Skip to main content
In Vivo logoLink to In Vivo
. 2018 Nov 3;32(6):1427–1432. doi: 10.21873/invivo.11395

Geranylgeraniol-induced Myogenic Differentiation of C2C12 Cells

TAKUMA MATSUBARA 1, MARIKO URATA 1, TSUYOSHI NAKAJIMA 1, MARI FUKUZAKI 1, RYO MASUDA 1, YOSHIYUKI YOSHIMOTO 1, WILLIAM N ADDISON 2, CHIHIRO NAKATOMI 1, KAZMASA MORIKAWA 3, MIN ZHANG 4, KATSURA SAEKI 5, YUKIKO TAKAHASHI 6, ATSUKO NAKAMICHI 6, SHOICHIRO KOKABU 1
PMCID: PMC6365721  PMID: 30348697

Abstract

Background: Geranylgeraniol (GGOH) is a C20 isoprenoid found in fruits, vegetables, and grains, including rice. As a food substance, GGOH is categorized as ‘Generally Recognized as Safe’. GGOH is an intermediate product in the mevalonate pathway and acts as a precursor to geranylgeranyl­pyrophosphate. Materials and Methods: C2C12 mouse myoblasts derived from muscle satellite cells were used. Quantitative reverse-transcriptase polymerase chain reaction, western blotting analysis, and immunocytochemical analysis were performed to respectively assess mRNA expression, protein levels, and the number of myofibers. Results: GGOH reduced the expression levels of skeletal muscle atrophy-related ubiquitin ligases in myofibers derived from C2C12 cells. GGOH induced myogenic differentiation of C2C12 cells via geranylgeranylation. GGOH did not adversely affect the proliferation of C2C12 cells. Conclusion: GGOH induces myoblast differentiation in C2C12 cells.

Keywords: Sarcopenia, myogenesis, statin, geranylgeranylation, C2C12 cells


Satellite cells are skeletal muscle stem cells residing beneath the basal lamina that provide myonuclei for postnatal muscle growth, repair, and regeneration in adults. Satellite cells are activated in response to muscle injury, proliferate extensively and then differentiate into myoblasts. This is accompanied by the transcriptional up-regulation of myogenic differentiation (MYOD) and other myogenic differentiation marker genes, such as myogenin (MYOG), creatine kinase M-type (CKM), and myosin heavy chain (MYHC) (1-3). Insulin-like growth factors (IGFs) are essential for skeletal muscle development, regeneration, and hypertrophy – processes which all require satellite cell activation and differentiation (4-6). The autocrine action of IGF2 is especially critical for the differentiation of satellite cells in vitro (7). C2C12 cells are a murine myoblast cell line derived from satellite cells (8). C2C12 cells are commonly used as an in vitro model of muscle regeneration due to their ability to transition from a proliferative phase into differentiated myofibers, similar to satellite cells, upon adequate stimulus (3).

Statins act by inhibiting 3-hydroxy-3-methylgutaryl-coenzyme A reductase, the first step of the isoprenoid biosynthetic pathway and the rate-limiting step of cholesterol biosynthesis (9). Statins are used as a frontline therapy for lowering plasma cholesterol and preventing cardiovascular disease (10-13). Statins are generally safe and effective. However, they may induce a variety of skeletal muscle-associated, dose-dependent adverse reactions that range from muscle pain to muscle cell damage and severe rhabdomyolysis (14-17). These statin-associated muscle side-effects are prevalent in about 10% of patients (18). Statin-associated muscle disorders are likely due to inhibition of the synthesis of crucial intermediary molecules such as geranylpyrophosphate and geranylgeranylpyrophosphate (GGPP) (19-21). Treatment of C2C12 cells with GGPP was found to reverse the suppressive effect of statin on myotube formation (22). Geranylgeraniol (GGOH), a precursor to GGPP, reduced muscle cell damage induced by statin treatment in vitro (23). Thus, GGOH seems to have protective effects on skeletal muscle. However, the extent of this potentially beneficial effect remains unknown. In this study, the effect of GGOH on myogenesis in C2C12 cells was investigated.

Materials and Methods

Cell culture, transfection, and skeletal muscle differentiation. C2C12 murine myoblasts were purchased from American Type Culture Collection (Manassas, VA, USA). C2C12 cells were maintained as previously described (24) and cultured in the presence of 0, 5, 10, 50, or 100 μM GGOH (Sigma–Aldrich Chemicals, St. Louis, MO, USA) and 100 μM of the geranylgeranyltransferase I inhibitor N-[4-[2(R)-amino-3-mercaptopropyl]amino-2-(1-naphtha-lenyl)benzoyl]-L-leucine methyl ester trifluoroacetate salt (GGTI-298) (Tocris Bioscience, Bristol, UK). Skeletal muscle differentiation in C2C12 cells was induced by culturing cells with Dulbecco’s modified Eagle’s medium supplemented with 2% horse serum (Biosera, Kansas City, MO, USA) for 5-8 days (3).

Reverse transcription and quantitative polymerase chain reaction (qPCR) analysis. Total RNA was isolated from C2C12 cells using FastGene RNA Basic Kit (Nippon Genetics, Tokyo, Japan) and then reverse-transcribed into cDNA using the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan). SYBR green-based qPCR was performed in 96-well plates using PowerUp SYBR Green Master Mix (ThermoFisher Scientific, Waltham, MA, USA) with QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Values were normalized to β-actin (Actb) using the 2ΔΔCt method (25). The following primers were used for qPCR analyses: qPCR for murine Fbxo32: forward: agtgaggaccggctactgtg, reverse: gatcaaacgcttgcgaatct; tripartite motif containing 63 (Trim63): forward: tgacatctacaagcaggagtgc, reverse: tcgtcttcgtgttccttgc; murine Igf2: forward: cctccttacccaacttcaggt, reverse: aagagatgagaagcac caacatc; murine Myog: forward: ccttgctcagctccctca, reverse: tgggagttgcattcactgg; murine Myod: forward: agcactacagtggcgactca, reverse: ggccgctgtaatccatcat; murine Ckm: forward: cagcacagacag acactcagg, reverse: gaacttgttgt gggtgttgc; and murine Actb: forward: aaggccaaccgtgaaaagat, reverse: gtggtacgaccagaggcatac.

Proliferation assay. C2C12 cells were cultured in the presence of GGOH at concentrations of 0, 5, 10, 50, or 100 μM for 1, 2, or 3 days. Proliferation of C2C12 cells was assessed using Cell Counting Kit-8 (Dojindo, Kumamoto, Japan), according to the manufacturer's protocol.

ImmunocytochemicaI analysis. C2C12 cells were fixed by 4% formaldehyde for 10 min and incubated with primary antibodies for 1 hour at room temperature following blocking/permeabilization with phosphate-buffered saline containing 0.3% Triton X100 and 5% goat serum for 30 min at room temperature. Mouse monoclonal antibody to MYHC (R & D Systems, Minneapolis, MN, USA) was used for immunocytochemistry. The target protein was visualized using an Alexa 488-conjugated secondary antibody (Invitrogen, Carlsbad, CA, USA) and imaged with an ABZ-9000 microscope (Keyence, Tokyo, Japan).

Western blot analysis. The following mouse monoclonal antibodies were used for western blot analysis: anti-MYOG (Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-MYHC (R & D systems), and anti-ACTB (Sigma–Aldrich Chemicals). The target proteins were detected using an anti-mouse or anti-rabbit IgG antibody conjugated with a horseradish peroxidase (Cell Signaling, Beverly, MA, USA) and visualized by using ImmunoStar LD (WAKO, Osaka, Japan).

Statistical analysis. Comparisons were made using an unpaired Student’s t-test; the results are shown as the means±S.D. Statistical significance was defined as p&0.05.

Results

Firstly, it was confirmed whether GGOH protects skeletal muscle fibers derived from C2C12 cells from atrophy. Treatment of cells with 50 μM GGOH for 3 days reduced the expression levels of muscle atrophy-related ubiquitin ligase Fbxo32 (Figure 1A) and Trim63 (Figure 1B).

Figure 1. Geranylgeraniol (GGOH) reduces the expression levels ofskeletal muscle atrophy-related ubiquitin ligases in myofibers derived fromC2C12 cells. C2C12 cells were cultured with 2% horse serum for 5 daysand then treated with or without (CtrI) 50 μM GGOH for another 3 days.Total RNA was isolated, then F-box protein 32 (Fbxo32) (A) and tripartitemotif containing 63 (Trim63) (B) mRNA levels were analyzed usingquantitative polymerase chain reaction. All data are expressed as themean±SD (n=3). *Significantly different at p&0.01 versus vehicle-treatedcells. Similar results were obtained by three independent experiments.

Figure 1

Next, we examined the effect of GGOH on skeletal muscle differentiation in C2C12 cells. qPCR analysis revealed that although 50 μM GGOH treatment for 2 days did not change the expression level of Myod (Figure 2A), it did enhance the induction of early-stage myogenic marker genes such as Myog and Ckm (Figure 2B and C). GGOH treatment also led to a dose-dependent increase in the protein level of MYOG (Figure 2F) as well as of the late myoblast marker MYHC (Figure 2G and H). In addition, GGOH dramatically stimulated the expression level of Igf2 in C2C12 cells (Figure 2D). The positive effect of GGOH on the induction of Myog was blocked by the addition of the geranylgeranyl transferase inhibitor GGIT-298 (Figure 2I), suggesting that the augmentative effect of GGOH on myogenic differentiation is via geranlygeranylation. GGOH did not adversely affect the proliferation of C2C12 cells (Figure 3).

Figure 2. Geranylgeraniol (GGOH) induces myogenic differentiation of C2C12 cells via geranylgeranylation. C2C12 cells were treated with orwithout (CtrI) 50 μM GGOH for 2 days. Myogenic differentiation (Myod) (A), myogenin (Myog) (B), creatine kinase, M-type (Ckm) (C), and insulinlikegrowth factor-2 (Igf2) (D) mRNA levels were analyzed using quantitative polymerase chain reaction. All data are expressed as the mean±SD(n=3).*Significantly different at p&0.01 versus vehicle-treated cells. Cells were treated with 0, 5, 10, 50, or 100 μM GGOH for 3 (F) or 5 (G) days.The protein levels of MYOG (F) and myosin heavy chain (MYHC) (G) were assessed by western blotting analysis. Immunocytochemical analysiswas performed using antibody to MYHC on day 5. Scale bar represents 10 μm (H). Cells were treated with or without 50 μM GGOH in the presenceor absence of 100 μM GGTI-298 for 3 days. The protein levels of MYOG were determined by western blotting analysis (I). Similar results wereobtained by three independent experiments (F-I). Myogenic differentiation of C2C12 cells was induced by the treatment with Dulbecco’s modifiedEagle’s medium supplemented with 2% horse serum (Myo-Media) (A-F) .

Figure 2

Figure 3. Geranylgeraniol (GGOH) does not affect the proliferation ofC2C12 cells. C2C12 cells were cultured in the presence of 0, 5, 10, 50,or 100 μM GGOH for the indicated times. The proliferation of cells wasassessed using a Cell Counting Kit-8. All data are expressed as themean±SD (n=3).

Figure 3

Discussion

In the present study, we examined the effect of GGOH on fiber degradation, differentiation, and proliferation in C2C12 cells.

GGOH is a C20 isoprenoid found in fruits, vegetables, and grains, including rice. As a food substance, GGOH is categorized as ‘Generally Recognized as Safe’ (26). GGOH is an intermediate product in the mevalonate pathway and acts as a precursor to GGPP. In the cell, GGOH is thought to be subsequently converted into the pyrophosphate moiety, GGPP, by two successive monophosphorylation events (27). GGPP induces geranylgeranylation, which is necessary for the membrane localization of intracellular proteins, particularly the small GTP-binding proteins rat sarcoma virus oncogene (RAS), ras homolog family member (RHO), Rac family small GTPase (RAC) and Rap GTPase (RAP) (28). In our study, GGTI-298, an inhibitor of geranylgeranylation, eliminated GOOH-induced myoblast differentiation of C2C12 cells (Figure 2I), suggesting that GGOH-induced myogenesis requires geranylgeranylation of certain protein(s). Further experiments are needed to elucidate the mechanism that underlies GGOH-induced myoblast differentiation.

Inhibition of the isoprenoid biosynthetic pathway by statins may be involved in the occurrence of statin-associated muscle problems (19,21), suggesting that GGOH may be a potential drug for the prevention or treatment of statin-associated muscle problems without interfering with the beneficial plasma cholesterol-lowering effects of statins.

Skeletal muscle atrophy, such as observed during sarcopenia, is characterized by an associated loss of skeletal muscle mass and a decrease in muscle strength that impairs healthy life expectancy (29). The prevalence of sarcopenia is approximately 10% among adults aged 60 years or older (30), resulting in a cost of over US$18 billion in 2001 alone (31). Thus, there is an unmet and urgent need for strategies that will prevent the loss of skeletal muscle fibers and stimulate the proliferation and differentiation of skeletal muscle stem cells such as satellite cells for improving skeletal muscle mass and function.

In conclusion, we demonstrated that in C2C12 murine skeletal muscle myoblasts cells, GGOH reduced the expression of muscle atrophy-related genes and enhanced myogenic differentiation. Since GGOH is categorized as ‘Generally Recognized as Safe’ and can be taken orally (32), upon the establishment of a suitable protocol for GGOH treatment, our data will provide the basis for a new potential product for the treatment of muscle atrophy.

Conflicts of Interest

The Authors declare that they have no conflict of interests in regard to this study.

Acknowledgements

This study was supported by The Japan Health Foundation (S. K.).

References

  • 1.Montarras D, L'Honore A, Buckingham M. Lying low but ready for action: the quiescent muscle satellite cell. FEBS J. 2013;280:4036–4050. doi: 10.1111/febs.12372. [DOI] [PubMed] [Google Scholar]
  • 2.Zammit PS, Golding JP, Nagata Y, Hudon V, Partridge TA, Beauchamp JR. Muscle satellite cells adopt divergent fates: A mechanism for self-renewal. J Cell Biol. 2004;166:347–357. doi: 10.1083/jcb.200312007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Kokabu S, Nakatomi C, Matsubara T, Ono Y, Addison WN, Lowery JW, Urata M, Hudnall AM, Hitomi S, Nakatomi M, Sato T, Osawa K, Yoda T, Rosen V, Jimi E. The transcriptional co-repressor TLE3 regulates myogenic differentiation by repressing the activity of the MyoD transcription factor. J Biol Chem. 2017;292:12885–12894. doi: 10.1074/jbc.M116.774570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Florini JR, Ewton DZ, Magri KA. Hormones, growth factors, and myogenic differentiation. Annu Rev Physiol. 1991;53:201–216. doi: 10.1146/annurev.ph.53.030191.001221. [DOI] [PubMed] [Google Scholar]
  • 5.Rosenblatt JD, Yong D, Parry DJ. Satellite cell activity is required for hypertrophy of overloaded adult rat muscle. Muscle Nerve. 1994;17:608–613. doi: 10.1002/mus.880170607. [DOI] [PubMed] [Google Scholar]
  • 6.Barton-Davis ER, Shoturma DI, Sweeney HL. Contribution of satellite cells to IGF-I induced hypertrophy of skeletal muscle. Acta Physiol Scand. 1999;167:301–305. doi: 10.1046/j.1365-201x.1999.00618.x. [DOI] [PubMed] [Google Scholar]
  • 7.Florini JR, Magri KA, Ewton DZ, James PL, Grindstaff K, Rotwein PS. "Spontaneous" differentiation of skeletal myoblasts is dependent upon autocrine secretion of insulin-like growth factor-II. J Biol Chem. 1991;266:15917–15923. [PubMed] [Google Scholar]
  • 8.Yaffe D, Saxel O. Serial passaging and differentiation of myogenic cells isolated from dystrophic mouse muscle. Nature. 1977;270:725–727. doi: 10.1038/270725a0. [DOI] [PubMed] [Google Scholar]
  • 9.Endo A, Tsujita Y, Kuroda M, Tanzawa K. Inhibition of cholesterol synthesis in vitro and in vivo by ML-236A and ML-236B, competitive inhibitors of 3-hydroxy-3-methylglutaryl-coenzyme A reductase. Eur J Biochem. 1977;77:31–36. doi: 10.1111/j.1432-1033.1977.tb11637.x. [DOI] [PubMed] [Google Scholar]
  • 10.Tikkanen MJ, Nikkila EA. Current pharmacologic treatment of elevated serum cholesterol. Circulation. 1987;76:529–533. doi: 10.1161/01.cir.76.3.529. [DOI] [PubMed] [Google Scholar]
  • 11.Illingworth DR, Sexton GJ. Hypocholesterolemic effects of mevinolin in patients with heterozygous familial hypercho-lesterolemia. J Clin Invest. 1984;74:1972–1978. doi: 10.1172/JCI111618. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hoeg JM, Maher MB, Zech LA, Bailey KR, Gregg RE, Lackner KJ, Fojo SS, Anchors MA, Bojanovski M, Sprecher DL, Brewer HB Jr. Effectiveness of mevinolin on plasma lipoprotein concentrations in type II hyperlipoproteinemia. Am J Cardiol. 1986;57:933–939. doi: 10.1016/0002-9149(86)90733-2. [DOI] [PubMed] [Google Scholar]
  • 13.Grundy SM, Vega GL. Influence of mevinolin on metabolism of low density lipoproteins in primary moderate hypercholesterolemia. J Lipid Res. 1985;26:1464–1475. [PubMed] [Google Scholar]
  • 14.Thompson PD, Clarkson P, Karas RH. Statin-associated myopathy. Jama. 2003;289:1681–1690. doi: 10.1001/jama.289.13.1681. [DOI] [PubMed] [Google Scholar]
  • 15.Pasternak RC, Smith SC Jr., Bairey-Merz CN, Grundy SM, Cleeman JI, Lenfant C, American College of C, American Heart A, National Heart L, Blood I. ACC/AHA/NHLBI Clinical Advisory on the Use and Safety of Statins. Circulation. 2002;106:1024–1028. doi: 10.1161/01.cir.0000032466.44170.44. [DOI] [PubMed] [Google Scholar]
  • 16.McKenney JM, Davidson MH, Jacobson TA, Guyton JR, National Lipid Association Statin Safety Assessment Task F. Final conclusions and recommendations of the National Lipid Association Statin Safety Assessment Task Force. Am J Cardiol. 2006;97:89C–94C. doi: 10.1016/j.amjcard.2006.02.030. [DOI] [PubMed] [Google Scholar]
  • 17.Sathasivam S. Statin induced myotoxicity. Eur J Intern Med. 2012;23:317–324. doi: 10.1016/j.ejim.2012.01.004. [DOI] [PubMed] [Google Scholar]
  • 18.Venero CV, Thompson PD. Managing statin myopathy. Endocrinol Metab Clin North Am. 2009;38:121–136. doi: 10.1016/j.ecl.2008.11.002. [DOI] [PubMed] [Google Scholar]
  • 19.Bhardwaj S, Selvarajah S, Schneider EB. Muscular effects of statins in the elderly female: A review. Clin Interv Aging. 2013;8:47–59. doi: 10.2147/CIA.S29686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Nishimoto T, Tozawa R, Amano Y, Wada T, Imura Y, Sugiyama Y. Comparing myotoxic effects of squalene synthase inhibitor, T-91485, and 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors in human myocytes. Biochem Pharmacol. 2003;66:2133–2139. doi: 10.1016/j.bcp.2003.08.011. [DOI] [PubMed] [Google Scholar]
  • 21.Matzno S, Yamauchi T, Gohda M, Ishida N, Katsuura K, Hanasaki Y, Tokunaga T, Itoh H, Nakamura N. Inhibition of cholesterol biosynthesis by squalene epoxidase inhibitor avoids apoptotic cell death in L6 myoblasts. J Lipid Res. 1997;38:1639–1648. [PubMed] [Google Scholar]
  • 22.Baba TT, Nemoto TK, Miyazaki T, Oida S. Simvastatin suppresses the differentiation of C2C12 myoblast cells via a RAC pathway. J Muscle Res Cell Motil. 2008;29:127–134. doi: 10.1007/s10974-008-9146-9. [DOI] [PubMed] [Google Scholar]
  • 23.Cao P, Hanai J, Tanksale P, Imamura S, Sukhatme VP, Lecker SH. Statin-induced muscle damage and atrogin-1 induction is the result of a geranylgeranylation defect. FASEB J. 2009;23:2844–2854. doi: 10.1096/fj.08-128843. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kokabu S, Ohte S, Sasanuma H, Shin M, Yoneyama K, Murata E, Kanomata K, Nojima J, Ono Y, Yoda T, Fukuda T, Katagiri T. Suppression of BMP-SMAD signaling axis-induced osteoblastic differentiation by small C-terminal domain phosphatase 1, a Smad phosphatase. Mol Endocrinol. 2011;25:474–481. doi: 10.1210/me.2010-0305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(–Delta Delta C(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 26.Muraguchi T, Okamoto K, Mitake M, Ogawa H, Shidoji Y. Polished rice as natural sources of cancer-preventing geranylgeranoic acid. J Clin Biochem Nutr. 2011;49:8–15. doi: 10.3164/jcbn.10-110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Frenkel J, Rijkers GT, Mandey SH, Buurman SW, Houten SM, Wanders RJ, Waterham HR, Kuis W. Lack of isoprenoid products raises ex vivo interleukin-1beta secretion in hyperimmuno-globulinemia D and periodic fever syndrome. Arthritis Rheum. 2002;46:2794–2803. doi: 10.1002/art.10550. [DOI] [PubMed] [Google Scholar]
  • 28.Walker K, Olson MF. Targeting Ras and Rho GTPases as opportunities for cancer therapeutics. Curr Opin Genet Dev. 2005;15:62–68. doi: 10.1016/j.gde.2004.11.001. [DOI] [PubMed] [Google Scholar]
  • 29.Delmonico MJ, Harris TB, Lee JS, Visser M, Nevitt M, Kritchevsky SB, Tylavsky FA, Newman AB, Health A, Body Composition S. Alternative definitions of sarcopenia, lower extremity performance, and functional impairment with aging in older men and women. J Am Geriatr Soc. 2007;55:769–774. doi: 10.1111/j.1532-5415.2007.01140.x. [DOI] [PubMed] [Google Scholar]
  • 30.Cruz-Jentoft AJ, Baeyens JP, Bauer JM, Boirie Y, Cederholm T, Landi F, Martin FC, Michel JP, Rolland Y, Schneider SM, Topinkova E, Vandewoude M, Zamboni M, European Working Group on Sarcopenia in Older P. Sarcopenia: European consensus on definition and diagnosis: Report of the European Working Group on Sarcopenia in Older People. Age Ageing. 2010;39:412–423. doi: 10.1093/ageing/afq034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Janssen I, Shepard DS, Katzmarzyk PT, Roubenoff R. The healthcare costs of sarcopenia in the United States. J Am Geriatr Soc. 2004;52:80–85. doi: 10.1111/j.1532-5415.2004.52014.x. [DOI] [PubMed] [Google Scholar]
  • 32.Giriwono PE, Shirakawa H, Ohsaki Y, Hata S, Kuriyama H, Sato S, Goto T, Komai M. Dietary supplementation with geranylgeraniol suppresses lipopolysaccharide-induced inflammation via inhibition of nuclear factor-kappaB activation in rats. Eur J Nutr. 2013;52:1191–1199. doi: 10.1007/s00394-012-0429-y. [DOI] [PubMed] [Google Scholar]

Articles from In Vivo are provided here courtesy of International Institute of Anticancer Research

RESOURCES