Skip to main content
BMC Veterinary Research logoLink to BMC Veterinary Research
. 2019 Jan 29;15:44. doi: 10.1186/s12917-019-1788-x

Bacterial species associated with interdigital phlegmon outbreaks in Finnish dairy herds

Miia Kontturi 1,, Reijo Junni 1, Heli Simojoki 1, Erja Malinen 2, Eija Seuna 2, Kirstine Klitgaard 3, Minna Kujala-Wirth 1, Timo Soveri 1, Sinikka Pelkonen 2
PMCID: PMC6352363  PMID: 30696445

Abstract

Background

Severe outbreaks of bovine interdigital phlegmon (IP) have occurred recently in several free stall dairy herds in Finland. We studied the aetiology of IP in such herds, and the association of bacterial species with the various stages of IP and herds of various morbidity of IP. Nineteen free stall dairy herds with IP outbreaks and three control herds were visited and bacteriological samples collected from cows suffering from IP (n = 106), other hoof diseases (n = 58), and control cows (n = 64). The herds were divided into high morbidity (morbidity ≥50%) and moderate morbidity groups (9–33%) based on morbidity during the first two months of the outbreak.

Results

F. necrophorum subspecies necrophorum was clearly associated with IP in general, and T. pyogenes was associated with the healing stage of IP. Six other major hoof pathogens were detected; Dichelobacter nodosus, Porphyromonas levii, Prevotella melaninogenica, Treponema spp. and Trueperella pyogenes. Most of the samples of acute IP (66.7%) harboured both F. necrophorum and D. nodosus. We found differences between moderate morbidity and high morbidity herds. D. nodosus was more common in IP lesion in high than in moderate morbidity herds.

Conclusions

Our result confirms that F. necrophorum subspecies necrophorum is the main pathogen in IP, but also T. pyogenes is associated with the healing stage of IP. Our results suggest that D. nodosus may play a role in the severity of the outbreak of IP, but further research is needed to establish other bacteriological factors behind these severe outbreaks.

Keywords: Interdigital phlegmon, Infectious hoof diseases, Fusobacterium necrophorum, Dichelobacter nodosus, Foot rot, Interdigital necrobacillosis, Foul-in-the-foot

Background

During recent years, severe outbreaks of interdigital phlegmon (IP) have occurred in dairy herds in Finland, with sudden onset and of divergent morbidity. No preceding clear wound has been detected in the interdigital cleft of the IP cows. These new types of outbreaks have caused serious economic losses to affected dairy farms [1].

IP occurs usually as a sporadic infection of cattle. The herd incidence per lactation is generally 2–5% [2, 3], but studies of earlier outbreaks of IP report incidences of 17–25% during outbreaks [4, 5]. Common signs of IP are lameness; occasionally with an acute onset, a swelling of the interdigital area and the bulbs of the heels, and a fetid odour. A fissure with swollen protruding edges may appear along the interdigital cleft. In severe cases, systemic signs occur, including fever, recumbency, anorexia or decrease in milk production [6, 7]. IP reduces milk yield [8] and can necessitate early culling of the affected cow [8, 9].

Traditionally, Fusobacterium necrophorum is considered the major infective agent of IP [1012] and is detected frequently in IP lesions. F. necrophorum is a common animal pathogen, producing several toxins that can injure tissues; leukotoxin, coded for the lktA gene, is considered a major virulence factor in cattle [13]. lktA is unique to F. necrophorum [14], and its detection has been used in cattle research as a reliable tool for the detection of F. necrophorum [15]. F. necrophorum is classified into two subspecies, necrophorum and funduliforme. Subspecies necrophorum is more frequently encountered in animal infections and in pure culture, whereas funduliforme is found in mixed infections and is considered less pathogenic [16].

In addition to F. necrophorum, several other bacteria such as, Bacteroides melaninogenicus [11, 12], Dichelobacter nodosus [7], Porphyromonas levii [17, 18], Spirochetes [5, 7], and Trueperella pyogenes [11] have been suggested to play a role in the pathogenesis of IP. Nevertheless, most of that research was done long ago and, for example, the taxonomical changes since then make interpretation of the results challenging. Also, a recent review describes that the role of various bacterial species in the pathogenesis of IP is still unresolved [6].

Recently the main research focus worldwide has been on digital dermatitis (DD) and treponemes and only a few studies have addressed IP and its bacteriology. However, because of numerous new type outbreaks of IP in dairy herds in Finland, we investigated the bacteriology of IP, including those bacteria earlier suggested to be involved in IP. The aim of the study was to investigate the bacteriology of IP in this new type of outbreaks; at various stages of IP, both acute and during the healing process, and compare the findings with healthy control cows. Moreover, we investigated whether these bacteriological findings differed between herds of various morbidities.

Methods

Herds

During 2012–2015 we carried out a research project on infectious hoof diseases in Finland. As a part of the project, we made several farm visits to privately owned dairy herds affected by outbreaks of IP. Of the farms visited, 19 fulfilled the criteria for an outbreak of IP; at least three observed cases of IP within 1 week, and no previous history of IP in the herd for 10 years. The outbreak herds were later divided into two categories based on the incidence of IP within 2 months of the outbreak. Furthermore, we collected samples from control cows of three non-outbreak herds (IP free herds). All herds studied were housed in free stalls. The average herd size was 75 lactating cows (range 31–140, median 62) and the average milk yield was 9234 kg (8000–10,914 kg, median 9219 kg).

Cows

The primary selection criteria for inclusion of a cow in the study were lameness, prolonged lying-time, or a ‘trouble report’ from an automatic milking system. In the outbreak herds, we collected samples mainly from cows that had IP, but also from lesions apparently infected with bacteria. Such lesions included DD, interdigital dermatitis (ID), white line abscesses and sole ulcers. The IP lesions were classified as acute IP or healing IP. The diagnosis of acute IP was made if a symmetric swelling and possible ulceration appeared in the interdigital cleft. Healing IP was identified as proliferation tissue or apparent scar formation in the affected region. DD diagnosis was made according to Döpfer et al. [19]. We also sampled 1–5 control cows per IP outbreak herd. These were non-lame cows with no sign of IP, DD, ID, sole ulcer, or white line disease, and are hereafter referred to as control cows (IP herd). In control herds, we sampled 4–8 cows in each herd using the same criteria as for control cows (IP herd).

We sampled a single hoof from all control cows, but from 11 cows with IP or DD we took samples from two separate feet. Five outbreak herds were visited 2 or 3 times. During these visits, 10 IP cows were sampled repeatedly 2 or 3 times 11–34 days after the first sampling. These samples were additional and not included in the total number of hoof samples (total n = 228). These resampled IP cows had clinical signs of IP at all sampling times. Table 1 presents the number of study herds of various morbidities, numbers of sampled cows and hoof samples in various disease groups.

Table 1.

Dairy herds, cows and bacteriological samples of a study of interdigital phlegmon outbreaks in Finland

Herd (n) Cow (n) Control (IP free herd) Control (IP herd) Acute IP Healing stage IP Other hoof disease
Number of herds 19 217
 High morbidity herd 7 65 13 (28.9%) 27 (45%) 11 (27.5%) 14 (26.4%)
 Moderate morbidity herd 12 133 32 (71.1%) 33 (55%) 29 (72.50%) 39 (73.6%)
 Non-outbreak herd 3 19 19 (100%)
Number of cows 217 19/217 (8.8%) 45/217 (20.7%) 60/217 (27.7%) 40/217 (18.4%) 53/217 (24.4%)
Cows with antibiotic treatment
 None 151 (69.6%) 19 (100%) 45 (100%) 31 (51.7%) 7 (17.5%) 49 (92.5%)
 Current 37 (17.1%) 0 (0%) 0 (0%) 21 (35%) 15 (37.5%) 1 (1.9%)
 Previous 29 (13.4%) 0 (0%) 0 (0%) 8 (13.3%) 18 (45%) 3 (5.7%)
Hoof sample (n) Control (IP free herd) Control (IP herd) Acute IP Healing stage IP Other hoof disease
Number of hoof samples 228a 19 (8.3%) 45 (19.7%) 65a (28.5%) 41a (18.0%) 58a (25.4%)
 Front feet 25 (11.0%) 0 (0%) 5 (11.1%) 12 (18.5%) 5 (12.2%) 3 (5.2%)
 Hind feet 203 (89.0%) 19 (100%) 40 (88.9%) 53 (81.5%) 36 (87.8%) 55 (94.8%)
Hoof sample with antimicrobial treatment
 None 159 (69.7%) 19 (100%) 45 (100%) 36 (55.4%) 7 (17.1%) 52 (89.7%)
 Current 38 (16.7%) 0 (0%) 0 (0%) 21 (32.3%) 16 (39.0%) 1 (1.7%)
 Previous 31 (13.6%) 0 (0%) 0 (0%) 8 (12.3%) 18 (43.9%) 5 (8.6%)
Number of PCR tests Hoof sample (n) Control (IP free herd) Control (IP herd) Acute IP Healing stage IP Other hoof disease
Fusobacterium necrophorum 205 19 (100%) 43 (95.6%) 52 (80.0%) 37 (90.2%) 54 (93.1%)
Dichelobacter nodosus 205 19 (100%) 43 (95.6%) 52 (80.0%) 37 (90.2%) 54 (93.1%)
Porphyromonas levii 142 19 (100%) 41 (91.1%) 49 (75.4%) 33 (80.5%) Not analyzed
Prevotella melaninogenica 142 19 (100%) 41 (91.1%) 49 (75.4%) 33 (80.5%) Not analyzed
Treponema group 2 & 3 168 19 (100%) 42 (93.3%) 39 (60.0%) 36 (87.8%) 32 (59.3%)
Trueperella pyogenes 205 19 (100%) 43 (95.6%) 52 (80.0%) 37 (90.2%) 54 (93.1%)

aTwo feet were sampled from 11 cows (5 acute IP, 1 healing stage IP, 5 other hoof diseases)

Numbers of sampled cows, numbers of hoof samples and a possible antimicrobial treatment in various disease groups; control cows in a herd with no outbreak of interdigital phlegmon, IP (IP free herd), control cows in a herd with an outbreak of IP (IP herd), acute interdigital phlegmon (Acute IP), IP at healing stage (Healing IP) and hoof diseases other than IP (Other). The group “Other” included hoof samples from digital dermatitis, interdigital dermatitis, white line abscess and sole ulcer. With antibiotic treatment, “None” signifies no current or previous antibiotic treatment during last month, “Current” signifies current antibiotic treatment or treatment within 6 days before sampling and “Previous” means previous treatment with antibiotics within 7–30 days prior to the sampling. “Number of PCR tests column means the number of samples that were successfully amplified in PCR

Of the sampled cows (n = 217) selected for the study, 58.5% were Ayrshire and 41.5% Holstein. Moreover 4.6% were heifers, 41.5% first parity cows, 22.1% second parity, 29.5% third or more parity cows and 36.9% were on early lactation (1–120 days in milk, DIM), 53.0% late lactation (121–305 DIM) and 7.8% were either dry cows or heifers. Information on parity and lactation stage was absent for 5 cows (2.3%).

Sampling methods and materials

Two veterinarians (MK, RJ) experienced in hoof diseases of cattle, evaluated the general condition and hoof health of the cows prior to sampling and recorded clinical diagnosis and antimicrobial treatment history. Every hoof was photographed at sampling, and diagnoses were standardized between the two veterinarians by evaluating some of the photographs together.

The sampling took place in a trimming chute; we lifted the foot up and spread the claws with an extensor. Then we washed the distal foot carefully with a hose, spouted with saline solution, and dried it with gauze. We collected the bacterial samples from the inflamed region using sterile swabs (FLOQSwabs), used them immediately for culturing, and took cytobrush samples from the same region for PCR analysis. We placed the cytobrushes (Medscand Medical Cytobrush Plus, CooperSurgical Inc., Germany) in sampling tubes (Micro tube 2 mL, Sarstedt, Germany) and froze them to – 20 °C in 24 h. We sampled the control cows similarly from the interdigital cleft. All bacterial samples in this study are hereafter referred as hoof samples. If needed, the farm veterinarian treated IP and DD cows with severe signs after sampling.

Bacteriological culture

During the farm visits, we set up a field laboratory at the farm. It included culture media, disposable plastic loops (10 μL, Mekalasi Oy, Helsinki, Finland) and equipment to maintain anaerobic conditions. Fastidious Anaerobe Agar, FAA (LabM, Lancashire, UK) and Fusobacterium Neomycin Vancomycin, NV agar [20] were used for primary culture. NV media were provided by Kokkola laboratory ((Maintpartner OY, Kokkola, Finland) or the Finnish Food Safety Authority (Evira, Helsinki, Finland). Agar plates were prereduced in Genbox containers (Biomerieux, France). The agar plates were sealed to maintain anaerobic conditions (BD GasPak EZ, Becton, Dickinson and Company, USA and GENpag anaer, Biomerieux, France) within 2 hours of sampling and incubated anaerobically for 2 days at 37 °C.

Isolation and identification of Fusobacteriumnecrophorum

From cultures we picked greyish, umbonate colonies of various shapes and sizes typical of spp. necrophorum, and smaller, yellowish, and waxy colonies typical of spp. funduliforme. Both colony types expressed strong beta-haemolysis on FAA and NV agars. The colonies were identified using conventional bacteriological methods to species and subspecies level [20], and verified using PCR assays for lktA and haemagglutinin (Table 2). Isolates were stored below − 70 °C for further characterisation.

Table 2.

PCR oligos and reaction conditions of a study of interdigital phlegmon outbreaks in Finnish dairy herds

PCR assay Oligos Annealing temperature (°C) PCR product (bp) Reference
Dichelobacter nodosus 16S(F2): CGGGGTTATGTAGCTTGC 60 783 [43]
16S(R2): TCGGTACCGAGTATTTCTACCCAACACCT
F. necrophorum leucotoxin LT3 F: GGAGTAAGAGCAACTATGGGAGCAGCTAC 60 360 [44]
LT3 R: CCCAATCCACCTTTTACAGCAGCTCG
F. necrophorum hemagglutinin HAEM F: CATTGGGTTGGATAACGACTCCTAC 55 286 [45]
HAEM R: CAATTCTTTGTCTAAGATGGAAGCGG
Trueperella pyogenes pyolysin PLO F: TCATCAACAATCCCACGAAGAG 60 150 [46]
PLO R: TTGCCTCCAGTTGACGCTTT
Universal 16S 27f YM: 5’-AGAGTTTGATYMTGGCTCAG-3′ 53 ~ 1500 [47]
1492 r: 5’-TACCTTGTTACGACTT-3′
Porphyromonas levii
PORP01F01 GACCAAATCGTCGTACTTGACAAA 66.2 75
PORP01R01 GCCTCGGCTGGCAGTAAG 66.4
PORP01P01FAM ACTCTCATGGTTGCCTACTTCTACAATCTTTCC 71.3
Prevotella melaninogenica
PREV01F01 CCCGGCTGTTTAGAATACTTTGTCA 67.8 152
PREV01R02 CTTTGCATGGGTGGTGTTGAT 67.2
PREV01P01FAM AATTAATCGTCGTCCGATATCACCACATACAGAG 73.4
Treponemas
Group 1 (T. medium/T. vincentii –like) TmF 5′-GAATGCTCATCTGATGACGGTAATCGACG-3′ 68 472–500 [21]
TmR 5′-CCGGCCTTATCTAAGACCTTCTACTAG-3′
Group 2 (T. phagedenis-like) TbF 5′-GAAATACTCAAGCTTAACTTGAGAATTGC-3′ 64 400 [21]
TbR 5′-CTACGCTACCATATCTCTATAATATTGC-3′
Group 3 (T. denticola /T. putidum-like) TpF 5′-GGAGATGAGGGAATGCGTCTTCGATG-3′ 67 475 [21]
TpR 5′-CAAGAGTCGTATTGCTACGCTGATATATC-3′
Universal 16S 16S F 5′-AGAGTTTGATCCTGG-3′ 57 1526 [48]
16S R 5′-TACCTTGTTACGACTT-3′

DNA extraction from the cytobrush samples

Total DNA was extracted from cytobrush samples with Qiagen Blood and Tissue Column kit (Qiagen Gmbh, Germany) following the manufacturer’s instructions. The samples were eluted in 100 μL EB and stored at − 20 °C. An aliquot of 2 μL was used as a template for PCR amplification. Bovine DNA in the preparations did not block the detection of bacterial target DNA by PCR. The PCR assays are listed in Table 2.

PCR for Fusobacterium necrophorum, Dichelobacter nodosus and Trueperellapyogenes

The PCR analyses were performed at the Finnish Food Safety Authority Evira. Of the 228 samples analyzed, 205 samples were successfully amplified. The PCR assays, oligos and conditions for PCR are shown in Table 2. PCR reactions consisted of 0.5 μM of each oligo, 200 μM dNTP (Thermo Fisher Scientific), 1.0 U Dynazyme polymerase, 1.5 mM MgCl2 and 2 μL template in Dynazyme F-511 buffer (Thermo Fisher Scientific). PTC Thermal cycler (Thermo Fisher Scientific™) was used for ampilification. For lktA gene, the thermal profile consisted of 95 °C for 2 min followed by 35 cycles of 95 °C for 30 s, 60 °C for 30 s, 72 °C for 40 s, with a final extension at 72 °C for 5 min. For haemagglutinin gene, the thermal profile was 95 °C for 2 min, followed by 35 cycles of 95 °C for 30 s, 55 °C for 15 s and 72 °C for 30 s, with a final extension at 72 °C for 5 min. The PCR products were separated and visualized using electrophoresis and SybrSafe in 1.5% agarose gel.

PCR for Porphyromonaslevii and Prevotella melaninogenica

The PCR analyses were performed at ThermoFisher Scientific Vantaa, Finland. Control (IP herd and IP free herd) and IP samples (n = 142) were analysed. All PCR reactions contained 0.5 μM of primers and 0.25 μM of probes in 20 μL of final PCR volume. QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific™) was used for thermal cycling. The thermal profile consisted of 95 °C for 10 min followed by 40 cycles of 95 °C for 5 s, and 60 °C for 1 min. In-house programs were applied to design qPCR oligo sequences for P. levii and P. melaninogenica used in this study (Table 2). Inclusivity and exclusivity were confirmed in silico using all RefSeq (NCBI Reference Sequence Database) bacterial genomes as reference sequence data.

Commercial genomic DNA (gDNA) stocks from P. melaninogenica DSM26980 and P. levii DSM23370 were measured using a Qubit Fluorometer (Qubit® 2.0 Fluorometer, Thermo Fisher Scientific™) and gDNA copy numbers were calculated using DNA Copy Number and Dilution Calculator (Thermo Fisher Scientific™). Both oligo sets were multiplexed with an internal amplification control (IAC) oligos and template DNA (eliminates false-negative results due to inhibition of the reaction) and compared to the singleplex reactions using a genomic DNA dilution series in triplicate. Amplification efficiency for both oligo sets was calculated from the multiplex reactions. No-template controls (NTC) were run with each multiplex to screen potential oligo cross-reactions. Sensitivity of the oligo sets was tested using a doubling dilution series of genomic DNA in 8 replicates. Specificity of both oligo sets was tested using the non-target panel of several bacteria. DNA samples were analysed with the two oligo sets using 2 μL of DNA. Positive controls and NTC’s were included into each run.

PCR for Treponema

The PCR analyses were performed at Denmark Technical University. Altogether 168 cytobrush samples had enough DNA for the analysis. An initial PCR step using a universal bacterial oligo pair encompassing most of the 16S rRNA gene [21] was followed by nested PCR analysis using oligos specific for the three DD Treponema phylogroups as described by Evans et al. [21] (Table 2). In all PCR assays, a 25 μL reaction mixture contained 1.25 U AmpliTaq DNA polymerase (Applied Biosystems, CA, USA), 1.5 mM (universal oligos) or 3 mM (group specific oligos) MgCl2 Solution (Applied Biosystems, USA), 100 μM of each dNTP (Amersham Biosciences, NJ, USA), 0.2 μM of each specific oligo, and 1 μL of the template in PCR Buffer II (Applied Biosystems, USA). Thermal cycling was performed in a T3 thermocycler (Biometra, Göttingen, Germany) as described by Evans et al. [21]. In each assay, water served as a negative control, and genomic DNA from each of the three Treponema groups as positive control. PCR products were separated on a 2% E-gel (Invitrogen, Carlsbad, 92,008 CA, USA), and visualized by UV fluorescence.

Bacterial controls

The following type strains were used as controls in the PCR assays: D. nodosus ATCC 25549, F. necrophorum ssp. necrophorum ATCC 25286, F. varium ATCC 8501, F. necrophorum ssp. funduliforme DSM 19678, T. pyogenes ATCC 19411D, P. levii (DSM23370) and P. melaninogenica (DSM26980), T. vincentii (ATCC 35580), T. phagedenis (ATCC 27087) and T. denticola (ATCC 3320). Our own Arcanobacterium haemolyticum isolate served as a negative control for T. pyogenes pyolysin.

Statistical analysis

The bacteriological results and data recorded during the herd visits were entered Excel spreadsheets and the statistical analyses were carried out using Stata IC version 15.0 (Stata Corporation, Texas, USA). A p-value of < 0.05 was considered statistically significant. The repeated samples were excluded from statistical analyses.

Two groups of cows served as controls in our study; control in IP free herd (n = 19) and in IP herd (n = 45), and were tested for statistical difference using chi square. All hoof samples were divided into four disease categories; 1) control, 2) acute IP, 3) healing IP, and 4) other hoof diseases. Antimicrobial treatments were divided into three categories; 1) no current or previous antimicrobial treatment during last month, 2) current antimicrobial treatment or treatment within 6 days before sampling and 3) previous treatment with antimicrobials within 7–30 days prior to the sampling. The outbreak herds (n = 19) were divided into two categories 1) herds of high morbidity; ≥50% of the cows having IP and 2) herds of moderate morbidity; 9–33% of the cows with IP during the first 2 months of the outbreak. No herds had morbidity between these figures.

The effect of antimicrobial treatment to each bacterium was tested separately with a logistic regression model. The dependent variable was each bacterium separately and independent variables were disease categories 1–4 and antimicrobial treatment categories 1–3. Herd was included as a random factor in these models.

The possible association of culture results of fusobacteria and IP were tested using chi-squared test. The possible association of bacteria in IP samples and high or moderate morbidity outbreak of IP were tested using Fisher exact test; only cows without antimicrobial treatment were included in the analysis.

We studied the association of disease categories and various bacteria (n = 6) in a multinomial logistic regression model. The herd had no effect on the results and was not included to the final model. The outcome of the model was disease categories (control, acute IP, healing IP) and variables were F. necrophorum, D. nodosus, T. pyogenes, Treponema, P. levii and P. melaninogenica (all dichotomous, no presence/presence). The group of other hoof diseases was excluded from this analysis.

Results

Association of Fusobacterium necrophorum isolates in different disease categories

F. necrophorum ssp. necrophorum was detected by culture in 48/65 (73.8%) of the samples from acute IP and in 26/41 (63.4%) from healing IP and was clearly associated with IP (p < 0.01) when both IP groups (n = 106) were combined and compared with controls (n = 64). All the F. necrophorum isolates, including both subspecies necrophorum and funduliforme, possessed the lktA gene. Figure 1 shows the prevalence of cultured fusobacteria in various disease categories; control cows (IP free herd, n = 19), control cows (IP herd, n = 45), acute IP (n = 65), healing IP (n = 41), other hoof diseases (n = 58).

Fig. 1.

Fig. 1

Detection of Fusobacterium necrophorum ssp. necrophorum and ssp. funduliforme by culture in hoof samples from various disease categories. Samples (n = 228) were collected from control cows (IP free herd, n = 19), control cows (IP herd, n = 45), acute interdigital phlegmon (Acute IP, n = 65), during the healing process of IP (Healing IP, n = 41) and from other hoof diseases than IP, including digital dermatitis, interdigital dermatitis, white line abscess and sole ulcer (Other, n = 58)

The group of other hoof diseases (n = 58) included samples from cases of DD, ID, sole ulcer and white line abscesses. In 20 DD samples, F. necrophorum ssp. necrophorum was detected in 7 (35.0%) samples. In other hoof diseases, including ID, white line abscesses and sole ulcers, ssp. necrophorum was detected in 11/38 (28.9%) of the samples.

Isolation of Fusobacterium necrophorum from repeated samples

The resampled hooves were culture negative for F. necrophorum ssp. necrophorum in a first sampling, but both were positive subsequently. One sample was positive at both samplings and seven samples were negative at the second sampling. One cow was sampled three times and after being positive for F. necrophorum ssp. necrophorum at the first sampling, it was negative at the second and positive at the third sampling. All cows except one were treated with antimicrobials between sampling times.

PCR results

We obtained PCR results for D. nodosus, F. necrophorum and T. pyogenes from 205 hoof cytobrush samples, P. levii and P. melaninogenica from 142 and Treponema from 168 samples. Figure 1 shows the number of successful PCR tests in each disease category. Of 168 Treponema samples, 93 (55.4%) were positive for universal Treponema primer. None of the samples was positive for Treponema group 1 (T. medium/ T. vincentii-like). However, 28/168 (16.7%) were positive for Treponema group 2 (T. phagedenis-like) and 16/168 (9.5%) for Treponema group 3 (T. putidum/ T. denticola-like). Treponema group 3 was always detected simultaneously with Treponema group 2. Of these 16 samples were 4 acute IP, 3 healing IP, 8 DD and 1 other hoof disease.

PCR results for control cows

D. nodosus was detected from 9/19 (47.4%) control cows (IP free herd) and 21/43 (48.8%) control cows (IP herd), F. necrophorum was detected in 0/19 (0%) and 4/43 (9.3%) of samples, P. levii in 1/19 (5.6%) and 3/41 (7.3%), P. melaninogenica in 0/19 (0%) and 2/41 (4.9%), Treponema group 2 and 3 in 4/19 (21.1%) and 6/42 (14.3%), and T. pyogenes in 1/19 (5.3%) and 0/43 (0%). No statistical differences were evident between the control groups regarding the bacteria detected and therefore data for each control group were combined for statistical analyses.

PCR results for samples of IP and other hoof diseases

Figure 2 presents the results of PCR analysis for various disease categories; control cows (n = 62), acute IP (n = 52), healing IP (n = 37), and other hoof diseases (n = 54). P. levii and P. melaninogenica were not analysed among the group of other hoof diseases. Several bacterial species were detected by PCR in numerous hoof samples (Table 3). The control cows were either PCR negative (26/59; 44.1%), or harboured D. nodosus alone (16/59; 27.1%) or in combination with Treponema group 2 and 3 (9/59; 15.3%). In most acute IP samples (24/36; 66.7%), F. necrophorum and D. nodosus were detected. They occurred with P. levii (4/36; 11.1%) or Treponema group 2 and 3 (4/36; 11.1%), and F. necrophorum alone was combined with T. pyogenes (4/36; 11.1%). For the healing stage of IP, the most frequently detected combinations were F. necrophorum and T. pyogenes (6/33, 18.2%), F. necrophorum alone (3/33; 9.1%) and F. necrophorum, T. pyogenes and P. levii (3/33, 9.1%).

Fig. 2.

Fig. 2

Detection of bacteria by PCR in hoof samples from various disease categories. The disease categories included; control cows (n = 62), acute interdigital phlegmon (Acute IP, n = 52), IP in a healing stage (Healing IP, n = 37) and other hoof diseases than IP (Other, n = 54). The group other hoof diseases included hoof samples from digital dermatitis, interdigital dermatitis, white line abscess and sole ulcer. Total number of hoof samples is 205, except with P. levii and P. melaninogenica (142) and Treponema group 2 and 3 (168)

Table 3.

Combinations of bacterial species detected by PCR in various disease categories in interdigital phlegmon outbreaks in Finnish dairy herds

Bacterial combination Control Acute IP Healing IP
n 59 36 33
No detected bacteria 26 2
P. melaninogenica 1
P. levii 3
Treponema a 1
T. pyogenes 1 1
D. nodosus 16 2
D. nodosus, P. melaninogenica 1
D. nodosus, Treponema 9 2
D. nodosus, Treponema, P. levii 1
D. nodosus, Treponema, T. pyogenes 1
F. necrophorum 1 3
F. necrophorum, P. melaninogenica 1
F. necrophorum, P. levii 1 2
F. necrophorum, Treponema 1 1
F. necrophorum, T. pyogenes 4 6
F. necrophorum, T. pyogenes, P. melaninogenica 2
F. necrophorum, T. pyogenes, P. levii 3
F. necrophorum, T. pyogenes, P. levii, P. melaninogenica 1
F. necrophorum, T. pyogenes, Treponema 1
F. necrophorum, D. nodosus 1 7 2
F. necrophorum, D. nodosus, P. melaninogenica 1
F. necrophorum, D. nodosus, P. levii 4
F. necrophorum, D. nodosus, P. levii, P. melaninogenica 1
F. necrophorum, D. nodosus, Treponema 4
F. necrophorum, D. nodosus, P. melaninogenica, Treponema 1 1
F. necrophorum, D. nodosus, T. pyogenes 2 2
F. necrophorum, D. nodosus, T. pyogenes, P. melaninogenica 1
F. necrophorum, D. nodosus, T. pyogenes, P. levii 1 1
F. necrophorum, D. nodosus, T. pyogenes, P. levii, P. melaninogenica 1
F. necrophorum, D. nodosus, T. pyogenes, Treponema 2 1
F. necrophorum, D. nodosus, T. pyogenes, P. levii, Treponema 1

aTreponema includes Treponema group 2 and 3

Various disease categories are control cows, interdigital phlegmon (IP) in an acute stage (Acute IP), and IP during a healing process (Healing IP). Total number of control and IP hoof samples is 128

Association of disease categories and bacterial species

We investigated the association of control samples, acute IP, and healing IP with the bacterial species detected by PCR (Table 4). F. necrophorum was associated distinctively with both stages of IP (p < 0.01). T. pyogenes was found more often with the healing IP (p = 0.01), but only a trend existed in the group of acute IP samples. Antimicrobial treatment affected detection of D. nodosus (current treatment OR = 0.2, p = 0.01, previous treatment OR = 0.1, p < 0.01) and Treponema group 2 and 3 (current treatment OR = 0.1, p < 0.01, previous treatment OR = 0.1, p = 0.03), but not detection of other bacteria.

Table 4.

The multinomial logistic regression model for the association of various disease categories and presence of bacteria in outbreaks of interdigital phlegmon in Finnish dairy herds

Disease categories n RRRa p-value 95% CIb
Control cows 59 Base outcome
Acute IP 36
Dichelobacter nodosus 2.1 0.36 0.44–9.88
Fusobacterium necrophorum 74.9 < 0.01 14.31–391.71
Porphyromonas levii 1.7 0.62 0.22–12.43
Prevotella melaninogenica 0.7 0.80 0.04–12.67
Treponemac 3.8 0.11 0.75–19.33
Trueperella pyogenes 10.8 0.06 0.91–127.48
 Constantd 0.04 < 0.01 0.01–0.15
Healing IP 33
Dichelobacter nodosus 0.4 0.26 0.08–1.95
Fusobacterium necrophorum 58.4 < 0.01 10.29–332.00
Porphyromonas levii 1.1 0.96 0.13–8.73
Prevotella melaninogenica 3.0 0.44 0.19–47.02
Treponemac 2.2 0.40 0.35–13.76
Trueperella pyogenes 22.4 0.01 2.01–249.04
 Constantd 0.08 < 0.01 0.02–0.25

aRRR = relative risk ratio

b95% CI = 95% confidence interval

cTreponema group 2 and 3

dConstant is a baseline relative risk for each outcome

The disease categories were control cows, acute interdigital phlegmon (Acute IP) and IP in a healing stage (Healing IP). The herd had no effect on the results. In this model, the number of the hoof samples is 128

Bacterial findings in high and moderate morbidity herds

Of 19 outbreak herds, in 7 herds the morbidity was high (morbidity ≥50% during first 2 months of the outbreak) and 12 herds moderate (morbidity 9–33%). No herds had morbidity of 34–49%. We found no differences in detected bacteria in control samples of herds of various morbidity. We focused on acute IP samples and compared their bacteriology between these 7 high morbidity herds and 12 moderate morbidity herds. Bacterial species detected by PCR in hoof samples from acute IP in high and moderate morbidity herds are presented in Fig. 3 and combinations of bacterial species detected in Table 5.

Fig. 3.

Fig. 3

PCR results for hoof samples from acute interdigital phlegmon (IP) in herds with various morbidity. We visited high morbidity (morbidity ≥50% during the first two months of the outbreak) and moderate morbidity (morbidity 9–33%) herds. Number of hoof samples is 52, except with P. levii and P. melaninogenica (n = 49) and Treponema (n = 39). Treponema includes Treponema group 2 and 3

Table 5.

Combinations of bacterial species detected by PCR in hoof samples from acute interdigital phlegmon (n = 36) in high morbidity (≥50%) and moderate morbidity (9–33%) Finnish dairy herds

Bacterial combination High Moderate
n 17 19
No detected bacteria 2
T. pyogenes 1
D. nodosus and Treponema a 1 1
D. nodosus, Treponema, P. levii 1
F. necrophorum 1
F. necrophorum, Treponema 1
F. necrophorum, T. pyogenes 1 3
F. necrophorum, D. nodosus 7
F. necrophorum, D. nodosus, P. levii 3 1
F. necrophorum, D. nodosus, P. levii, P. melaninogenica 1
F. necrophorum, D. nodosus, Treponema 4
F. necrophorum, D. nodosus, P. melaninogenica, Treponema 1
F. necrophorum, D. nodosus, T. pyogenes 2
F. necrophorum, D. nodosus, T. pyogenes, P. levii 1
F. necrophorum, D. nodosus, T. pyogenes, P. levii, P. melaninogenica 1
F. necrophorum, D. nodosus, T. pyogenes, Treponema 1 1
F. necrophorum, D. nodosus, T. pyogenes, P. levii, Treponema 1

aTreponema group 2 and 3

First, we analysed the association of culture results of fusobacteria in various morbidity herds. The presence of 2 F. necrophorum subspecies in acute IP samples from high (n = 31) and from moderate morbidity herds (n = 34) did not differ (p = 0.24); of these samples, no fusobacteria were detected in 9 (29.0%) samples from high and in 4 (11.8%) samples from moderate morbidity herds. Subspecies necrophorum was detected in 18 samples (58.1%) from high and in 22 (64.7%) samples from moderate morbidity, ssp. funduliforme in 2 samples from both morbidity groups (6.5 and 5.9% respectively), and both subspecies in 2 samples (6.5%) from high and in 6 (17.7%) from moderate morbidity herds. Subsequently we compared the association of other bacteria in various morbidity herds; presence of D. nodosus, F. necrophorum, P. levii, P. melaninogenica, Treponema group 2 and 3, and T. pyogenes detected by PCR in acute IP samples from high and moderate morbidity herds is presented in Fig. 3.

The most common combination, F. necrophorum and D. nodosus, was found in 14/17 (82.4%) samples of acute IP from high and 10/19 (52.6%) samples from moderate morbidity herds (Table 5). D. nodosus was more often detected in IP in high than moderate morbidity herds (p = 0.05, n = 35).

Discussion

F. necrophorum was found in this study as the main pathogen in IP. This is in line with previous studies [1012]. Based on our results, it was ssp. necrophorum that was clearly associated with IP. We also detected F. necrophorum in DD and in other hoof diseases, but less frequently than in IP. Similarly, fusobacteria are detected in DD lesions in other studies [22, 23].

F. necrophorum is a normal inhabitant in the rumen of cattle [24]. Occasionally, it can be detected in the faeces, and thus it contaminates the environment [25]. In a study of DD microbiome, small number of fusobacteria were detected on healthy hooves [26]. Similarly, in our study F. necrophorum ssp. necrophorum was not detected on the skin of healthy hooves, even when a severe IP outbreak was evident in the herd. This indicates that F. necrophorum does not colonize the intact skin in large numbers. A moist environment or possible trauma has been mentioned as predisposing factors for IP in previous studies [7, 27]. Interestingly, in most of our acute IP study cows no hoof trauma was visible. In most of the study herds the free stall was also reasonably new and well-managed. As a result, we can speculate that F. necrophorum may have to interact with other bacteria to invade to the subcutaneous tissue in the interdigital cleft.

Unexpectedly in repeated sampling, fusobacteria were cultivated from IP lesions even though cows had been treated with antimicrobials and IP was at the healing stage. The clinical signs appeared to diminish after beginning of antimicrobial treatment, but F. necrophorum remained in the affected region. However, our bacteriological methods were not quantitative and therefore, we do not know the number of detected bacteria and whether the amount had diminished or not. In a small pilot study of outbreaks of IP in two herds, susceptibility of 27 F. necrophorum isolates to penicillin, tetracycline, cefuroxime and cefotaxime was determined by E-test. All isolates were found susceptible to tested antimicrobials [28]. Also other study reports that antimicrobial resistance is not characteristic of F. necrophorum in IP [29].

We detected D. nodosus from healthy hooves, IP and other hoof diseases. In most of the acute IP samples (66.7%), both F. necrophorum and D. nodosus were detected. A significant association was established with the presence of D. nodosus in IP lesions and high morbidity outbreak in the herd. This could indicate that the presence of D. nodosus affects the severity of IP. D. nodosus is associated with ID [30] and DD [3033] and detected in healthy hooves [30]. It is hypothesised that D. nodosus could break down the epidermal barrier, creating a suitable environment for secondary invaders [32]. A recent study also suggests D. nodosus as a potentially important pathogen in DD [23]. Our qualitative investigation does not take account of the numbers of bacteria, which might differ in IP lesions compared with healthy hooves.

P. levii and T. pyogenes are detected with F. necrophorum in various cattle infections and evidence of interactions and possible synergism between these species is reported [3437]. IP is induced using field strains of F. necrophorum and B. melaninogenicus [11]; the latter is reclassified as several Porphyromonas and Prevotella species [20]. Moreover, in other studies these bacteria are detected in IP samples [17, 18]. In addition to IP, P. levii is detected in DD lesions [22] and in an outbreak of necrotic vulvovaginitis [38]. Also, T. pyogenes is reported to occur in IP lesions [7, 11, 18]. In our study T. pyogenes was associated with a healing stage of IP and only a trend existed with acute IP, indicating that this pathogen has a secondary role in IP. Nevertheless, we were unable to establish an association between high morbidity and P. levii or T. pyogenes.

There are very few studies of the occurrence of treponemes in IP, but many concerning DD. Earlier studies revealed occurrence of Spirochetes in IP lesions [5, 7] but it remains uncertain whether the organisms were treponemes or not. Treponemes are regarded as the most important pathogens in DD [19, 22, 26, 39], and have been detected also in other hoof lesions, including toe necrosis, sole ulcer and white line disease [40, 41]. In our study, we detected Treponema group 2 and 3 in all disease categories, but more frequently in IP and in other hoof diseases; mainly DD. Interestingly all observed DD lesions were detected in herds of moderate morbidity (data not shown). To date ID and DD are not represented a major problem of cattle in Finland [42].

Of 217 cows sampled, 66 (30.4%) were currently being or had previously been treated with antimicrobials. It would have been unethical to leave the affected cows untreated until the sampling visit took place. Nevertheless, the possible effect of an antimicrobial treatment was taken into account in the analysis.

Conclusion

In the current study, we investigated several bacteria in new type of outbreaks of IP and possible bacterial dissimilarities in herds with various morbidity. We could detect all studied bacteria in IP lesions either alone or in various combinations but observed bacteriological differences in herds with various morbidity. The most substantial finding was the presence of F. necrophorum in IP lesions, and T. pyogenes at the healing stage of IP. Our results also suggest that D. nodosus may play a role in the severity of the outbreak of IP. It is also quite apparent that a correct diagnosis of IP cannot be made based on a single bacteriologic sample without a clinical inspection.

Virulence factors of F. necrophorum isolates and transmission of hoof pathogens among and within farms may represent an important subject that merits further research.

Acknowledgements

The authors thank the study farms and veterinarians, hoof trimmers and others who helped during the farm visits, Taina Lehto and Merja Pöytäkangas at the University of Helsinki for DNA isolation and Tiina Karla, Milja Tikkanen and Laura Vaahtoranta at Thermo Fisher Scientific Vantaa for PCR analysis of Porphyromonas and Prevotella species.

Funding

This study was financially supported by the Ministry of Agriculture and Forestry project (2066/312/2011) for infectious hoof diseases in new free stalls in Finland. Valio Ltd., the Mercedes Zachariassen Foundation, the Finnish Foundation of Veterinary Research and Helsinki University doctoral programme in Clinical Veterinary Medicine are acknowledged for their financial support in the analysis and interpretation of data and the writing of the manuscript.

Availability of data and materials

The datasets analyzed during this study are available from the corresponding author on reasonable request.

Abbreviations

DD

Digital dermatitis

ID

Interdigital dermatitis

IP

Interdigital phlegmon

Authors’ contributions

All authors participated in planning the study. MK, RJ, HS and MKW took the hoof samples. EM, ES and KK performed the cultivation and PCR of the study samples. MK and HS performed the statistical analyses and MK drafted the manuscript. All authors commented, read and approved the final manuscript.

Ethics approval and consent to participate

Our study protocol was reviewed and approved by the Viikki Campus Research Ethics Committee of Helsinki University in 2012. A written informed consent to use the animals in our study was obtained from the owners of the study herds before sampling.

Consent for publication

Not applicable

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Miia Kontturi, Email: miia.kontturi@helsinki.fi.

Reijo Junni, Email: reijo.junni@gmail.com.

Heli Simojoki, Email: heli.simojoki@helsinki.fi.

Erja Malinen, Email: erja.malinen@welho.com.

Eija Seuna, Email: eijaseuna@gmail.com.

Kirstine Klitgaard, Email: kksc@vet.dtu.dk.

Minna Kujala-Wirth, Email: minna.j.kujala@helsinki.fi.

Timo Soveri, Email: timo.soveri@helsinki.fi.

Sinikka Pelkonen, Email: sinikka.pelkonen@foodauthority.fi.

References

  • 1.Häggman J, Junni R, Simojoki H, Juga J, Soveri T. The costs of interdigital phlegmon in four loose-housed Finnish dairy herds. Acta Vet Scand. 2015;57:90. doi: 10.1186/s13028-015-0181-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.DeFrain JM, Socha MT, Tomlinson DJ. Analysis of foot health records from 17 confinement dairies. J Dairy Sci. 2013;96:7329–7339. doi: 10.3168/jds.2012-6017. [DOI] [PubMed] [Google Scholar]
  • 3.Oberbauer AM, Berry SL, Belanger JM, McGoldrick RM, Pinos-Rodriquez JM, Famula TR. Determining the heritable component of dairy cattle foot lesions. J Dairy Sci. 2013;96:605–613. doi: 10.3168/jds.2012-5485. [DOI] [PubMed] [Google Scholar]
  • 4.David GP. Severe foul-in-the-foot in dairy cattle. Vet Rec. 1993;132:567–568. doi: 10.1136/vr.132.22.567. [DOI] [PubMed] [Google Scholar]
  • 5.Doherty M, Bassett H, Markey B, Healy A, Sammin D. Severe foot lameness in cattle associated with invasive spirochaetes. Ir Vet J. 1998;1:195–198. [Google Scholar]
  • 6.Van Metre DC. Pathogenesis and treatment of bovine foot rot. Vet Clin N Am-Food A 2017; 33:183–194. [DOI] [PubMed]
  • 7.Gupta RB, Fincher MG. Bruner DW. A study of the etiology of foot-rot in cattle. Cornell Vet. 1964;54:66–77. [PubMed] [Google Scholar]
  • 8.Hernandez J, Shearer JK, Webb DW. Effect of lameness on milk yield in dairy cows. J Am Vet Med Assoc. 2002;220:640–644. doi: 10.2460/javma.2002.220.640. [DOI] [PubMed] [Google Scholar]
  • 9.Booth CJ, Warnick LD, Gröhn YT, Maizon DO, Guard CL, Janssen D. Effect of lameness on culling in dairy cows. J Dairy Sci. 2004;87:4115–4122. doi: 10.3168/jds.S0022-0302(04)73554-7. [DOI] [PubMed] [Google Scholar]
  • 10.Flint JC, Jensen R. Pathology of necrobacillosis of the bovine foot. Am J Vet Res. 1951;12:5–13. [PubMed] [Google Scholar]
  • 11.Berg JN, Loan RW. Fusobacterium necrophorum and Bacteroides melaninogenicus as etiologic agents of foot rot in cattle. Am J Vet Res. 1975;36:1115–1122. [PubMed] [Google Scholar]
  • 12.Clark BL, Stewart DJ, Emery DL. The role of Fusobacterium necrophorum and Bacteroides melaninogenicus in the aetiology of interdigital necrobacillosis in cattle. Aust Vet J. 1985;62:47–49. doi: 10.1111/j.1751-0813.1985.tb14232.x. [DOI] [PubMed] [Google Scholar]
  • 13.Tan ZL, Nagaraja TG, Chengappa MM. Fusobacterium necrophorum infections: virulence factors, pathogenic mechanism and control measures. Vet Res Commun. 1996;20:113–140. doi: 10.1007/BF00385634. [DOI] [PubMed] [Google Scholar]
  • 14.Oelke A, Nagaraja TG, Wilkerson MJ, Stewart GC. The leukotoxin operon of Fusobacterium necrophorum is not present in other species of Fusobacterium. Anaerobe. 2005;11:123–129. doi: 10.1016/j.anaerobe.2004.10.003. [DOI] [PubMed] [Google Scholar]
  • 15.Zhou H, Bennett G, Hickford JGH. Variation in Fusobacterium necrophorum strains present on the hooves of footrot infected sheep, goats and cattle. Vet Microbiol. 2009;135:363–367. doi: 10.1016/j.vetmic.2008.09.084. [DOI] [PubMed] [Google Scholar]
  • 16.Lechtenberg K, Nagaraja T, Leipold H, Chengappa MM. Bacteriologic and histologic studies of hepatic abscesses in cattle. Am J Vet Res. 1988;49:58–62. [PubMed] [Google Scholar]
  • 17.Morck DW, Olson ME, Louie TJ, Koppe A, Quinn B. Comparison of ceftiofur sodium and oxytetracycline for treatment of acute interdigital phlegmon (foot rot) in feedlot cattle. J Am Vet Med Assoc. 1998;212:54. [PubMed] [Google Scholar]
  • 18.Sweeney M, Watts J, Portis E, Lucas M, Nutsch R, Meeuwse D, Bade D, Oliver V, Morc D, Shinabarger D, Poppe S, Peterson M, Sweeney D, Knechtel M, Zurenko G. Identification of Porphyromonas levii isolated from clinical cases of bovine interdigital necrobacillosis by 16S rRNA sequencing. Vet Ther. 2009;10:4. [PubMed] [Google Scholar]
  • 19.Döpfer D, Koopmans A, Meijer FA, Szakáll I, Schukken YH, Klee W, Bosma RB, Cornelisse JL, van Asten AJAM, ter Huurne AAHM. Histological and bacteriological evaluation of digital dermatitis in cattle, with special reference to spirochaetes and Campylobacter faecalis. Vet Rec. 1997;140:620–623. doi: 10.1136/vr.140.24.620. [DOI] [PubMed] [Google Scholar]
  • 20.Jousimies-Somer H, Summanen P. Recent taxonomic changes and terminology update of clinically significant anaerobic gram-negative Bacteria (excluding spirochetes) Clin Infect Dis. 2002;35(Suppl 1):S21. doi: 10.1086/341915. [DOI] [PubMed] [Google Scholar]
  • 21.Evans N, Brown J, Demirkan I, Singh P, Getty B, Timofte D, Daan Vink W, Murray R, Blowey R, Birtles R, Hart C, Carter S. Association of Unique, isolated Treponemes with bovine digital dermatitis lesions. J Clin Microbiol. 2009;47:689–696. doi: 10.1128/JCM.01914-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Nielsen MW, Strube ML, Isbrand A, Al-Medrasi WDHM, Boye M, Jensen TK, Klitgaard K. Potential bacterial core species associated with digital dermatitis in cattle herds identified by molecular profiling of interdigital skin samples. Vet Microbiol. 2016;186:139–149. doi: 10.1016/j.vetmic.2016.03.003. [DOI] [PubMed] [Google Scholar]
  • 23.Moreira T, Filho E, Carvalho A, Strube M, Nielsen M, Klitgaard K, Jensen T. Pathology and bacteria related to digital dermatitis in dairy cattle in all year round grazing system in Brazil. PLoS One. 2018;3:13. doi: 10.1371/journal.pone.0193870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Robinson TJ, Jasper DE, Guilbert HR. The isolation of Spherophorus necrophorus from the rumen together with some feed lot data on abscess and telangiectasis. J Anim Sci. 1951;10:733–741. doi: 10.2527/jas1951.103733x. [DOI] [Google Scholar]
  • 25.Smith GR, Thornton EA. Effect of disturbance of the gastrointestinal microflora on the faecal excretion of Fusobacterium necrophorum biovar a. Epidemiol Infect. 1993;110:333–337. doi: 10.1017/S0950268800068278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Johnson DW, Dommert AR, Kiger DG. Clinical investigations of infectious foot rot of cattle. J Am Vet Med Assoc. 1969;155:1886–1891. [PubMed] [Google Scholar]
  • 27.Junni R, Kontturi M, Seuna E, Kujala M, Simojoki H, Malinen E, Pekkanen K, Pelkonen S & Soveri T. Outbreaks of interdigital phlegmon in Finland. Proceedings of the 17th international symposium and 9th international conference on lameness in ruminants, Bristol, UK. 2013;59.
  • 28.Bergsten C, Jansson Mörk M, Pringle M, Persson Y. Can interdigital phlegmon (foot rot) be treated without antibiotics? Proceedings of the 19th international symposium and 11th international conference on lameness in ruminants, Munich, Germany 2017;315.
  • 29.Knappe-Poindecker M, Gilhuus M, Jensen TK, Klitgaard K, Larssen RB, Fjeldaas T. Interdigital dermatitis, heel horn erosion, and digital dermatitis in 14 Norwegian dairy herds. J Dairy Sci. 2013;96:7617–7629. doi: 10.3168/jds.2013-6717. [DOI] [PubMed] [Google Scholar]
  • 30.Capion N, Boye M, Ekstrøm CT, Jensen TK. Infection dynamics of digital dermatitis in first-lactation Holstein cows in an infected herd. J Dairy Sci. 2012;95:6457–6464. doi: 10.3168/jds.2012-5335. [DOI] [PubMed] [Google Scholar]
  • 31.Rasmussen M, Capion N, Klitgaard K, Rogdo T, Fjeldaas T, Boye M, Jensen TK. Bovine digital dermatitis: possible pathogenic consortium consisting of Dichelobacter nodosus and multiple Treponema species. Vet Microbiol. 2012;160:151–161. doi: 10.1016/j.vetmic.2012.05.018. [DOI] [PubMed] [Google Scholar]
  • 32.Sullivan LE, Evans NJ, Blowey RW, Grove-White DH, Clegg SR, Duncan JS, Carter SD. A molecular epidemiology of treponemes in beef cattle digital dermatitis lesions and comparative analyses with sheep contagious ovine digital dermatitis and dairy cattle digital dermatitis lesions. Vet Microbiol. 2015;178:77–87. doi: 10.1016/j.vetmic.2015.04.011. [DOI] [PubMed] [Google Scholar]
  • 33.Ruder CA, Sasser RG, Williams RJ, Ely JK, Bull RC, Butler JE. Uterine infections in the postpartum cow: II. Possible synergistic effect of Fusobacterium necrophorum and Corynebacterium pyogenes. Theriogenology. 1981;15:573–580. doi: 10.1016/0093-691X(81)90060-1. [DOI] [Google Scholar]
  • 34.Nagaraja TG, Beharka AB, Chengappa MM, Carroll LH, Raun AP, Laudert SB, Parrott JC. Bacterial flora of liver abscesses in feedlot cattle fed tylosin or no tylosin. J Anim Sci. 1999;77:973. doi: 10.2527/1999.774973x. [DOI] [PubMed] [Google Scholar]
  • 35.Kan IY, Blum S, Elad D. Synergism between Porphyromonas levii and Arcanobacterium pyogenes in a murine abscess model. Isr J Vet Med. 2009;64:62–65. [Google Scholar]
  • 36.Karstrup CC, Pedersen HG, Jensen TK, Agerholm JS. Bacterial invasion of the uterus and oviducts in bovine pyometra. Theriogenology. 2017;93:93–98. doi: 10.1016/j.theriogenology.2017.01.027. [DOI] [PubMed] [Google Scholar]
  • 37.Elad D, Friedgut O, Alpert N, Stram Y, Lahav D, Tiomkin D, Avramson M, Grinberg K, Bernstein M. Bovine necrotic Vulvovaginitis associated with Porphyromonas levii. Emerg Infect Dis. 2004;10:505–507. doi: 10.3201/eid1003.020592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Klitgaard K, Boye M, Capion N, Jensen T. Evidence of multiple Treponema phylotypes involved in bovine digital dermatitis as shown by 16S rRNA gene analysis and fluorescence in situ hybridization. J Clin Microbiol. 2008;46:3012–3020. doi: 10.1128/JCM.00670-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Zinicola M, Lima F, Lima S, Machado V, Gomez M, Döpfer D, Guard C, Bicalho R. Altered microbiomes in bovine digital dermatitis lesions, and the gut as a pathogen reservoir. PLoS One. 2015;10:3. doi: 10.1371/journal.pone.0120504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Evans NJ, Blowey RW, Timofte D, Isherwood DR, Brown JM, Murray R, Paton RJ, Carter SD. Association between bovine digital dermatitis treponemes and a range of 'non-healing' bovine hoof disorders. Vet Rec. 2011;168:214. doi: 10.1136/vr.c5487. [DOI] [PubMed] [Google Scholar]
  • 41.Sykora S, Kofler J, Glonegger-Reichert J, Dietrich J, Auersperg G, Brandt S. Treponema DNA in bovine ‘non-healing’ versus common sole ulcers and white line disease. Vet J. 2015;205:417–420. doi: 10.1016/j.tvjl.2015.05.023. [DOI] [PubMed] [Google Scholar]
  • 42.Kontturi M, Kujala M, Junni R, Malinen E, Seuna E, Pelkonen S, Soveri T, Simojoki H. Survey of interdigital phlegmon outbreaks and their risk factors in free stall dairy herds in Finland. Acta Vet Scand. 2017;59:1. doi: 10.1186/s13028-017-0313-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Moore LJ, Wassink GJ, Green LE, Grogono-Thomas R. The detection and characterization of Dichelobacter nodosus from cases of ovine footrot in England and Wales. Vet Microbiol. 2005;108:57–67. doi: 10.1016/j.vetmic.2005.01.029. [DOI] [PubMed] [Google Scholar]
  • 44.Ludlam H, Milner N, Brazier J, Davies I, Perry K, Marriott R, Donachie L, Curran M. lktA-encoded leukotoxin is not a universal virulence factor in invasive Fusobacterium necrophorum infections in animals and man. J Med Microbiol. 2009;58:529–530. doi: 10.1099/jmm.0.005231-0. [DOI] [PubMed] [Google Scholar]
  • 45.Aliyu S, Marriott R, Curran MD, Parmar S, Bentley N, Brown N, Brazier J, Ludlam H. Real-time PCR investigation into the importance of Fusobacterium necrophorum as a cause of acute pharyngitis in general practice. J Med Microbiol. 2004;53:1029–1035. doi: 10.1099/jmm.0.45648-0. [DOI] [PubMed] [Google Scholar]
  • 46.Silva E, Gaivão M, Leitão S, Jost BH, Carneiro C, Vilela CL, Lopes da Costa L, Mateus M. Genomic characterization of Arcanobacterium pyogenes isolates recovered from the uterus of dairy cows with normal puerperium or clinical metritis. Vet Microbiol. 2008;132:111–118. doi: 10.1016/j.vetmic.2008.04.033. [DOI] [PubMed] [Google Scholar]
  • 47.Frank JA, Reich CI, Sharma S, Weisbaum JS, Wilson BA, Olsen GJ. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl Environ Microbiol. 2008;74:2461–2470. doi: 10.1128/AEM.02272-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Rurangirwa F, Dilbeck P, Crawford T, McGuire T, McElwain T. Analysis of the 16S rRNA gene of micro-organism WSU 86-1044 from an aborted bovine foetus reveals that it is a member of the order Chlamydiales: proposal of Waddliaceae fam. Nov., Waddlia chondrophila gen. Nov., sp. nov. Int J Syst Bacteriol. 1999;49:577–581. doi: 10.1099/00207713-49-2-577. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets analyzed during this study are available from the corresponding author on reasonable request.


Articles from BMC Veterinary Research are provided here courtesy of BMC

RESOURCES