Skip to main content
NCBI home page
Physiology and Molecular Biology of Plants logoLink to Physiology and Molecular Biology of Plants
. 2018 Nov 28;25(1):263–275. doi: 10.1007/s12298-018-0626-0

Profiling of indole metabolic pathway in thermo-sensitive Bainong male sterile line in wheat (Triticum aestivum L.)

Qing Su 1,2, Jing Yang 1, Qing Yun Fu 1, Fei Yun Jia 1, Suo Ping Li 2, Yong Li 1,3, You Yong Li 1,✉
PMCID: PMC6352539  PMID: 30804648

Abstract

Bainong male sterile (BNS) wheat (Triticum aestivum L.) is a thermo-sensitive genic male sterile line with excellent sterility and self-restoration. We focused on transcriptional profiles of differentially expressed probes between BNS sterile and fertile anthers. Anthers, rachis and spikes from sterile line and fertile line were collected. Extracted RNA was assayed using wheat expression microarray and Gene Ontology was analyzed using Cytoscape with ClueGO. An indole (indole-3-acetic acid: IAA) metabolism pathway sub-network was almost formed in all differentially expressed profiles between sterile and fertile samples. IAA sub-network contained four nodes of indole and alkaloid metabolism connecting main network via indole compounds. This sub-network was absent in rachis and intact in transformed fertile anthers, which was the main differently expressed metabolism pathway in F1 anthers with restorer genes. Alkaloid metabolism was absent in sterile anthers. Abnormal metabolism of IAA may be involved in BNS sterility. BNS transformation may be regulated by the production of IAA and alkaloid metabolism pathway, which favor the safe utilization of the sterile line in hybrid wheat production.

Electronic supplementary material

The online version of this article (10.1007/s12298-018-0626-0) contains supplementary material, which is available to authorized users.

Keywords: Alkaloid metabolism, BNS male sterility, Gene expression microarray, IAA metabolism, Wheat

Introduction

Plant male sterile lines are the core materials for the utilization of heterosis. There are three main types of male sterile lines that can be used for wheat breeding and hybrid seed production. The first is three-line system, originated from cytoplasm-nucleus interaction male sterility (CMS). The second is two-line system, from photo-thermo-sensitive male sterility (PTGMS), and the third is chemical hybrid male sterility (CHM) treated with chemical androgenicides (Murai et al. 2008). Among them, the two-line system is the most valuable line for hybrid wheat production. It is a simplified system, with rich genetic background, and plump seeds of F1 (Murai et al. 2008; Singh et al. 2015; Zhao 2010).

A series of two-line system male sterile lines were found and applied in recent 20 years in China (Li et al. 2006, 2009, 2011a; Zhang et al. 2006; Zhao 2010). BNS is a thermo-sensitive genic male sterile line with good sterility and good self-conversion. Its F1 displays strong heterosis when it crosses with special father varieties (Fan et al. 2015; Li et al. 2009; Ma et al. 2013; Ning et al. 2011; Zhang et al. 2013a; Zhou et al. 2010). The characteristics of sterility, transformation and restoration of BNS have been observed systematically, and the genetic mechanisms have also been preliminarily studied (Fan et al. 2015; Ma et al. 2013; Ning et al. 2011; Sun et al. 2016; Zhang et al. 2013a), but its physiological mechanisms are seldom reported.

The occurrence and physiological mechanism of PTGMS were reported frequently in crops such as rice and rapeseed. It is generally believed that environmental factors such as light and temperature induced sterile gene expression at a certain stage of anther development, which changed the metabolism pathway and led to pollen abortion (Pan et al. 2014; Ulmasov et al. 1997; Zhao et al. 1996). In this process, plant hormones are considered to be the important mediators. The content levels of Indole-3-acetic acid (IAA), gibberellic acid (GA3), abscisic acid (ABA), and zeatin riboside (ZR) and so on, especially IAA, showed significant changed in a variety of plant male sterile lines. For example, rice Nongken 58S is a photo-thermo-sensitive male sterile line, its photo-sensitive organ was leaf, and IAA mediated the information from leaf to anther (Li et al. 2000). The recessive sterility site (ms33) of Arabidopsis thaliana could induce male sterility, accompanied with reducing indoxe-3-butyric acid and endogenous GA3 (Fei et al. 2004). The concentration of endogenous IAA, IBA and GA3 in two-line hybrid wheat C49S decreased significantly during the development of young ear (Zhang et al. 2001). The content of IAA in leaves and anthers of sterile BNS also significantly decreased when it differentiated from pistil to trinucleus (Zhang et al. 2016, 2013b). It suggests that the occurrence of male sterility in plant may be closely related to indole metabolism.

One of the risks of the utilization of the two-line hybrid wheat is that abnormal meteorological conditions for fertility transformation may lead to the increase of self-fertilization rate (Du et al. 2016; Qin et al. 2018) and would reduce the purity of hybrid wheat seeds, which could cause a fatal event for hybrid wheat production. For safely using of two-line male sterile system, it is necessary to control fertility conversion by artificial means with physiology mechanism and more research on metabolism in male sterility is indispensable.

Transcription microarray is a high throughput tool for differently expressed genes filtering and analysis (Daraselia et al. 2007; Hu et al. 2016; Meng et al. 2017). We used expression profile database and protein profile database to analyze metabolic pathway changes directly. In order to study the physiological mechanism of BNS sterility, anthers and rachis tissue were collected from typical sterile plants and fertile plants. Differentially expressed genes between different groups were detected by Affymetrix microarray, and metabolic pathways involved in the differentially expressed genes were analyzed. Our study may benefit the mechanism understanding and applying of sterility of BNS in wheat breeding.

Materials and methods

Sterile line materials

BNS line is an original male sterile line in our laboratory. It is planted and preserved by bagged every year in Huixian wheat breeding base of Henan province (China). BNS wheat develops into male sterility when it is sowed from October 1st to 10th in local area. The percentage of fertile pollen gradually increases after October 10th. The self-setting rate of the line reaches the highest when it is sowed around November 10th (Du et al. 2016; Qin et al. 2018). The BNS in our experiment was sown from October 1st to November 17th once every 8 days and 7 times in total. In order to compare the difference between temperature restoring fertility by BNS itself and restoring fertility by restoring gene, a combination of “BNS × Chinese Spring” was set up last year. Chinese Spring is a high restorer line of BNS. F1 of “BNS × Chinese Spring” was normally fertile even it was sowed in October 9th which is the typical sterile sowing date of BNS, and also is the local wheat sowing date. The planting pattern in the field was 3 m for row length and 0.23 m for row width, and the distance between two plants was 0.13 m. Two rows were planted and were separated by one empty row, which provided big space for plants growth and development.

Sampling

Sterile samples were collected from BNS sowed on 1st October, and fertile samples were collected from BNS sowed on 18th November, and F1 samples were collected from F1sowed on 9th October. The sampling time was determined according to the stage of panicle differentiation. The number, sampling date, and panicle differentiation stage of all samples were shown in Table 1. The sampling method was as following: the ears were collected at 7 am in field, and then they were taken to laboratory to be checked the microspore development stage under general microscope. The anthers of normally developed stage were peeled from spikes on ice bag, and were collected as anther samples. Then they were weighted, frozen for 1 min in liquid nitrogen and transferred to − 72° for storage. The ears whose spikes were removed were rachis samples which were weighed, frozen and preserved.

Table 1.

Details of 9 samples

Samples Sowing date Development stage and organ Sampling date
Spike1 9th October Spike in anther differentiation stage 20th March
Ste-anther 9th October Anther of tetrad stage, sterile plant 1st April
Ste-rachis 9th October Rachis of tetrad stage, sterile plant 1st April
Fer-anther 17th November Anther of tetrad stage, fertile plant 10th April
Fer-rachis 17th November Rachis of tetrad stage, fertile plant 10th April
F1-anther 9th October Anther of tetrad stage, F1 plant 1st April
F1-rachis 9th October Rachis of tetrad stage, F1 plant 1st April
Ste-mono 9th October Anther of mononucleate stage, sterile plant 3th April
Fer-mono 17th November Anther of mononucleate stage, fertile plant 12th April
Open in a new tab

Spike1 spike in anther differentiation stage, Ste-anther anther of tetrad stage, sterile plant, Ste-rachis rachis of tetrad stage, sterile plant, Fer-anther anther of tetrad stage, fertile plant, Fer-rachis rachis of tetrad stage, fertile plant, F1-anther anther of tetrad stage, F1 plant, F1-rachis rachis of tetrad stage, F1 plant, Ste-mono anther of mononucleate stage, sterile plant, Fer-mono anther of mononucleate stage, fertile plant

Microarray hybridization and analysis

Total RNA was extracted using Trizol method according to the manufacturer instruction (Invitrogen, USA). Each tissue sample of 100 mg was grinded in mortar with liquid nitrogen and 1 ml Trizol reagent was added. Equal volume chloroform was added and centrifuged at 2700 g 4 °C for 20 min. Supernatant was transferred to an equal volume isopropanol tube and oscillating mixed followed by stewing for 10 min at room temperature. After centrifuging at 2700 g 4 °C for 20 min, 70% ethanol was added into the treated RNA and centrifuged at 2700 g for 5 min. Dried RNA was dissolved by 32 µl DEPC water (Diethy pyrocarbonate, Promega, USA). RNA concentration and integrity were assayed using spectrometer NanoDrop (Thermo Scientific, USA) and Agilent 2100 bioanalyser (Agilent, USA).

Affymetrix Wheat Genome Array was designed based on the database of GeneBank and dbEST which contained 61127 probe sets representing 55052 transcripts (http://www.affymetrix.com/estore/). Wheat RNA samples were labeled, hybridized (Shanghai Yeslab Biotechnology, China) and scanned using the GeneChip Scanner 3000 (Affymetrix, Santa Clara, CA USA) according to the manufactures instruction. Array images were scanned and analyzed by Affymetrix Microarray Suite (MAS, version 5.0) and signal intensity of probes were normalized using Robust Multi-array normalization algorithm method (RMA, GeneSpring GX v11.5, Agilent). The cut-off of false discovery rate (FDR) was set as 0.05. The log2 Ratio of differently expressed genes were analyzed by method of paired error weighted mean and significance cut off value was log2(Ratio) > = 1 (value >=2).

Validation of differently expressed genes by qRT-PCR

Validation of differently expressed genes was performed using qRT-PCR method (Crismani et al. 2006). Genes of ATP1, Hsp23.5, Aldehyde dehydrogenase ALDH2 and malate dehydrogenase CMDH were selected for expression analysis because they differently expressed both in previous proteome research (Li et al. 2011b, 2015; Su et al. 2013) and present microarray results. The primers of 4 detected genes were: atp1 primer F TTCCGCGATAATGGAATGCACGCA, R AGCTACCTGCACCTGTCTGGTCCG; hsp23.5 primer F GCACCTCGATGCGGCGGTTGTACT, R AGGACGACGACGCGGTGTACCTCA; cmdh primer: F TGGTGCAGACCAGCCTGTTATTCT, R CCGCAACATTCACACCAGTGCAGGCC; aldh2 primer: F TTTCACCAACAACCTGGACACGGC, R CTCCCTACCGATGCCGCTCATCTT. Samples of Ste-anther, Ste-rachis, F1-anther, F1-rachis, Ste-mono, Fer-mono were performed by qRT-PCR with a housekeeping genes glyceraldehyde phosphate dehydrogenase (GAPDH) as reference gene on a real time PCR instrument (Roche LightCycler 480 PCR) (Li et al. 2015). The primers of GAPDH were F CCCTCAGACTCCTCCTTGATAGC, R TGACTGCAACCCAGAAGACTGTT.

Metabolism analysis

There were 9 samples in total. Sample Spike1 was young ears with un-differentiated floret. Florets had differentiated in other 8 samples. These 8 samples consisted of 4 pairing materials. Comparisons of each pair could imply different meanings. Ste-anther and Ste-rachis indicated anther and non-anther tissue of sterile BNS. Fer-anther and Fer-rachis indicated anther and non-anther tissue of fertile converted by BNS itself. F1-anther and F1-rachis originated from the F1 of “BNS × China Spring”. The plant development of F1 was also fertile under the condition of sterility, therefore, the difference between F1-anther and F1-rachis was that between anther and non-anther tissues with dominant restore gene. Ste-mono and Fer-mono indicated sterile and fertile anther tissue that developed at the stage of mononucleate. More information could be acquired from these materials based on more samples comparisons. For examples, more genes and metabolic differentially expressed information could be obtained when the undifferentiated floret Spike1 was compared with the anther, rachis and other samples.

Differently expressed genes (DEGs) in each paired samples were obtained according to the cut off value ≥ 2 based on normalized intension of each probes (fold change = 2(normalized intension 1 − normalized intension 2)). GO (Gene Ontology) and pathway analysis were performed using Cytoscape 3.5.1 platform with a plug of ClueGO 2.3.1 (Bindea et al. 2009), (http://www.ici.upmc.fr/cluego/cluegoDescription.shtml). Affymetrix probe ID were inputted into the ClueGo software and searched against wheat database. GO analysis was focused on the biological process and network of metabolism were analyzed on differently expressed genes (Shannon et al. 2003).

Results

Microarray analysis and hybridization quality evaluation

GeneSpring GX software (Agilent, USA) was employed to normalize the microarray results using RMA method by loading the CEL files of array. Valid probes of 15720 were acquired by RMA randomized method. Quantitative PCR results showed that the expression tendency of four genes Hsp23.5, ALDH, CMDH and ATP1 were high consistent with microarray, and the expression level (ΔΔCt) of four genes in above two methods was also close (Fig. 1). The coincident results implied that the microarray results were reliable.

Fig. 1.

Fig. 1

Open in a new tab

Relative expression level (ΔΔCt) of four genes using microarray and qRT-PCR assay. Bar graph represented the relative expression of four genes. Up regulated genes were displayed above the X axis and down regulated genes were displayed down the X axis

Metabolism analysis of differently expressed probes

The expression probfling of 15732 probes between the paired samples, different tissues (anther and rachis), and different developmental stages (early and late anther) were analyzed. The details of up and down regulated probes between paired samples were summarized in Table 2. The chip probe set signal was normalized, followed by calculating with formula of 2^− (normalized expression level 1- normalized expression 2), and the count of up-regulated probes was approximately equal to the down-regulated probes. In Table 2, only the counts of up-regulated or down regulated probes involved in IAA pathway were showed.

Table 2.

Differently expressed genes over two fold-change between paired samples involved in IAA metabolism

Sample comparing Differently expressed probes Down/up
Spike1 vs Ste-rachis 1696 Up
Ste-anther vs Ste-rachis 1938 Up
Ste-anther vs Fer-rachis 2279 Up
Fer-anther vs Fer-rachis 3096 Up
Ste-anther vs F1-anther 1468 Down
Ste-anther vs F1-rachis 2133 Up
Fer-anther vs F1-rachis 2720 Up
F1-anther vs F1-rachis 2421 Up
Spike1 vs Ste-mono 3507 Down
Fer-anther vs Ste-mono 667 Up
F1-anther vs Ste-mono 1959 Up
Spike vs Fer-mono 2985 Down
Ste-anther vs Fer-mono 1339 Up
F1-anther vs Fer-mono 1065 Up
Ste-mono vs Fer-mono 967 Down
Open in a new tab

IAA metabolic pathway was detected in these probe profilings. But IAA metabolic pathway was not found in down-regulated probe profilings between Spike1 versus Ste-rachis which was not shown in the table

Differently expressed genes were input into the software ClueGO, and biological process analysis was performed with a set of two tails test, 4–5 genes involved and kappa score = 0.4. Metabolism pathway was analyzed. In some matched groups, cutoff value was increased so the counts of differently expressed genes decreased to less 1000. Gene probes were decreased to about 200 when the key genes were analyzed.

The results indicated that there existed a stable and relatively independent sub-network in the main network of differently expressed genes between anthers and other tissues as well as other sterility and fertile samples (Fig. 2a–c). This metabolic sub-network consisted of four nodes, corresponding to 4 GO terms, which were indole biological synthesis, indole metabolism, alkaloids biosynthesis and alkaloids metabolism process (Fig. 2d). The sub-network was connected to the main network via GO nodes containing indole-containing compounds (Fig. 2a–c). As the function of the nodes in sub-network was mainly indole biosynthesis and metabolism, it was called as indole pathway sub-network (IAA metabolic sub-network).

Fig. 2.

Fig. 2

Open in a new tab

Network diagram of differently expressed probe profiling. The position of the IAA metabolic sub-network was displayed with black arrow. a Network diagram based on 1331 up-regulated probes over three fold-change between fertile monocyte anthers (Fer-anther) and F1 tetrad panicles (F1-rachis), which showed the complex metabolic network. b Network diagram based on 875 up-regulated probes over three fold-change between anthers at tetrad stage of sterile plant (Ste-anther) and anthers at F1 tetrad stage (Ste-rachis), which showed inddoxal compound was the connection node from the sub-network to the amino acid metabolism main network. c The main network diagram of 347 up-regulated probes over five fold-change between anthers at tetrad stage of sterile plant (Ste-anther) and anthers at F1 tetrad stage (Ste-rachis), which showed IAA sub-network and regulation route. d The structure of IAA metabolic sub-network. It contained 4 nodes of inddoxal biosynthesis, inddoxal metabolism, alkaloid biosynthesis and alkaloid metabolism

The universality and stability of the sub-network were also represented by the following two facts. The main network changed into a few simply sub-networks in which IAA sub-network still existed and kept completely when cut-off value was set more strictly such as increasing fold-change or enlarge kappa score of ClueGO (Fig. 3). Sixteen meaningful comparisons among 9 samples were analyzed, in which the sub-network was found in 14 pairs of comparisons (Table 2).

Fig. 3.

Fig. 3

Open in a new tab

The Network analysis of 179 down-regulated over four fold-change probes between sterile mononucleate anthers and fertile mononucleate anthers. The main network disappeared, and only 2 sub-networks of indole metabolism and coenzyme A biosynthesis metabolism were kept

It was reported that the deficency of IAA was one of the important physiological manifestations of crop male sterility. Here, the abnormal metabolic pathway of IAA was found in the metabolic pathway of differential expression, which meant that this action also could occur in BNS. By the analysis of the metabolic pathways of 14 differentially expressed probe profiles, some essential characteristics of the sub-metabolic network were descripted as following.

  1. Table 2 showed the possible meaningful comparisons among the nine samples. It could be found from the table that IAA metabolic sub-network existed in fertile anthers comparing with rachises, such as Ste-anther versus Ste-rachis, Ste-anther versus Fer-rachis, Ste-anther versus F1-rachis, which formed only in up-regulated probes. When sterile anthers are compared with fertile anthers, the sub-metabolic pathways appeared in down-regulated probes of fertile anthers. For example, the sub-metabolic pathways appeared in F1-anther and Fer-mono compared with Ste-anther versus Fer-mono, Ste-anther versus F1-anther, and Ste-mono versus Fer-mono. The sub-network appeared in the up-regulated probe of F1 fertile anther such as F1-anther versus Ste-mono, F1-anther versus Fer-mono, F1-anther, when F1 fertile anther was compared with BNS fertile anther restored by BNS itself.

  2. Indole metabolism pathway was the main metabolism of different expressed genes in typical sterile and fertile material pairs. Figure 3 displayed a ClueGO network mapping 179 differentially expressed probes (four fold change) which came from comparison between Ste-mono (sterile anthers at mononucleate stage), and Fer-mono (fertile anthers at mononucleate stage). There were only two sub-networks with more than one node in the enriched metabolic map, one of which was indole pathway. This characteristic was also found in up-regulated 264 probes over eight fold change in F1-anther versus F1-rachis, and up-regulated 213 genes of three fold change in Fer-anther versus Ste-mono. Figure 4a showed that the indole metabolic process accounted for a large proportion in up-regulated probes between anthers of tetrad stage in sterile plant, and panicle of tetrad stage in sterile plant. It was also found in the down-regulated probes between sterile monocyte anthers and fertile monocyte anthers (Fig. 4).

  3. Indole metabolic pathway was not completely lost in sterile anthers, but it presented incomplete or low expression level. Figure 5 showed a metabolic diagram of down regulated profiling between Spike1 (sterile young ear) and versus Ste-mono (sterile mononucleate anthers). There were only 2 IAA nodes, and no nodes of alkaloid biosynthesis and alkaloid metabolism in the IAA metabolite sub-network. The complete IAA metabolic pathway was formed, which indicated that IAA metabolism down regulated in sterile anthers when sterile anthers were compared with fertile anthers (Fig. 2a–c).

  4. Indole metabolism sub-network was a terminal metabolism pathway which located in the same position outside of main network in all involved network. It linked to the main network of amino acid, organic acids and monoterpene metabolism nodes by a node containing indole compound (Figs. 2a–c, 3). This metabolism was a relatively stable and independent metabolic pathway, and inter-regulated with amino acid and monoterpene metabolism. We termed indole metabolism as a terminal metabolic sub-network for its position and independence.

  5. Indole metabolism sub-network interacted with its main network. Figure 2c was a main network with mapping of 347 up-regulated probes which were over five fold-change between anthers and panicles at tetrad stage of sterile plant. It was showed that the pathway of information flow between the sub-network and its main network metabolism was as following: from main network to a GO node containing inddoxide, to IAA metabolism, to alkaloids metabolism; then back to IAA metabolism to the node of GO containing inddoxide, finaly, returned to the main network. The yellow nodes were incoming nodes, and the green were outcoming nodes.

Fig. 4.

Fig. 4

Open in a new tab

Clustering analysis of IAA metabolism of typical differential probe profiles by enrichment. Each process item proportion was displayed with different color in pie graph. a The cluster diagram of 347 up-regulated probes over five fold-change between anthers of tetrad stage in sterile plant (Ste-anther), and panicles of tetrad stage in sterile plant (Ste-rachis). b The cluster diagram of 481 down-regulated probes over threefold-change between sterile monocyte anthers (Ste-mono) and fertile monocyte anthers (Fer-mono)

Fig. 5.

Fig. 5

Open in a new tab

The network analysis of down-regulation probes over three fold-change in comparison of Spike1 (ear in anther differentiation stage) versus Ste-mono (anther of mononuclea stage, sterile plant). IAA metabolic pathway was indicated by black arrow in which there was only IAA metabolic nodes, and no alkaloid biosynthesis metobolic nodes existed

Annotation of key genes involved in IAA metabolite sub-network

The consistency and stability of indole metabolic sub-network in fertile anthers indicated that IAA metabolism would play an important role in the development of anthers and pollen in wheat. In order to further analyze the metabolic mechanism of the sub-network, “Associated Genes Found” was extracted from the results of ClueGo analysis (Table 3). There were 4 probe genes in total in structure GO nodes, they were Ta.2863.1, Ta.15150.1, Ta.15151.1 and LOC778393. The count of probe genes in two connecting GO nodes were more than that in structure GO nodes. Their counts were determined by the size of the main network. The larger the main network was, the more the connection between IAA sub-networks and main network would be. All of the non-repeat probe genes in 2 connecting GO nodes of IAA metabolic network over three fold-change are shown in Table 3, which contained 17 and 12 genes respectively. The function of these probe genes were annotated from Affymetrix probe database (http://www.affimetrix.com/analysis-netaffy/) in Table 4. From the table, it can be seen that protein LOC778393 shared by six GO terms was a male sterile protein of Arabidopsis thaliana. The probe gene Ta.2863.1 was similar to 41KD heat shock protein Dan J in Arabidopsis thaliana. Among these genes in connecting GO nodes, Wcat1 (Ta.442.1) was a peroxidase active protein, Ta.27477.1 was a oxalate oxidase GF-2.8 precursor, the rest were or EST locus, or putative protein locus with unknown function.

Table 3.

Main GO terms and associated genes found in IAA metabolic network

GO ID Node name Associated genes found
GO:0042431 Indole biosynthetic process LOC778393, Ta.2863.1, Ta.15150.1, Ta.15151.1
GO:0042432 Indole metabolic process LOC778393, Ta.2863.1, Ta.15150.1, Ta.15151.1
GO:0009820 Alkaloid metabolic process LOC778393, Ta.2863.1, Ta.15150.1, Ta.15151.1
GO:0009821 Alkaloid biosynthetic process LOC778393, Ta.2863.1, Ta.15150.1, Ta.15151.1,
GO:0042430 Indole-containing compound metabolic process LOC778393, Ta.2863.1,Ta.15150.1, Ta.15151.1, Ta.1118.1, Ta.27477.1, Ta.3840.3, Ta.4225.1, Ta.431.2, TaAffx.12340.1, TaBx1-A, Ta.14944.1, wcat1, Ta.6643.3, Ta.19271.3, Ta.25865.1, Ta.25867.1
GO:0042435 Indole-containing compound biosynthetic process LOC778393, Ta.2863.1,Ta.15150.1, Ta.15151.1, Ta.1118.1, Ta.27477.1, Ta.3840.3, Ta.4225.1, Ta.431.2, TaAffx.12340.1, TaBx1-A, Ta.14944.1
Open in a new tab

Table 4.

Annotation of important probe genes related to BNS male-sterility

Probe ID gb ID Annotation
Ta.11286.1 BQ169778 Male sterility protein-like (LOC780568) in Arabidopsis thaliana
Ta.2863.1 CK210585 Putative DnaJ protein(heat shock protein 41KD) in Arabidopsis thaliana
Ta.15150.1 CD878742 Wheat putative protein-coding gene
Ta.15151.1 CA691622 Wheat transcribed locus in Triticum aestivum
Ta.1118.1 BQ168573 A protein in Arabidopsis thaliana
Ta.3038.1 CK157008 Putative protein in Arabidopsis thaliana
Ta.27477.1 CD373670 Oxalate oxidase GF-2.8 precursor in Triticum aestivum
Ta.3840.3 CA608029 AKIN beta1 (Arabidopsis thaliana)
Ta.4225.1 BJ276566 Expressed protein in Arabidopsis thaliana
Ta.431.2 BJ296777 A protein in Arabidopsis thaliana
Ta.14944.1 CA685324 Transcribed sequence in Arabidopsis thaliana
Wcat1(Ta.442.1) D86327.1 Wheat oxidative stress, catalase activity
Open in a new tab

Discussion

Plant auxin hormones contain indole molecules including indole-3-acetic acid, acid-indoleacetic and heteroauxin which are indispensable substances for plant growth, organ building, nutrient transport and development. It has long been found that the contents of IAA decreased in male sterile young panicles of plants, such as rice (Li et al. 2000; Zhao et al. 1996), maize (Tang et al. 2003) and Arabidopsis thaliana (Fei et al. 2004), which led to imbalance of hormone ratio, like high temperature and water stress, then reduced the ability of transporting nutrients and induced male sterility occurrence. IAA deficiency was also found in PTGMS. In rice, Nongken 58S, IAA concentration in leaves of sterile line was only 1/3 of that in restored line (Li et al. 2000; Pan et al. 2014). IAA content in anthers of sterile line was about 80% of fertile line in wheat male sterile line C49S and BNS (Zhang et al. 2006, 2013b, 2016). Based on the transcriptional profiles, we found that IAA metabolism was a typical differential metabolic pathway in network between anthers and young panicles tissues. These results were consistent with previous studies on BNS physiological detection (Zhang et al. 2013b), which suggested that the metabolism of IAA and alkaloid metabolism are involved in the process of BNS sterility occurrence. The abnormality of IAA metabolism was one of the main physiological characteristics, which played an important role in physiology and sterility regulation of sterility.

IAA metabolism closely related to the occurrence of BNS sterility. The metabolism of IAA was formed in different expressed genes between sterile and fertile anthers, as well as anthers and other tissues. This pathway was found incomplete without alkaloid in sterile anthers. IAA pathway was the main metabolic pathway of differently expressed genes in fertile anther of F1 plant with restoring genes. This metabolism pathway was still formed if we adjusted the fold-change to 8, which implied that the metabolism of IAA was an important metabolic pathway for the normally development of wheat anthers. And those of weakening, incomplete and missing metabolisms will directly affect anther development. In BNS, the metabolism of IAA was abnormal and defective, which may lead to anther dysplasia and then pollen abortion. The information regulation route between the metabolism of IAA and the metabolism of main network is as following: from main network to IAA, from IAA to alkaloid, from alkaloid to IAA, and then back to the main network. This regulation route not only indicated the importance of IAA metabolism, but also implied that alkaloid metabolism was an important component of IAA metabolic pathway. But the relationship between alkaloid metabolism and wheat male sterility is not lucid and has rarely been reported in the past. Therefore, further study is need to investigate the mechanism of how male sterility genes affect alkaloid metabolism, and how alkaloid metabolism affects pollen development, and the relationship between IAA and the alkaloid as well as how they regulate sterile process.

IAA metabolic pathway was a terminal metabolic pathway. In fertile anthers, all IAA metabolic sub-network kept the same structure, relatively independent, and located outside of the main network, and connected to main network by a node containing IAA compound. It was suggested that IAA metabolism was the terminal metabolism with product formation, and could form a phenotypic trait. Abnormal metabolism may lead to phenotypic abnormalities and change sterility phenotype. A lot of researches have been reported on this metabolism in the past. A decrease in IAA content was detected in almost all plant male sterile individuals (Fei et al. 2004; Li et al. 2000; Pan et al. 2014; Tang et al. 2003; Zhang et al. 2006, 2013b; Zhao et al. 1996). Using IAA or IAA synthesis inhibitors or similar chemical reagents to treat young spikes of male sterility in rice, wheat, maize and other crops could change their sterility. He and Xiao (1992) reported that the spray of IAA at first terminal stage of branch differentiation in rice Nongken 58S could significantly increase the fertility of anthers, and treating with IAA oxidase inhibitor could reduced the sterility. Zhang et al. (2001) found that the fertile anthers and self-seeding rate was increased 20% in thermo-photo-sensitive wheat male sterile C50S when it was treated with 50 μg ml−1 IAA. And Tang et al. (1996) induced rice male sterility and found that the IAA and other hormone in anther were significantly decreased when it was treated with chemical anthericide TO3. Kovaleva et al. (2018) reported that ABA and IAA control microsporogenesis in Petunia hybrida L. These characteristics of IAA pathway not only indicated that their metabolism was an important physiological mechanism of sterility, but also implied that IAA or analogues could effectively regulate sterility occurrence or transformation.

The expression profiling of BNS sterility gene was anther specific and constitutive expression. The differential metabolism pathway between sterile plant and fertile plant in BNS was the result of differential expression of sterile genes. Based on the microarray analysis results, the genes related to the metabolic pathway were expressed in anthers but not in rachis, which indicated that these genes were specifically expressed in anthers. When we compared sterile anthers and fertile anthers, the complete metabolic pathway of IAA was formed, which indicated that the related genes were expressed in fertile anthers. When we compared sterile anthers and spike axes, IAA metabolic pathway partially formed which indicated that the sterile genes were also expressed in sterile anthers. Both results suggested that the gene expression of this pathway should be constitutive in anthers. These two characteristics of sterile gene expression, which have been found in our previous studies (Su et al. 2013; Zhao et al. 2014), provided two important clues to understand the mechanism of BNS sterility. One was that the temperature sensitive organ of BNS should be young ears and differentiated anthers, not rachis. The second was that the BNS sterile genes should be the functional mutation of key structure genes of pollen development, not the regulation genes.

Four key genes of male sterility were found. Among the four co-expressed genes in structural GO nodes and connecting GO nodes, two of which were annotated. One was Ta.11286.1 that codes Arabidopsis male sterile protein T16L24.80, and the other was Ta.2863.1, which is the gene of 41KD heat shock protein Dan J in Arabidopsis thaliana. Among the genes in connecting GO nodes, wheat peroxidase gene and oxalate oxidase precursor gene were annotated. For other genes, their function was unknown. Although the total number of annotated genes was relatively less, the annotated information still provided a few important clues for the probes of BNS male sterility mechanism. The male sterility protein LOC780568 was associated with sterility. The heat shock protein, a kind of temperature sensitive protein, was consistent with the characteristic of temperature-sensitive in BNS. There were a lot of reports on the relationship between heat shock protein and photo-thermo-sensitive male sterility (Al-Whaibi 2011). HSP23.5 gene of the small heat shock protein was significantly down-regulation in BNS sterile plant (Li et al. 2011b; Su et al. 2013; Zhao et al. 2014), indicating that the transcriptome results were consistent with the proteome results. Wheat 17.9KD and 23.6KD small heat shock protein genes were also differently expressed in barley male sterile spikelets induced by high temperature (Oshino et al. 2007); For annotated genes in connecting nodes, peroxidase had detoxification effect (Feki et al. 2015), and oxalate oxidase activity was related to apoptosis (Simmonds et al. 2004), which were closely related to the occurrence and recovery of male sterility. The analysis of male sterility and fertile transcriptional profiling of cotton (Suzuki et al. 2013) and rape (Zhou et al. 2017) showed that the indole-3-acetic acid amino synthetase metabolism was differently expressed. These investigation advanced the understanding of the physiological mechanism of BNS sterility.

The regulatory mechanism of male sterility is still unclear, and the key genes are also still unknown in genic male sterile wheat. We focused on the transcriptional profiling and the role of IAA metabolism in BNS sterile and fertile anthers. An indole metabolic sub-network was found in main metabolic networks involved in differentially expressed genes in almost all paired BNS samples using wheat expression microarray. IAA sub-network contained indole metabolism and alkaloid metabolism nodes. It was not formed in rachis of ear, and could be formed, but incomplete in sterile anthers, in which there was no alkaloid metabolism node. This sub-network was complete in fertile anthers. In F1 anthers with restorer genes, the sub-metabolic pathway became main subject of different metabolic pathway. More than a dozen key genes were found in the IAA metabolic pathway, four of which were annotated in molecular function. They were Arabidopsis male sterile protein, Arabidopsis 41 KD heat shock protein DanJ, peroxide oxidase and oxalate oxidase precursor. These functional genes and unknown functional genes were inferred to be specifically expressed and constitutively expressed in anther tissues. The complete indole-metabolizing pathway was a relatively independent terminal metabolic pathway with products formation. The intermediate products formed in this pathway could be used to regulate the sterility and conversion of BNS sterility, which may benefit the artificial regulation of BNS sterility and fertility.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary material 1 (DOC 39 kb) (39.5KB, doc)

Acknowledgements

This research was funded by Henan Research Project on Foundation and Frontier Technology (Nos. 122300410011 and 162300410136). We would like to thank prof. ZhenGang Ru, Directorate of Wheat Research Center in Henan institute of science and technology, for supply wheat BNS sterile line. We would also like to thank prof. Gonmbia who give many suggestions for ClueGO running.

Compliance with ethical standards

Conflict of interest

The authors have no conflict of interest to declare.

References

  1. Al-Whaibi MH. Plant heat shock proteins: a mini review. J King Saud Univ. 2011;23:139–150. doi: 10.1016/j.jksus.2010.06.022. [DOI] [Google Scholar]
  2. Bindea G, et al. ClueGO: a Cytoscape plug-into decipher functionally grouped gene ontology and pathway annotation networks. Bioinformatics. 2009;25:1091–1093. doi: 10.1093/bioinformatics/btp101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Crismani W, et al. Microarray expression analysis of meiosis and microsporogenesis in hexaploid bread wheat. BMC Genom. 2006;7:267. doi: 10.1186/1471-2164-7-267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Daraselia N, Yuryev A, Egorov S, Mazo I, Ispolatov I. Automatic extraction of gene ontology annotation and its correlation with clusters in protein networks. BMC Bioinform. 2007;8:243. doi: 10.1186/1471-2105-8-243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Du LJ, Sun HY, Su Q, A-l BA, Li YY. Average temperature above 15°C significantly affect fertility transition of thermo-sensitive Male Sterile Wheat BNS. Chin J Agrometeorol. 2016;37:555–563. [Google Scholar]
  6. Fan XJ, et al. Hereditary stability and restoration of thermo-photo-sensitive male sterile line BNS of wheat (Triticum aestivum L.) J Northwest A&F Univ (NatSciEd) 2015;43:53–58. [Google Scholar]
  7. Fei H, Zhang R, Pharis RP, Sawhney VK. Pleiotropic effects of the male sterile33 (ms33) mutation in Arabidopsis are associated with modifications in endogenous gibberellins, indole-3-acetic acid and abscisic acid. Planta. 2004;219:649–660. doi: 10.1007/s00425-004-1270-1. [DOI] [PubMed] [Google Scholar]
  8. Feki K, Kamoun Y, Ben Mahmoud R, Farhat-Khemakhem A, Gargouri A, Brini F. Multiple abiotic stress tolerance of the transformants yeast cells and the transgenic Arabidopsis plants expressing a novel durum wheat catalase. Plant Physiol Biochem. 2015;97:420–431. doi: 10.1016/j.plaphy.2015.10.034. [DOI] [PubMed] [Google Scholar]
  9. He ZC, Xiao YH. Effect of the regulators on fertility in HPGMR (58S) Hybrid Rice. 1992;7(3):39–42. [Google Scholar]
  10. Hu J, Chen G, Zhang H, Qian Q, Ding Y. Comparative transcript profiling of alloplasmic male-sterile lines revealed altered gene expression related to pollen development in rice (Oryza sativa L.) BMC Plant Biol. 2016;16:175. doi: 10.1186/s12870-016-0864-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Kovaleva LV, Voronkov AS, Zakharova EV, Andreev IM. ABA and IAA control microsporogenesis in Petunia hybrida L. Protoplasma. 2018;255:751–759. doi: 10.1007/s00709-017-1185-x. [DOI] [PubMed] [Google Scholar]
  12. Li NH, Tong Z, Lu SF. Immunohistochemical analysis of IAA in anthers of the photoperiod-sensitive genic male-sterile rice. Acta Botanica Sinica. 2000;42:1045–1050. [Google Scholar]
  13. Li YF, Zhao CP, Zhang FT, Sun H, Sun DF. Fertility alteration in the photo-thermo-sensitive male sterile line BS20 of wheat (Triticum aestivum L.) Euphytica. 2006;151:207–213. doi: 10.1007/s10681-006-9141-4. [DOI] [Google Scholar]
  14. Li LJ, Ru ZG, Gao QR, Jiang H, Guo FZ, Wu SW, Sun Z. Male sterility and thermo-photo sensitivity characterisitics of BNS in wheat. Sci Agric Sin. 2009;42:3019–3027. [Google Scholar]
  15. Li SX, Gu J, Tian YX, Liu K, Yang HX, Zhao H, Yang MJ. Advance of hybrid wheat seed production in Yunnan. Seed. 2011;30:59–62. [Google Scholar]
  16. Li YY, Ru ZG, Su Q, Fu QY. Identification and analysis of differentially expressed proteins of BNS male sterile line and its conversion line of wheat. Acta Agron Sin. 2011;37:1540–1550. doi: 10.3724/SP.J.1006.2011.01540. [DOI] [Google Scholar]
  17. Li YY, Li Y, Fu QY, Sun HH, Ru ZG. Anther proteomic characterization in temperature sensitive Bainong male sterile wheat. Biol Plant. 2015;59:273–282. doi: 10.1007/s10535-015-0486-1. [DOI] [Google Scholar]
  18. Ma XF, Wang Z, Li XY, Liu F, Fan XJ, Ma LJ. Restoring ability test and heterosis analysis of wheat thermo-photo-sensitive genic male sterile line BNS. Acta Agric Boteali-occidentalis Sin. 2013;22:90–94. [Google Scholar]
  19. Meng C, et al. Transcriptome profiling reveals the genetic basis of alkalinity tolerance in wheat. BMC Genom. 2017;18:24. doi: 10.1186/s12864-016-3421-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Murai K, Tsutui I, Kawanishi Y, Ikeguchi S, Yanaka M, Ishikawa N. Development of photoperiod-sensitive cytoplasmic male sterile (PCMS) wheat lines showing high male sterility under long-day conditions and high seed fertility under short-day conditions. Euphytica. 2008;159:315–323. doi: 10.1007/s10681-007-9510-7. [DOI] [Google Scholar]
  21. Ning JQ, Ru ZG, Zheng WJ, Chai SC. Male sterility and restoration of thermo-photo-sensitive male sterile line BNS of common wheat (Triticum aestivum L.) Journal of Triticeae Crops. 2011;31:642–647. [Google Scholar]
  22. Oshino T, Abiko M, Saito R, Ichiishi E, Endo M, Kawagishi-Kobayashi M, Higashitani A. Premature progression of anther early developmental programs accompanied by comprehensive alterations in transcription during high-temperature injury in barley plants. Mol Genet Genomics. 2007;278:31–42. doi: 10.1007/s00438-007-0229-x. [DOI] [PubMed] [Google Scholar]
  23. Pan Y, et al. Genes associated with thermosensitive genic male sterility in rice identified by comparative expression profiling. BMC Genom. 2014;15:1114. doi: 10.1186/1471-2164-15-1114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Qin Z, Sun HY, Fu QY, Wei X, Ba A, Ru ZG, Li YY. Study on significant effects of temperature changes in winter and spring on fertility conversion of wheat thermo-sensitive male sterile line BNS. Acta Agric Boreali-occidentalis Sin. 2018;27:31–37. [Google Scholar]
  25. Shannon P, et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 2003;13:2498–2504. doi: 10.1101/gr.1239303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Simmonds J, et al. Oxalate oxidase: a novel reporter gene for monocot and dicot transformations. Mol Breeding. 2004;13:79–91. doi: 10.1023/B:MOLB.0000012877.45556.09. [DOI] [Google Scholar]
  27. Singh SP, Srivastava R, Kumar J. Male sterility systems in wheat and opportunities for hybrid wheat development. Acta Physiol Plant. 2015;37:1713. doi: 10.1007/s11738-014-1713-7. [DOI] [Google Scholar]
  28. Su SQ, Ru ZG, Qin ZY, Cao YP, Liu FF, Li YY. Differential expression of small heat shock protein gene (hsp23.5) between wheat (Triticum aestivum L.) BNS male sterile line and its conversion line. J Agric Biotechnol. 2013;21:29–37. [Google Scholar]
  29. Sun HH, Yang J, Wei X, Fu QY, Cao YP, Ru ZG, Li YY. Detection of linkage groups and location of QTLs in Chinese Spring for restoring wheat BNS male sterility. J Tritceae Crops. 2016;36:856–865. [Google Scholar]
  30. Suzuki H, Rodriguez-Uribe L, Xu J, Zhang J. Transcriptome analysis of cytoplasmic male sterility and restoration in CMS-D8 cotton. Plant Cell Rep. 2013;32:1531–1542. doi: 10.1007/s00299-013-1465-7. [DOI] [PubMed] [Google Scholar]
  31. Tang RS, Mei CS, Zhang JY, Cai XN, Wu GN. Relationship between rice male sterility induction by TO3 and level of endogenous hormones. Jiangsu J Agric Sci. 1996;12:6–10. [Google Scholar]
  32. Tang JH, He ZY, Chen WC, Tan YS, Xie HL, Li DL. Relationship between fertility conversion and endogenous hormones in a maize thermo-sensitive genic male-sterile line. Acta Agron Sin. 2003;29:336–338. [Google Scholar]
  33. Ulmasov T, Murfett J, Hagen G, Guilfoyle TJ. Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell. 1997;9:1963–1971. doi: 10.1105/tpc.9.11.1963. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Zhang JK, Feng L, Luo D, Yu GD, Shi YM, Li BQ. Effect on the fertility of thermo-photo-sensitive genic male-sterile wheat C49S using different chemicals. J Triticeae Crops. 2001;21:69–72. [Google Scholar]
  35. Zhang JK, Zong XF, Yu GD, Li JN, Zhang W. Relationship between phytohormones and male sterility in thermo-photo-sensitive genic male sterile (TGMS) wheat. Euphytica. 2006;150:241–248. doi: 10.1007/s10681-006-9114-7. [DOI] [Google Scholar]
  36. Zhang BL, et al. Genetic analysis on male sterility of thermo-photo-sensitive male sterile line BNS in wheat. Sci Agric Sin. 2013;46:1533–1542. [Google Scholar]
  37. Zhang YY, et al. Dynamic changes of endogenous hormones in thermo-photo-sensitive male sterile wheat line BNS. Acta Bot Boreali-Occidentalia Sin. 2013;33:1165–1170. [Google Scholar]
  38. Zhang ZG, et al. Relationship between fertility transition of thermo-photo-sensitive wheat male sterile line BNS and endogenous hormone contents in its developing ear. J Plant Genet Resour. 2016;17:913–919. [Google Scholar]
  39. Zhao CP. Status and trends of hybrid wheat research in China. J Agric Sci Technol. 2010;12:5–8. [Google Scholar]
  40. Zhao YJ, Tong Z, Chen HJ, Jin YJ. Relationship between male fertility and endogenous phytohormones in photoperiod - sensitive genic male sterile rice. Acta Bot Sin. 1996;38:936–941. [Google Scholar]
  41. Zhao DH, Sun HH, Yu TY, Li YY. Gene atp1 expresses differentially between BNS male sterile line and its conversion line in wheat. Life Sci Res. 2014;18:488–493. [Google Scholar]
  42. Zhou M, Ru Z, Luo Y, Luo P, Li Q, Guo X, Zhou P. Male fertility transformation of two-line wheat sterile lines BNS. J Nuclear Agric Sci. 2010;24:887–894. [Google Scholar]
  43. Zhou X, Liu Z, Ji R, Feng H. Comparative transcript profiling of fertile and sterile flower buds from multiple-allele-inherited male sterility in Chinese cabbage (Brassica campestris L. ssp. pekinensis) Mol Genet Genomics. 2017;292:967–990. doi: 10.1007/s00438-017-1324-2. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary material 1 (DOC 39 kb) (39.5KB, doc)

Articles from Physiology and Molecular Biology of Plants are provided here courtesy of Springer

RESOURCES