian N, Wang M, Wang W, Watt K, Weatherall DJ, Weinstock MA, Weintraub R, Weisskopf MG, Weissman MM, White RA, Whiteford H, Wiersma ST, Wilkinson JD, Williams HC, Williams SR, Witt E, Wolfe F, Woolf AD, Wulf S, Yeh PH, Zaidi AK, Zheng ZJ, Zonies D, Lopez AD, Murray CJ, AlMazroa MA, Memish ZA. Years lived with disability (YLD) for 1160 sequelae of 289 diseases and injuries 1990–2010: a systematic analysis for the Global Burden of Disease Study 2010. Lancet 2012;380:2163–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [47].Wilson AJ, Murphy WA, Hardy DC, Totty WG, Dreimann M, Hempfing A, Stein H, Metz-Stavenhagen P, Rudwaleit M, Sieper J. Transient osteoporosis: transient bone marrow edema? Radiology 1988;167:757–60. [DOI] [PubMed] [Google Scholar]

Articles from Pain Reports are provided here courtesy of Wolters Kluwer Health

RESOURCES