Abstract
Aim:
In this study we investigated the prevalence of binary toxin genes, cdtA and cdtB, in clinical isolates of C. difficile from hospitalized patients with diarrhea.
Background:
C. difficile binary toxin (CDT) is an action-specific ADP-ribosyltransferase that is produced by some strains of C. difficile. Co-expression of this toxin with tcdA and tcdB can lead to more severe disease in CDI patients.
Methods:
Totally, 930 patients suspected of having CDI was included in this study. All samples were treated with methanol and cultured on selective C. difficile agar plates. The C. difficile isolates were further identified by PCR. Presence of tcdA, tcdB, cdtA, and cdtB genes among the strains were examined by PCR.
Results:
Analysis of the PCR results showed a prevalence of 85.2% (144/169) for toxigenic C. diffidile. Toxin genotyping of the strains for tcdA and tcdB genes revealed the toxin profiles of A+B+, A+B-, A-B+ accounting for 86.1% (124/144), 7.6% (11/144), 6.2% (9/144) among the strains, respectively. Totally, 12.4% (21/169) of the C. difficile strains were binary toxin-positive. cdtA-B+, cdtA+B+ and cdtA+B- were detected in 43% (9/21), 38% (8/21) and 19% (4/21) of the strains, respectively. Interestingly, 12% (3/25) of nontoxigenic C. difficile strains (tcdA-B-) had either cdtA+B+ or cdtA-B+ profiles.
Conclusion:
This is the first report for the prevalence of binary toxin genes in C. difficile strains isolated from Iran. Further studies are required to investigate the exact role of binary toxins in the pathogenesis of C. difficile particularly in patients with chronic diarrhea among Iranian populations.
Key Words: Clostridium difficile, Binary toxin, cdtA, cdtB, Diarrheal patients
Introduction
Clostridium difficile is a gram-positive spore forming anaerobic bacterial pathogen. This microorganism is considered as the major causative agent for 5 to 25% of antibiotic associated diarrhea (AAD) and also pseudomembranous colitis (PMC) (1). Toxigenic strains generally produce two main toxins, including toxin A (enterotoxin) and B (cytotoxin), which have been identified as the main virulence factors in the pathogenesis of these bacteria (2, 3). The genes encoding toxin A and B are clustered in a specific locus, the pathogenicity locus called PaLoc. This locus is composed of five genes, including tcdA and tcdB that encode the over-mentioned toxins, tcdE encodes a putative holin for extracellular release of tcdA and tcdB, and tcdR and tcdC that encode the regulatory proteins (4).
Popoff et al. discovered a binary toxin in the historic CD196 strain, called CDT in 1988 (5). This toxin is found in a few strains of C. difficile and consists of a binding component and an enzymatic component that displays an action-specific ADP ribosyltransferase activity that leads to cytoskeleton disorganization (6). The genes encoding these two components, cdtA and cdtB, and a regulatory protein, are co-located on a locus called CdT. This toxin might potentiate the toxicity of tcdA and tcdB and lead to more severe disease and could, thus, be considered to be an accessory virulence factor (7). It has been estimated that about 1.6 to 10% of C. difficile isolates carry the binary toxin genes in their genomes (8).
In spite of high prevalence of toxin-A-negative/toxin-B-positive C. difficile strains among hospitalized patients, there are several reports about involvement of tcdA/B-negative strains in the occurrence of AAD and enterocolitis (9-13). Although overgrowth of tcdA/B-negative strains in the intestine and the absence of other enteric pathogens may support this involvement, further studies are required to determine the role of accessory virulence factors in the pathogenesis of C. difficile infection (CDI). Involvement of CDT in induction of apoptosis through its DNAse activity was shown in an in vitro study (14). This activity could mimic the same pathophysiological effects in the intestine, as was shown for tcdA/B toxins (8). Several clinical studies have suggested an association between the CDT-encoding C. difficile strains and increased mortality of the patients (15), however its establishment needs further studies. In the current study we aimed to investigate the prevalence of binary toxin genes, cdtA and cdtB, in clinical isolates of C. difficile recovered from hospitalized patients with diarrhea.
Methods
Bacterial isolates
The study population consisted of 169 clinical isolates of C. difficile, which had been recovered from the fecal samples of 930 patients with chronic diarrhea referred to the Diagnostic Anaerobic Laboratory of Research Institute for Gastroenterology and Liver Diseases in Tehran, Iran. All demographic and clinical data of the patients, including age, gender, antibiotic treatment and medications history were collected by using a standard questionnaire.
Culture and isolation
All fecal samples from patients cultured on proper culture media after their treatments by the following methods. First, small amount of stool samples were mixed with 1 ml of 5% yeast extract broth and directly inoculated onto C. difficile medium (Mast, London, United Kingdom) supplemented with 7% horse blood and C. difficile selective supplement consisting of D-cycloserine (250 mg/ liter), cefoxitin (8 mg/liter), and lysozyme (5 mg/liter) (Mast, London, United Kingdom). The cultured plates were incubated at 37 °C for at least 48-72 h under anaerobic conditions (80% N2; 10% CO2 and 10% H2) in an anaerobic generation system Anoxomat-Mart (Microbiology, Holland). Second, the samples treated with 1 ml of methanol (alcohol-shock procedure) for 1 to 2 minutes before inoculation on C. difficile medium (16, 17). The cultures results were followed up to one week. Isolates with characteristic colony morphologies and Gram staining for C. difficile were further identified by PCR using specific primers (18). Subcultures of the confirmed isolates were stored in cooked meat broth (Himedia, India) at 4 ˚C.
Genomic DNA extraction
The genomic DNA was extracted from pure colonies of C. difficile grown on C. difficile medium agar plates. DNA was extracted by Instagene matrix extraction kit (Bio-Rad, Nazareth, Belgium) and boiling method (19). In the boiling method, a loop full of each colony was resolved in 500 µl of distilled water and homogenized and centrifuged for 10 min at 13000 g. The pellets were mixed with 100 µl of distilled water, vortexed and incubated for 10 min in water bath. The samples were then centrifuged at 13000 g for 8-10 min. The supernatant containing bacterial DNA was stored at -20 °C, until further use.
Detection of binary-toxin genes
For molecular identification of C. difficile isolates, PCR was done using specific primers for cdd3 gene of PaLoc. All primer pairs used in this study are presented in Table 1. PCR amplification was also done by using specific primers for tcdA and tcdB genes as previously described by Spigaglia et al. (18). For detection of cdtA and cdtB genes, PCR was done using specific primers (20) in a 25μl reaction mixtures containing 1X PCR buffer (50 mM KCl, 10 mM Tris-HCl), 1.5μM MgCl2, 0.3μM of cdtA and 0.5μM cdtB primers, and 1U of Taq DNA polymerase. PCR amplifications of 375 bp fragment of the cdtA was done in a thermocycler (Eppendorf, Hamburg, Germany) as follows: initial denaturation at 5 min at 95 °C, followed by 40 cycles of 1 min at 95 °C, 50s at 57.5 °C and 35s at 72 °C; and a final extension at 72 °C for 5 min to end amplification process. For amplification of 510 bp fragment of the cdtB the following time-temperature profile was used: 5 min at 95 °C for initial denaturation, 40 cycles of 1 min at 95 °C, 1 min at 58.9 °C, and 35 at 72 °C; and a final extension cycle of 10 min at 72 °C. Peptoclostridium difficile strain RIGLD141 was used as the control positive strain in amplification experiments. The partial nucleotide sequences for cdtB (KM047900.1) and cdtA-like (KM047901.1) genes were deposited in the GenBank/NCBI.
Table 1.
Oligonucleotide sequences used to amplify the target genes in this study
Target gene | Primer | Oligonucleotide sequences (5' – 3') | Product length (bp) | References |
---|---|---|---|---|
cdd3 | Time6 Struppi6 |
TCCAATATAATAAATTAGCATTCC GGCTATTACACGTAATCCAGATA |
622 | 18 |
tcdA | TA1 TA2 |
ATGATAAGGCAACTTCAGTGG TAAGTTCCTCCTGCTCCATCAA |
624 | 18 |
tcdB | TB1 TB2 |
GACCTGCTTCAATTGGAGAGA GTAACCTACTT CATAACACCAG |
412 | 18 |
cdtA | CdtA | TGAACCTGGAAAAGGTGATG AGGATTATTTACTGGACCATTTG |
375 | 20 |
cdtB | CdtB | CTTAATGCAAGTAAATACTGAG AACGGATCTCTTGCTTCAGTC |
510 | 20 |
Statistical analysis
Statistical analyses were performed using IBM SPSS Statistics version 21 (Armonk, NY: IBM Corp.). Clinical and demographic data were analyzed by the Chi-square and Fisher’s exact tests. A p value less than 0.05 was regarded as indicating a statistically significant difference.
Table 2.
Demographic and clinical characteristics of the study population among 144 toxigenic C. dificile strain
Patient characteristics | Toxigenic C. dificile (n=144) |
tcdA
+
B
+
(n=124) |
tcdA
-
B
+
(n=9) |
cdt+
(n=21) |
cdtA
+
B
+
(n=8) |
cdtA
+
B
-
(n=4) |
cdtA
-
B
+
(n=9) |
---|---|---|---|---|---|---|---|
Age (years) | |||||||
1-5 6-30 31-50 51-70 70-10 |
22 (15.3) 36 (25) 25 (17.3) 31 (21.5) 30 (20.9) |
20 (16.1) 31 (25) 20 (16.1) 27 (21.8) 26 (21) |
0 3 (33.4) 2 (22.2) 3 (33.4) 1 (11) |
5 (23.8) 6 (28.5) 4 (19.1) 2 (9.5) 4 (19.1) |
2 (25) 3 (37.5) 2 (25) 1 (12.5) 0 |
2 (50) 1 (25) 0 0 1 (25) |
1 (11.2) 2 (22.2) 2 (22.2) 1 (11.2) 3 (33.2) |
Gender | |||||||
Female Male |
73 (50.7) 71 (49.3) |
63 (50.8) 61 (49.1) |
6 (66.7) 3 (33.3) |
8 (38) 13 (62) |
3 (37.5) 5 (62.5) |
2 (50) 2 (50) |
3 (33.3) 6 (66.7) |
Defecation (times/day) | |||||||
3-5 5-8 >10 |
73 (50.7) 41 (28.5) 30 (20.8) |
64 (51.7) 35 (28.2) 25 (20.1) |
5 (55.6) 2 (22.2) 2 (22.2) |
14 (66.7) 1 (4.8) 6 (28.5) |
5 (62.5) 0 3 (37.5) |
3 (75) 0 1 (25) |
6 (66.7) 1 (11.1) 2 (22.2) |
Antibiotic usage | |||||||
Yes No |
121 (84) 23 (16) |
104 (83.9) 20 (16.1) |
8 (88.9) 1(11.1) |
18 (85.7) 3 (14.3) |
6 (75) 2 (25) |
4 (100) 0 |
9 (100) 0 |
Underlying diseases | |||||||
Cancer Renal failure Dementia Immunodeficiency disorder Diabetes mellitus (DM) Mall nutrition Epilepsy/Allergy |
14 (9.8) 7 (4.9) 1 (0.7) 2 (1.4) 4 (2.8) 2 (1.4) 1 (0.7) 1 (0.7) |
11 (8.9) 0 1 (0.8) 1 (0.8) 4 (3.22) 2 (1.6) 1 (0.8) 1 (0.8) |
1 (11.1) 0 0 0 0 0 0 0 |
3(14.3) 2 (9.5) 0 0 1 (4.8) 0 0 0 |
0 1 (12.5) 0 0 1 (12.5) 0 0 0 |
1 (25) 0 0 0 0 0 0 0 |
2 (22.2) 1 (11.1) 0 0 0 0 0 0 |
Hospital wards | |||||||
Internal Infectious Surgery Intensive care unit (ICU) Pediatric Oncology Coronary care unit (CCU) Gynecology Gastroenterology Urology Nephrology Endocrinology Orthopedic Psychology Outpatient |
32 (22.1) 38 (26.4) 16 (11.1) 21 (14.6) 3 (2) 15 (10.4) 1(0.7) 3 (2) 8 (5.6) 3 (2) 0 1(0.7) 1(0.7) 1(0.7) 1(0.7) |
28 (22.6) 32 (25.8) 14 (11.3) 18 (14.5) 3 (2.4) 13 (10.5) 1 (0.8) 3 (2.4) 6 (4.8) 3 (2.4) 0 1 (0.8) 1 (0.8) 0 1 (0.8) |
2 (22.2) 2 (22.2) 0 2 (22.2) 0 1 (11.1) 0 0 1 (11.1) 0 0 0 0 1 (11.1) 0 |
5 (23.8) 7 (33.3) 4 (19) 2 (9.5) 0 1 (4.8) 0 1 (4.8) 1 (4.8) 0 0 0 0 0 0 |
0 4(50) 2 (25) 2 (25) 0 0 0 0 0 0 0 0 0 0 0 |
2 (50) 1 (25) 1 (25) 0 0 0 0 0 0 0 0 0 0 0 0 |
4 (44.4) 2 (22.2) 1 (11.1) 1 (11.1) 0 0 0 1 (11.1) 0 0 0 0 0 0 0 |
Table 3.
Distribution of tcdAB toxin genes in relation to cdtAB binary toxin profiles in 169 clinical strains of C. difficile
Toxin profile | Binary toxin (%) |
Total | |||
---|---|---|---|---|---|
cdtA
+
B
+
(n=8) |
cdtA
+
B
-
(n=4) |
cdtA
-
B
+
(n=9) |
cdtA
-
B
-
(n=148) |
||
tcdA + B + | 6 (75) | 2 (50) | 6 (66.7) | 110 (74.3) | 124 (73.3) |
tcdA + B - | 1 (12.5) | 1 (25) | 1 (11.1) | 8 (5.4) | 11 (6.5) |
tcdA - B + | 0 | 1 (25) | 0 | 8 (5.4) | 9 (5.3) |
tcdA - B - | 1 (12.5) | 0 | 2 (22.2) | 22 (14.8) | 25 (14.7) |
Results
Prevalence of CDI
This study investigated 930 suspected patients to CDI, including 466 males and 464 females. The CDI was confirmed in 169 patients (18.2%), 85 men and 84 women ranged between <1 to 50 years old. The prevalence of CDI varied among the patients in different wards of hospital and was as follow; 22.6% (38/169) in infectious diseases ward, 18.9% (32/169) in internal medicine ward, 12.4% (21/169) in intensive care unit (ICU), 9.5% (16/169) in surgical ward, and 4.8% (8/169) in gastroenterology ward. The lowest prevalence was detected among the patients in bone marrow and kidney transplantation units with less than 5%. Most of the CDI patients presented a defecation rate of 3 times per day, which was higher than CDI-negative patients with ≤2 times per day.
Frequency of tcdA, tcdB and binary toxins among the C. difficile strains
Of total patients with CDI, toxigenic and nontoxigenic C. difficile strains were characterized in 85.2% (144/169) and 14.8% (25/169) of the patients, respectively. Toxin genotyping of the strains for tcdA and tcdB genes revealed the toxin profiles of A+B+, A+B-, A-B+ accounting for 86.1% (124/144), 7.6% (11/144), 6.2% (9/144) among the strains, respectively. Nearly, half of the toxigenic C. difficile strains (51.7%) with toxin profile of tcdA+B+ were detected among the patients who had 3-5 defecations per day. More than half of the patients (63.6%) with toxin profile of tcdA+B- were seen among the males, while most of the females (66.7%) had toxin profile of tcdA-B+. Among all toxigenic patients, cancer was observed as the most common underlying disease. The highest (26.3%) prevalence of toxigenic C. difficile strains was observed in patients confined in infectious diseases ward, and the lowest (0.7%) was seen in coronary care unit (CCU), endocrinology and orthopedic wards. Totally, 12.4% (21/169) of the C. difficile strains were binary toxin-positive. Among them, cdtA-B+, cdtA+B+ and cdtA+B- were detected in 43% (9/21), 38% (8/21) and 19% (4/21) of the strains, respectively. Strains with cdtA+B+ and cdtA-B+ profiles were mostly seen among males, while cdtA+B- were equally detected within males and females. The demographic and clinical characteristics of the study population among 144 toxigenic C. difficile strains are presented in Table 2.
Distribution of tcdAB genes in relation to binary toxin profiles
Most of the C. difficile strains with cdtA+B+ and cdtA-B+ profiles were found to be tcdA+B+. Moreover, half of the strains with cdtA+B- profile were found to be tcdA+B+. Interestingly, 12% (3/25) of nontoxigenic C. difficile strains (tcdA-B-) were found to have either cdtA+B+ or cdtA-B+ profiles. None of the strains with cdtA+B+ and cdtA-B+ profiles were detected to be tcdA-B+. In addition, strains with cdtA+B- profile carried at least one of the tcdA or/and tcdB genes. Distribution of tcdAB toxin genes in relation to cdtAB binary toxin profiles were shown in Table 3.
Discussion
The structure of the C. difficile binary toxin is well known, but few data are available to show the role of this toxin in the pathogenesis of gastrointestinal disease. Currently, there is little information about the clinical relevance and pathogenic role of the ADP-ribosylating toxin CDT in C. difficile infections (21). C. difficile induces a wide range of diseases from mild diarrhea to PMC, toxic megacolon, and even fulminant colitis. It has been reported that variations in the expression levels of tcdA and tcdB as the major C. difficile toxins cannot account for the wide spectrum of clinical presentations (7, 21). Borriello et al. reported no correlation between virulence in a hamster model of antibiotic association colitis and the production of tcdA and tcdB in vitro (22). Therefore, it was hypothesized that CDT produced by some C. difficile strains may be responsible for these manifestations. CDT is a potent cytotoxin, which impairs the functions of mucosal barrier and subsequently can facilitate the action of typical Clostridial cytotoxins (23). CDT may also act in synergy with other toxins, depolymerizing the actin cytoskeleton by a complementary mechanism (24). In C. difficile strain CD196 that can cause a severe PMC, the production of this additional toxin exacerbates the symptoms of PMC (23). In the present study, C. difficile was detected in 169/930 (18.2%) fecal samples collected from diarrheal patients, in which 85.2% (144/169) and 14.8% (25/169) isolates were toxigenic and nontoxigenic, respectively. In our study, the prevalence of toxin profiles including A+B+, A+B-, A-B+ were 86.1% (124/144), 7.6% (11/144), 6.2% (9/144), respectively. In another report by Huang et al., the frequency of A+B+and A–B+ toxin profiles were 43/71 (60.5%) and 13/71 (18.3%) among patients with recurrent CDI (25). Even though toxigenic C. difficile (tcdA+B+) plays a major role in the pathogenesis of CDI, several studies represented that CDI caused by A-B+ strains is increasing significantly (10, 26, 27). Another study performed in Europe demonstrated that 6.2% of C. difficile isolates had A−B+ profile (28). Brazier et al. (29) in UK and Pituch et al. in Poland (11), reported the isolation rates of 3% and 11% for A-B+ types, respectively.
In this study, we found that 21 (12.4%) strains of C. difficile harbored binary toxin genes. It is noted that 12% (3/25) of our nontoxigenic strains (tcdA-B-) were cdtA+B+ and cdtA-B+. Although many investigations have been conducted on A−B− CDT+ toxin profile of C. difficile in humans and animals (30-33), the prevalence of this toxin type has been reported to be less than 5% in humans (34). Binary toxin producing strains of C. difficile has been reported in recent years, and the prevalence of binary toxin genes vary in different geographic regions worldwide. The deduced prevalence of binary toxin genes in toxigenic strains is high and differences in the findings of prevalence reports may be partly due to the differences in patient (symptomatic or not, adult or children) or strain selection. In addition, as was shown recently by Rupnik et al., the distribution of binary toxin positive strains can vary between hospitals (35). Eckert et al. (31) in 2015 reported a range of 17 to 23% for binary toxin prevalence among CDI patients. Another study carried out in UK, revealed that 6.4% of the toxigenic isolates of C. difficile possessed the cdtA and cdtB genes (3). Rupnik et al. (36) in 2003, showed a prevalence of 1.6% for the binary toxin in 310 isolates from various hospitals in Japan, Korea and from healthy infants from Indonesia. During 2008 and 2009 Katie et al. reported a prevalence 32.5 % of the binary toxin gene (cdtB) in 150 consecutive patients with CDI in two hospitals in Ireland (37). In our study, the frequency of A+B+CDT+, A+B+CDT- andA-B+CDT- were 6/169 (3.6%), 110/169 (65%), and 8/169 (4.7%), respectively. In a study conducted in Japan the prevalence of A+B+CDT+, A+B+CDT- and A-B+CDT- were 4/71(5.6%), 58/71(81.7%), and 9/71 (12.7%), respectively (38, 39). In conclusion, to our knowledge this is the first report for the prevalence of binary toxin genes in C. difficile strains isolated from Iran. Further studies are required to investigate the exact role of binary toxins in the pathogenesis of C. difficile particularly in patients with chronic diarrhea among Iranian populations.
Conflict of interests
The authors declare that they have no conflict of interest.
References
- 1.Rodríguez-Varón A, Muñoz OM, Pulido-Arenas J, Amado SB, Tobón-Trujillo M. Antibiotic-associated diarrhea: Clinical characteristics and the presence of Clostridium difficile. Rev Gastroenterol Mex. 2017;82:129–133. doi: 10.1016/j.rgmx.2016.10.003. [DOI] [PubMed] [Google Scholar]
- 2.Just I, Selzer J, Wilm M, von Eichel-Streiber C, Mann M, Aktories K. Glucosylation of Rho proteins by Clostridium difficile toxin B. Nature. 1995;375:500. doi: 10.1038/375500a0. [DOI] [PubMed] [Google Scholar]
- 3.Bartlett JG. Clinical practice Antibiotic-associated diarrhea. N Engl J Med. 2002;346:334–9. doi: 10.1056/NEJMcp011603. [DOI] [PubMed] [Google Scholar]
- 4.Taremi M, Soltan Dallal M, Gachkar L, MoezArdalan S, Zolfagharian K, Reza Zali M. Prevalence and antimicrobial resistance of Campylobacter isolated from retail raw chicken and beef meat, Tehran, Iran. Int J Food Microbiol. 2006;108:401–403. doi: 10.1016/j.ijfoodmicro.2005.12.010. [DOI] [PubMed] [Google Scholar]
- 5.Popoff MR, Boquet P. Clostridium spiroforme toxin is a binary toxin which ADP-ribosylates cellular actin. Biochem Biophys Res Commun. 1988;152:1361–8. doi: 10.1016/s0006-291x(88)80435-2. [DOI] [PubMed] [Google Scholar]
- 6.Perelle S, Gibert M, Bourlioux P, Corthier G, Popoff MR. Production of a complete binary toxin (actin-specific ADP-ribosyltransferase) by Clostridium difficile CD196. Infect Immun. 1997;65:1402–7. doi: 10.1128/iai.65.4.1402-1407.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Barbut F, Decré D, Lalande V, Burghoffer B, Noussair L, Gigandon A, et al. Clinical features of Clostridium difficile-associated diarrhoea due to binary toxin (actin-specific ADP-ribosyltransferase)-producing strains. J Med Microbiol. 2005;54:181–5. doi: 10.1099/jmm.0.45804-0. [DOI] [PubMed] [Google Scholar]
- 8.Gerding DN, Johnson S, Rupnik M, Aktories K. Clostridium difficile binary toxin CDT: mechanism, epidemiology, and potential clinical importance. Gut Microbes. 2014;5:15–27. doi: 10.4161/gmic.26854. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Davies NL, Compson JE, Mackenzie B, O'Dowd VL, Oxbrow AK, Heads JT, et al. A mixture of functionally oligoclonal humanized monoclonal antibodies that neutralize Clostridium difficile TcdA and TcdB with high levels of in vitro potency shows in vivo protection in a hamster infection model. Clin Vaccine Immunol. 2013;20:377–90. doi: 10.1128/CVI.00625-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Pestechian N, Rasekh H, Rostami-Nejad M, Yousofi HA, Hosseini-Safa A. Molecular identification of Giardia lamblia; is there any correlation between diarrhea and genotyping in Iranian population? Gastroenterol Hepatol Bed Bench. 2014;7:168–72. [PMC free article] [PubMed] [Google Scholar]
- 11.Pituch H, van den Braak N, van Leeuwen W, van Belkum A, Martirosian G, Obuch-Woszczatyński P, et al. Clonal dissemination of a toxin-A-negative/toxin-B-positive Clostridium difficile strain from patients with antibiotic-associated diarrhea in Poland. Clin Microbiol Infect. 2001;7:442–6. doi: 10.1046/j.1198-743x.2001.00312.x. [DOI] [PubMed] [Google Scholar]
- 12.Drudy D, Harnedy N, Fanning S, O'Mahony R, Kyne L. Isolation and characterisation of toxin A-negative, toxin B-positive Clostridium difficile in Dublin, Ireland. Clin Microbiol Infect. 2007;13:298–304. doi: 10.1111/j.1469-0691.2006.01634.x. [DOI] [PubMed] [Google Scholar]
- 13.Tajbakhsh M, García Migura L, Rahbar M, Svendsen CA, Mohammadzadeh M, et al. Antimicrobial-resistant Shigella infections from Iran: an overlooked problem? J Antimicrob Chemother. 2012;67:1128–33. doi: 10.1093/jac/dks023. [DOI] [PubMed] [Google Scholar]
- 14.Rostami Nejad M, Nazemalhosseini Mojarad E, Nochi Z, Fasihi Harandi M, Cheraghipour K, Mowlavi GR, et al. Echinococcus granulosus strain differentiation in Iran based on sequence heterogeneity in the mitochondrial 12S rRNA gene. J Helminthol. 2008;82:343–47. doi: 10.1017/S0022149X0804594X. [DOI] [PubMed] [Google Scholar]
- 15.Bacci S, Mølbak K, Kjeldsen MK, Olsen KE. Binary toxin and death after Clostridium difficile infection. Emerg Infect Dis. 2011;17:976–82. doi: 10.3201/eid1706.101483. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Azimirad M, Krutova M, Nyc O, Hasani Z, Afrisham L, Alebouyeh M, et al. Molecular typing of Clostridium difficile isolates cultured from patient stool samples and gastroenterological medical devices in a single Iranian hospital. Anaerobe. 2017;47:125–128. doi: 10.1016/j.anaerobe.2017.05.004. [DOI] [PubMed] [Google Scholar]
- 17.Azimirad M, Rostami-Nejad M, Rostami K, Naji T, Zali MR. The Susceptibility of Celiac Disease Intestinal Microbiota to Clostridium difficile Infection. Am J Gastroenterol. 2015;110:1740–1. doi: 10.1038/ajg.2015.360. [DOI] [PubMed] [Google Scholar]
- 18.Spigaglia P, Mastrantonio P. Molecular analysis of the pathogenicity locus and polymorphism in the putative negative regulator of toxin production (TcdC) among Clostridium difficile clinical isolates. J Clin Microbiol. 2002;40:3470–5. doi: 10.1128/JCM.40.9.3470-3475.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Shayganmehr FS, Alebouyeh M, Azimirad M, Aslani MM, Zali MR. Association of tcdA+/tcdB+ Clostridium difficile Genotype with Emergence of Multidrug-Resistant Strains Conferring Metronidazole Resistant Phenotype. Iran Biomed J. 2015;19:143–8. doi: 10.7508/ibj.2015.03.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Stubbs S, Rupnik M, Gibert M, Brazier J, Duerden B, Popoff M. Production of actin-specific ADP-ribosyltransferase (binary toxin) by strains of Clostridium difficile. FEMS Microbiol Lett. 2000;186:307–12. doi: 10.1111/j.1574-6968.2000.tb09122.x. [DOI] [PubMed] [Google Scholar]
- 21.Rostami Nejad M, Ishaq S, Al Dulaimi D, Zali MR, Rostami K. The role of infectious mediators and gut microbiome in the pathogenesis of celiac disease. Arch Iran Med. 2015;18:244–49. [PubMed] [Google Scholar]
- 22.Borriello SP, Ketley JM, Mitchell TJ, Barclay FE, Welch AR, Price AB, et al. Clostridium difficile--a spectrum of virulence and analysis of putative virulence determinants in the hamster model of antibiotic-associated colitis. J Med Microbiol. 1987;24:53–64. doi: 10.1099/00222615-24-1-53. [DOI] [PubMed] [Google Scholar]
- 23.Gonçalves C, Decré D, Barbut F, Burghoffer B, Petit JC. Prevalence and characterization of a binary toxin (actin-specific ADP-ribosyltransferase) from Clostridium difficile. J Clin Microbiol. 2004;42:1933–9. doi: 10.1128/JCM.42.5.1933-1939.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Silva ROS, Salvarani FM, Júnior C, da Costa EC, Pires PS, Santos RLR, et al. Detection of enterotoxin A and cytotoxin B, and isolation of Clostridium difficile in piglets in Minas Gerais, Brazil. Ciência Rural. 2011;41:1430–5. [Google Scholar]
- 25.Huang H, Wu S, Wang M, Zhang Y, Fang H, Palmgren A-C, et al. Clostridium difficile infections in a Shanghai hospital: antimicrobial resistance, toxin profiles and ribotypes. Int J Antimicrob Agents. 2009;33:339–42. doi: 10.1016/j.ijantimicag.2008.09.022. [DOI] [PubMed] [Google Scholar]
- 26.Komatsu M, Kato H, Aihara M, Shimakawa K, Iwasaki M, Nagasaka Y, et al. High frequency of antibiotic-associated diarrhea due to toxin A-negative, toxin B-positive Clostridium difficile in a hospital in Japan and risk factors for infection. Eur J Clin Microbiol Infect Dis. 2003;22:525–9. doi: 10.1007/s10096-003-0992-5. [DOI] [PubMed] [Google Scholar]
- 27.Elliott B, Squire MM, Thean S, Chang BJ, Brazier JS, Rupnik M, et al. New types of toxin A-negative, toxin B-positive strains among clinical isolates of Clostridium difficile in Australia. J Med Microbiol. 2011;60:1108–11. doi: 10.1099/jmm.0.031062-0. [DOI] [PubMed] [Google Scholar]
- 28.Barbut F, Mastrantonio P, Delmée M, Brazier J, Kuijper E, Poxton I; et al. Prospective study of Clostridium difficile infections in Europe with phenotypic and genotypic characterisation of the isolates. Clin Microbiol Infect. 2007;13:1048–57. doi: 10.1111/j.1469-0691.2007.01824.x. [DOI] [PubMed] [Google Scholar]
- 29.Brazier JS, Stubbs SL, Duerden BI. Prevalence of toxin A negative/B positive Clostridium difficile strains. J Hosp Infect. 1999;42:248–9. [PubMed] [Google Scholar]
- 30.McGovern AM, Androga GO, Knight DR, Watson MW, Elliott B, Foster NF, et al. Prevalence of binary toxin positive Clostridium difficile in diarrhoeal humans in the absence of epidemic ribotype 027. PLoS One. 2017;12:e0187658. doi: 10.1371/journal.pone.0187658. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Eckert C, Emirian A, Le Monnier A, Cathala L, De Montclos H, Goret J, et al. Prevalence and pathogenicity of binary toxin–positive Clostridium difficile strains that do not produce toxins A and B. New Microbes New Infect. 2015;3:12–7. doi: 10.1016/j.nmni.2014.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Knight DR, Thean S, Putsathit P, Fenwick S, Riley TV. Cross-sectional study reveals high prevalence of Clostridium difficile non-PCR ribotype 078 strains in Australian veal calves at slaughter. Appl Environ Microbiol. 2013;79:26305. doi: 10.1128/AEM.03951-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Janezic S, Potocnik M, Zidaric V, Rupnik M. Highly Divergent Clostridium difficile Strains Isolated from the Environment. PLoS One. 2016;11:e0167101. doi: 10.1371/journal.pone.0167101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Hensgens MP, Keessen EC, Squire MM, Riley TV, Koene MG, de Boer E, et al. Clostridium difficile infection in the community: a zoonotic disease? Clin Microbiol Infect. 2012;18:635–45. doi: 10.1111/j.1469-0691.2012.03853.x. [DOI] [PubMed] [Google Scholar]
- 35.Rupnik M, Kato N, Grabnar M, Kato H. New types of toxin A-negative, toxin B-positive strains among Clostridium difficile isolates from Asia. J Clin Microbiol. 2003;41:1118–25. doi: 10.1128/JCM.41.3.1118-1125.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Barbut F, Delmée M, Brazier JS, Petit JC, Poxton IR, Rupnik M, et al. A European survey of diagnostic methods and testing protocols for Clostridium difficile. Clin Microbiol Infect. 2003;9:989–96. doi: 10.1046/j.1469-0691.2003.00683.x. [DOI] [PubMed] [Google Scholar]
- 37.Solomon K, Martin AJ, O'Donoghue C, Chen X, Fenelon L, Fanning S, et al. Mortality in patients with Clostridium difficile infection correlates with host pro-inflammatory and humoral immune responses. J Med Microbiol. 2013;62:1453–60. doi: 10.1099/jmm.0.058479-0. [DOI] [PubMed] [Google Scholar]
- 38.Iwashima Y, Nakamura A, Kato H, Kato H, Wakimoto Y, Wakiyama N, et al. A retrospective study of the epidemiology of Clostridium difficile infection at a University Hospital in Japan: genotypic features of the isolates and clinical characteristics of the patients. J Infect Chemother. 2010;16:329–33. doi: 10.1007/s10156-010-0066-4. [DOI] [PubMed] [Google Scholar]
- 39.Eesteghamati A, Gouya M, Keshtkar A, Najafi L, Zali MR, Sanaei M, et al. Sentinel hospital-based surveillance of rotavirus diarrhea in iran. J Infect Dis. 2009;200:S244–47. doi: 10.1086/605050. [DOI] [PubMed] [Google Scholar]