Skip to main content
Journal of Veterinary Research logoLink to Journal of Veterinary Research
. 2018 Dec 31;62(4):457–462. doi: 10.2478/jvetres-2018-0073

New Insight of Apparently Healthy Animals as a Potential Reservoir for Clostridium Perfringens: A Public Health Implication

Dalia Hamza 1,*, Sohad M Dorgham 2, Mahmoud Elhariri 3, Rehab Elhelw 3, Elshaimaa Ismael 4
PMCID: PMC6364162  PMID: 30729202

Abstract

Introduction

Clostridium perfringens is commonly found in the gastrointestinal tract of animals and humans and continues to cause one of the most prevalent foodborne diseases in man.

Material and Methods

A total of 355 samples were examined for the occurrence of C. perfringens: rectal swabs from cattle, sheep, and goats, fresh stool samples from diarrhoea sufferers having been in contact with these animals, irrigation water and soil samples from the husbandry sites, and pre-harvesting fresh produce from farms irrigated with the sampled water. All samples were collected from Cairo and Giza governorates, Egypt. PCR analysis was carried out with positive isolates using the α-toxin gene. Sequence analysis of the gene of C. perfringens isolates was performed using the neighbour-joining approach. Bootstrap analysis was executed with 1,000 resamplings.

Results

174 C. perfringens strains were isolated with a 49.01% prevalence. The highest prevalence of C. perfringens in apparently healthy animals was found in sheep (65.45%) followed by goats (58%), buffaloes (55%), and cattle (47.1%). Its prevalence in humans being in contact with these animals was 47.5%. The bacterium’s isolation from the soil and irrigation water was achieved in 40% and 31.7% of samples, respectively, posing a risk, particularly when the water and soil contact food in the field, shown by the fresh produce isolation of 40%. A significant relationship between the prevalence of C. perfringens in animal and environmental samples was identified (P < 0.05). A significant relationship was identified neither between animal species and C. perfringens prevalence, nor between the environmental source and C. perfringens prevalence (P > 0.05). All isolates were positive for the α-toxin gene by PCR. The sequence analysis and the phylogenetic relationship of the α-toxin genes from different samples revealed that C. perfringens from faeces of apparently healthy cattle, buffaloes, sheep, and goats is a significant threat in places where it can contaminate the soil and water. In addition, the sequence of C. perfringens from humans suffering from diarrhoea was found in the same cluster with the sequence from cows, goats, and sheep.

Conclusion

The role of apparently healthy animals in transmitting C. perfringens to humans, either through being in direct or indirect contact via water or soil in the cultivation of vegetables and fruits, was demonstrated.

Keywords: humans, apparently healthy animals, Clostridium perfringens, soil, water, public health

Introduction

The foodborne human diseases caused by Clostridium perfringens remain some of the most prevalent diseases. C. perfringens is responsible for two forms of enteritis: type A produces diarrhoea with abdominal pain within 8–20 h after ingestion of the contaminated food (24 h clinical course), and type C is responsible for necrotising enteritis (bloody diarrhoea with abdominal pain, shock and peritonitis) (4). This bacterium is commonly found in vegetables and crops as well as meat products (12), including cooked foods, because as these gradually cool, heat-stable spores of C. perfringens may germinate and proliferate (16).

C. perfringens is spore producer, is impervious to heat, chlorination, and other stress factors, and has a strong capability to survive in contrast to vegetative cells like E. coli and enterococci, which are less resistant to hostile environments (15). C. perfringens is reported to display a certain acceptance of aerobic conditions in foods. This is a noteworthy in comparison with other anaerobes, that it can grow not only in canned foods but also in bulk food if reducing substances are present (4), and this indicates wide sources of infection. Meanwhile C. perfringens is a normal inhabitant of the intestine of most animal species and humans and also is widespread in the environment (14). The soil is a reservoir of C. perfringens (13), so this organism can contaminate vegetables during cultivation and subsequent harvest. Foodborne pathogens that are associated with fresh produce originate mostly from intestinal tract and faecal material of humans or animals (12). Contamination of vegetables and fruits with spores of bacteria such as B. cereus, C. botulinum, or C. perfringens present in the soil is common (11).

In this work, we have determined the presence of C. perfringens in apparently healthy animals which might be a source of contamination of fresh produce through water and soil, and a potential risk factor for consumers.

Material and Methods

Sample collection and preparation

Animal and human samples. Rectal swabs from 70 cattle, 40 buffaloes, 55 sheep, and 50 goats in Cairo and Giza governorates, Egypt, and 40 fresh stool samples from people suffering from diarrhoea and having been in contact with these animals were collected and transferred directly without delay to the laboratory.

Water samples. Water was taken in a total of 60 samples from the irrigated water around the animal facilities (1 L for each sample) to sterile glass bottles with sodium thiosulphate as a dechlorinating agent, and then transferred to the laboratory.

Soil samples. The soil was collected from different locations around the examined animals. Each of the 30 samples contained 1 g of soil, which was collected in a 15 mL sterile plastic tube.

Fresh produce. A total of 10 regular market-sized fresh products were collected from farms prior to harvesting, which were previously irrigated with the examined water. All samples were placed in sterile polyethylene bags, labelled, and placed in an ice box for further isolation and identification.

Isolation and identification of C. perfringens

Faecal samples. Rectal swabs were inoculated onto a tube of sterile freshly prepared cooked meat broth (Oxoid, UK), then incubated at 37°C for 24–48 h in an anaerobic jar, using anaerobic gas generating kits. A loopful from a previously incubated tube was streaked onto the surface of 10% sheep blood agar with neomycin sulphate (200 μg/mL). The plates were incubated anaerobically at 37°C for 24–48 h.

Water samples. Water samples were concentrated by filtration through 0.45 μm pore nitrocellulose filters (Sartorius, France), and then the filters were vortexed in peptone broth for recovering the bacteria. After removing the filters, the bacteria were cultivated in cooked meat broth (Oxoid, UK), then incubated at 37ºC for 24–48 h in an anaerobic jar, using anaerobic gas generating kits. A loopful from a previously incubated tube was streaked onto the surface of 10% sheep blood agar with neomycin sulphate (200 μg/mL). The plates were incubated anaerobically at 37°C for 24–48 h (6).

Fresh produce. The surface of products was sanitised by dipping it in a 70% ethanol solution and then allowing it to dry. The products were dissected using a sterile scalpel into stem scar and pulp, as described by Guo et al. (9). Each sample was placed in a sterile stomacher bag with 9 mL of sterile 0.1% peptone water and stomached for 2 min. One millilitre of the sample was added to 9 mL of cooked meat media and completion of sample preparation ensued as previously.

Soil samples. A 10 mL aliquot of sterile differential reinforced clostridial broth medium (DRCM; Merck, Germany) was added to 1 g of each soil sample in a 15 mL sterile tube. After gentle mixing, 1 mL aliquots of DRCM suspension containing a soil sample were added to two tubes, each containing 9 mL of sterile DRCM. To identify and encourage the germination of any C. perfringens spores present in soil samples, one tube of each paired set was heat shocked at 75ºC for 20 min before incubation at 43ºC for 16 h, and the other tube was directly incubated at 43ºC for 16 h to enrich for C. perfringens vegetative cells or self-germinating spores which were present in the sample. A loopful from the previously incubated tube was streaked onto the surface of 10% sheep blood agar with neomycin sulphate (200 μg/ml). The plates were incubated anaerobically at 37ºC for 24–48 h (12).

The typical suspect colonies with the double zone of haemolysis were identified after conducting the anaerobic tolerance test by different biochemical tests such as Gram staining, phospholipase C (lecithinase) test, indole, urease production, gelatin hydrolysis, and fermentation of sugars like glucose, lactose, and mannitol (8).

DNA extraction and PCR assay. Genomic DNA of C. perfringens was extracted using a QIAmp Mini Kit (Qiagen, Germany). Specific oligonucleotide primers for the α-toxin gene of C. perfringens were used: forward GTTGATAGCGCAGGACATGTTAAG and reverse CATGTAGTCATCTGTTCCAGCATC with molecular weight 402 bp (1).

The assay was carried out in 25 μL of PCR reaction mixture (25 μL) containing 3 μL of template DNA, 12.5 μL of master mix, 0.5 μL of one of the primers (10 pmol/μL), and 8.5 μL of DNase-free water. The PCR reaction mixtures were placed in a Biometra PCR thermal cycler (Biometra, Germany). Following initial denaturation for 5 min at 94ºC, the samples were subjected to 30 cycles of denaturation at 94ºC for 1 min, annealing at 55ºC for 1 min, and extension at 72ºC for 1 min. After the last cycle, a final extension for 10 min at 72ºC was performed (7). The PCR reaction mixtures were analysed by electrophoresis on a 1.5% (w/v) agarose gel in the presence of a 100 bp DNA ladder (Fermentas Life Science, part of Thermo Fisher Scientific, USA).

Sequence of α-toxin gene. PCR products of eight C. perfringens isolates obtained from different animal species, human, soil, water, and fresh produce were purified using a QIA quick PCR purification kit (Qiagen, Germany) according to the manufacturer's instructions, and sequencing was conducted using a Big Dye Terminator V3.1 sequencing kit (Applied Biosystems, USA.) by using forward and reverse primers of α-toxin genes.

GenBank submission. The sequences of the α-toxin genes have been deposited in the GenBank database under accession numbers: KJ729010, KJ729012, KJ729013, and KJ729016 from cow, sheep, goat, and buffalo, respectively, kF383124 from human, KX793135 and KX793136 from soil and water respectively, and MG252853 from fresh produce.

Sequence and phylogenetic analysis of nucleotide (nt) sequences of the α-toxin gene were compared with the sequences available in public domains using NCBI, BLAST server, and the representative sequences of α-toxin genes of C. perfringens from different animals and soil obtained from GenBank. Sequences were downloaded and imported into BIOEDIT version 7.0.1.4 (Tom Hall of Ibex Pharmaceuticals, USA) for multiple alignments according to their amino acid deduced using the CLUSTAL W programme of BIOEDIT. Phylogenetic analysis was performed with MEGA version 6 (Molecular Evolutionary Genetic Analysis, Kumar S, Stecher G, and Tamura K. USA), using the maximum likelihood approach. Bootstrap analysis was performed with 1,000 resamplings.

Statistical analysis. PASW Statistics, SPSS 18.0 software (IBM SPSS, USA) was used to analyse the data. The chi-squared test was used to determine whether there is a relation between the occurrence of C. perfringens and species of animals and to compare its presence in different types of samples. Differences were considered statistically significant if the P value was <0.05.

Results

A total of 174 C. perfringens strains (49.01%) were isolated from 355 examined samples. Samples totalling 120 (55.81%) were positive for C. perfringens from 215 rectal swabs from various animals, 19 (47.5%) samples were positive from 40 human stool samples, 31 (34.44%) samples were positive from 90 environmental samples, and 4 (40%) samples were positive from 10 fresh produce samples (Table 1). The difference between animal and environmental samples was significant as tested by the chi-squared test (P < 0.05).

Table 1.

Prevalence (%) of C. perfringens in apparently healthy animals and humans, environment, and fresh produce (n = 355)

Samples Number of samples C. perfringens strains
Positive %
Animals
Cattle 70 33 47.10
Buffaloes 40 22 55.00
Sheep 55 36 65.45
Goats 50 29 58.00
Total 215 120 a 55.81
Human 40 19 ab 47.50
Environment
Water 60 19 31.70
Soil 30 12 40.00
Total 90 31 b 34.44
Fresh products 10 4 ab 40.00
Total samples 355 174 49.01
a, b

Different superscripts indicate significance at P < 0.05

Isolation of C. perfringens from animals. The prevalence of C. perfringens in cattle (33/70) was 47.10% and in buffaloes (22/40) was 55%. The prevalence of C. perfringens in sheep (36/55) was 65.45% and in goats (29/50) was 58%. No significant relationship among animal species and C. perfringens prevalence was observed (P > 0.05) (Table 1).

Isolation of C. perfringens from the environment surrounding the animal populations. C. perfringens strains were isolated from 19 out of 60 water samples used for land irrigation to give 31.7% prevalence. C. perfringens was isolated from 12 (40%) samples of the 30 soil samples (Table 1). No significant relationship between the environmental source and C. perfringens prevalence was found (P > 0.05) (Table 1).

The prevalences of C. perfringens in soil and water by animal species raised in proximity to that soil or water are presented in Table 2. Soil-isolated C. perfringens strains sampled near cattle and buffaloes (3/10), sheep and goats (4/10), and mixed animal populations (5/10) had 30%, 40%, and 50% prevalences, respectively. The prevalences of positive isolation from water sources around cattle and buffaloes (6/20), sheep and goats (6/20), and mixed animal populations (7/20) were 30%, 30% and 35%, respectively.

Table 2.

Prevalence (%) of C. perfringens in soil and water samples collected from areas around various apparently healthy animal populations (n = 90)

Samples Number of samples C. perfringens strains
Positive %
Soil
Cattle and buffaloes 10 3 30
Sheep and goats 10 4 40
Mixed species 10 5 50
Total 30 12 40
Water
Cattle and buffaloes 20 6 30
Sheep and goats 20 6 30
Mixed species 20 7 35
Total 60 19 31.70
Total environmental samples 90 31 34.44

Sheep and goats were kept in one area, cattle and buffaloes were kept in another, while in the third area all animal species mixed freely

All isolates were positive for the α-toxin gene by PCR. The sequence analysis of the eight C. perfringens isolates from different samples and the phylogenetic relationship revealed that the sequence of C. perfringens from humans suffering from diarrhoea was found in the same cluster with sequences from cow, goat, and sheep, and in the same group as those isolated from soil, water, and fresh produce.

Discussion

As indicated by our results, 174 C. perfringens strains were isolated from 355 samples (faecal samples of apparently healthy cattle, buffaloes, sheep, and goats, humans, water, soil, and fresh produce) with an overall prevalence rate of 49.01%. A significant relationship between prevalence in animals and environmental samples was identified (P < 0.05). A significant relationship was identified neither between animal species and C. perfringens prevalence, nor between the environmental source and the prevalence (P > 0.05).

C. perfringens were isolated more frequently from sheep, followed by goats, buffaloes, and cattle (63.6%, 58%, 55%, and 47.1%, respectively). This outcome thoroughly concurs with the established certainty that C. perfringens is widely distributed in nature and normally found in the intestines of animals, as reported previously (2).

Moreover, the isolation of C. perfringens from the soil around animal husbandry sites was 40%, which could be a result of the common use of animal manures as fertilisers. Alternatively, it is possible that C. perfringens can grow in soil (13). In addition, the presence of C. perfringens in irrigation water (31.7%) could be a potential risk, particularly when the water interacts with food. Prevalence of C. perfringens in soil and water was not significantly related to the species of animals raised around them (Table 2), and this indicates that the spreading of the organism could happen irrespective of the animal species raised in proximity.

Our results stated that the α-toxin gene was isolated from all positive samples of C. perfringens, and the phylogenetic relationship of the selected sequences illustrated that the presence of C. perfringens in faeces of apparently healthy animals (cattle, buffaloes, sheep, and goats) represents a major hazard that could contaminate the soil and water (Fig. 1).

Fig. 1.

Fig. 1

Phylogenetic relationship determined using maximum likelihood method. The analysis was conducted based on the partial sequence of α-toxin gene of C. perfringens. The evolutionary analysis was performed with MEGA version 6

Since many types of life form can contaminate the surface of vegetables, microbial contamination can occur through irrigation with water contaminated with high levels of faecal bacteria and the sewage sludge of wastewater (10). C. perfringens can contaminate vegetables through soil or water at any stage from production to consumption as it was found at high prevalence in both water and soil.

The related foodborne diseases are caused by C. perfringens enterotoxin produced during sporulation (4). This enterotoxin is not produced by all known strains. Enterotoxin effects only ensue after ingestion of a large number of life forms (108–109).

The occurrence of C. perfringens in people that have contact with apparently healthy animals and suffer from diarrhoea was high, with prevalence of 47.5% (Table 1). The sequence analysis of C. perfringens isolated from humans suffering from diarrhoea was found in the same cluster with sequences from cow, goat, and sheep, and in the same group as those isolated from water, soil, and fresh produce. These results elucidate the role of animals in transmitting C. perfringens to humans, either through humans having direct contact with these animals or through indirect contact by using contaminated water and soil in the cultivation of vegetables and fruits. This is supported by Al-Kharousi et al. (3) who identified some microbial communities of fresh imported fruits and vegetables. The authors isolated Enterobacteriaceae with 60% prevalence from fruits and 91% from vegetables, Enterococcus also was isolated from 20% of fruits and 42% of vegetables. E. coli and S. aureus were also isolated from 22% and 7% of vegetables, respectively. The different microbes in fresh fruits and vegetables can passthrough the stomach to the intestines where they set up the particular relationship with the host and bring their different consequences for human health (5). Further study of isolation of C. perfringens from fresh produce is required.

In conclusion, the role of apparently healthy animals in transmitting C. perfringens to humans being in contact with those animals was illuminated by sequence analysis of C. perfringens isolates’ α-toxin gene and was proved by the presence of the α-toxin gene sequence from human and animal isolates in the same cluster. This potentiates the enormous risk of transmission of C. perfringens. These animals can shed the organism in a continuous manner to the environment, including soil and water, and finally to fruit and vegetables during the cultivation and subsequent harvest or through surface contamination.

Footnotes

Conflict of Interests Statement: The authors declare that there is no conflict of interests regarding the publication of this article.

Financial Disclosure Statement: The authors declare that they did not have any funding source or grant to support their research work. The authors are committed to paying the publication fees with their own funds.

Ethics Statement: Ethical clearance to use human subjects was obtained from the designated health facility Cairo University, Giza, Egypt). Written consent was obtained from each person upon information on the use of samples.

Animal Rights Statement: Collection of samples was conducted according to the guidelines of the Ethical Committee of the Faculty of Veterinary Medicine, Cairo University, Egypt.

References

  • 1.Abd El-Moez S.I., Hamza D.A., Dorgham S.M., Ahmed B.M., Khairy E.A., Hedia R.A.. Molecular characterization and genetic diversity among Clostridium perfringens isolates. Int J Curr Microbiol App Sci. 2014;3:125–134. [Google Scholar]
  • 2.Akhi M.T., Asl S.B., Pirzadeh T., Naghili B., Yeganeh F., Memar Y., Mohammadzadeh Y.. Antibiotic sensitivity of Clostridium perfringens isolated from faeces in Tabriz, Iran. Jundishapur J Microbiol. 2015;8:e20863. doi: 10.5812/jjm.20863v2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Al-Kharousi Z.S., Guizani N., Al-Sadi A.M., Al-Bulushi I.M., Shaharoona B.. Hiding in fresh fruits and vegetables: opportunistic pathogens may cross geographical barriers. Inter J Microbiol. 2016;2016:1–14. doi: 10.1155/2016/4292417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Auricchio B. Clostridi patogeni degli alimenti. Istituto Superiore di Sanità, Centro Nazionale di Riferimento per il botulismo. University of Rome ‘Tor Vergata’; Rome: http://www.uniroma2.it/didattica/Scien.Nutr.Umana/deposito/Clostridi.pdf 19 March 2009. Accessed 06 July 2015. [Google Scholar]
  • 5.Berg G., Erlacher A., Smalla K., Krause R.. Vegetable microbiomes: is there a connection among opportunistic infections, human health and our ‘gut feeling’? Microbial Biotech. 2014;7:487–495. doi: 10.1111/1751-7915.12159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bezuidenhout C., Mthembu N., Puckree T., Lin J.. Microbiological evaluation of the Mhlathuze River, Kwazulu-Natal (RSA) Water S.A. 2002;28:281–286. [Google Scholar]
  • 7.Effat M.M., Abdallah Y.A., Soheir M.F., Rady M.M.. Characterization of Clostridium perfringens field isolates implicated in necrotic enteritis outbreaks on private broiler farms in Cairo by multiplex PCR. African J Micro Res. 2007:29–32. [Google Scholar]
  • 8.Fader R.C., Mahon C.R., Lehman D.C., Manuselis G. Textbook of diagnostic microbiology. W.B. Saunders Company; Philadelphia, USA: 2015. Anaerobes of clinical importance; pp. 495–528. [Google Scholar]
  • 9.Guo X., Chen J., Bracket R.E., Beuchat L.R.. Survival of salmonellae on and in tomato plants from the time of inoculation at flowering and early stages of fruit development through fruit ripening. Appl Environ Microbiol. 2001;67:4760–4764. doi: 10.1128/AEM.67.10.4760-4764.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Gurnari G. Safety protocols in the food industry and emerging concerns Springer Briefs in Chemistry of Foods. Springer; New York, Dordrecht, London: 2015. The chemistry of disinfection: ally or enemy? pp. 75–92. [Google Scholar]
  • 11.Harris L.J., Farber J.N., Beuchat L.R.. Outbreaks associated with fresh produce: incidence, growth, and survival of pathogens in fresh and fresh-cut produce. Comp Rev Food Sci Food Safety. 2003;2:78–141. [Google Scholar]
  • 12.Jung S.H., Hur M.J., Ju J.H., Kim K.A., Oh S.S., Go J.M., Kim Y.H., Im J.S.. Microbiological evaluation of raw vegetables. J Food Hyg Safety. 2006;21:250–257. [Google Scholar]
  • 13.Li J., Sayeed S., McClane B.A. Prevalence of enterotoxigenic Clostridium perfringens isolates in Pittsburgh (Pennsylvania) area soils and home kitchens. App Environ Microbiol. 2007;73:7218–7224. doi: 10.1128/AEM.01075-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Lukinmaa S., Takkunen E., Siitonen A.. Molecular epidemiology of C perfringens related to food-borne outbreaks of disease in Finland from. App Environ Microbiol 2002. 1984;68:3744–3749. doi: 10.1128/AEM.68.8.3744-3749.2002. to 1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.National Standard Method, Enumeration of Clostridium perfringens by membrane filtration. 2005;3(4) Issue no. Reference no W5i3.1. [Google Scholar]
  • 16.Sartory D.P., Field M., Curbishley S.M., Pritchard A.M.. Evaluation of two media for the membrane filtration enumeration of Clostridium perfringens from water. Lett Appl Microbiol. 1988;27:323–327. doi: 10.1046/j.1472-765x.1998.00454.x. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Veterinary Research are provided here courtesy of De Gruyter

RESOURCES