Cucurbit aphid-borne yellows virus (CABYV) was first described in France in 1992 and since then has been reported in various parts of the world, including the United States. Here, we present the first complete genome sequence of a CABYV isolate (BL4) that was collected from pumpkin during the 2017 growing season in Oklahoma.
ABSTRACT
Cucurbit aphid-borne yellows virus (CABYV) was first described in France in 1992 and since then has been reported in various parts of the world, including the United States. Here, we present the first complete genome sequence of a CABYV isolate (BL4) that was collected from pumpkin during the 2017 growing season in Oklahoma.
ANNOUNCEMENT
Cucurbits are economically important cash crops in the United States and are mostly grown in the southern states, including Texas and Florida, which are the two major watermelon-producing states (1). CABYV belongs to the genus Polerovirus in the family Luteoviridae (2) and was first reported in France in 1992 (3). The virus causes yellowing and thickening of the older leaves in cucurbit plants and is often mistakenly attributed as a nutrient deficiency. Although the major veins of younger leaves would remain green after the infection, plant yield may be reduced (3). The virus is transmitted primarily by Aphis gossypii Glover and Myzus persicae Sulzer, and the transmission could be circulative, persistent, and nonpropagative (4, 5). CABYV has been reported from cucurbit crops across different climatic regions of the world such as temperate, Mediterranean, and subtropical (6), and no mechanical transmission has been reported (7). The main constraint for the management of diseases caused by members of Luteoviridae is that no effective strategy exists to cure plants after virus infection (8).
It has been nearly two and half decades since the first report of CABYV in the United States (9); however, to our knowledge, no complete genome sequence of any CABYV isolate from the United States has been reported so far. In this work, we report the first complete genome sequence of a CABYV isolate collected from a grower’s field in Oklahoma.
Previously, we reported CABYV for the first time from commercial cucurbit fields in Blaine County in Oklahoma (10). One of the dot-immunobinding assay (DIBA)-positive samples (10) against the CABYV antibody (designated as CABYV isolate BL4) was used in this work.
Total RNA was extracted from the CABYV-infected leaf tissues of pumpkin (11). Seven pairs of overlapping primers were designed (Table 1) and synthesized commercially (IDT Technologies, USA) from the previous CABYV isolates available from GenBank. All seven genome fragments were amplified by reverse transcription-PCR (RT-PCR) with the respective primer pairs using total RNA as the template, as described previously (11). Both 5′ end and 3′ end rapid amplification of cDNA ends (RACE) was performed using a commercial kit (TaKaRa Bio, Inc., Japan). Expected PCR products were analyzed and confirmed on 1% agarose gels and cleaned with Exosap-IT (Affymetrix). Purified PCR products were directly sequenced in both directions using an Applied Biosystems 3130 instrument.
TABLE 1.
Primers used in RT-PCR to amplify the complete genome of Cucurbit aphid-borne yellow virus
| Primer name | Primer sequence | Product size (nucleotides) |
|---|---|---|
| CABYVF1 | ACAAAAGATACGAGCGGGTGA | 665 |
| CABYVR1 | GCAAGTCGCCAAAAATCCAA | |
| CABYV F2 | AGAGAGTCTGCTCCACGTGA | 1,099 |
| CABYV R2 | GAGACTGTGCGTCTCCACTT | |
| CABYV F3 | CGACCGCCGAAACAACCG | 1,168 |
| CABYVR3 | TGCTCATCCGTAGACAAGCC | |
| CABYVF4 | AACAAGCGCGAGATAGCGTT | 998 |
| CABYVR4 | CGCCTCCCTGCATTTTGATT | |
| CABYVCP5 | ATGAATACGGCCGCGGCTAGAAATC | 600 |
| CABYVCP5 | CTATTTCGGGTTCTGGACCTGGCA | |
| CABYVF6 | AACGGATCTTCCTCGGTTGC | 1,320 |
| CABYVR6 | CACTTTCTCGTCTCTTCGTC | |
| CABYV F7 | CACAGCCCACCCGGACTATA | 544 |
| CABYVR7 | ACACCGAAACGCCAGGGG |
Nucleotide sequences of each genome fragment were confirmed and assembled using DNASTAR Lasergene 13 (Madison, WI) software. Sequences of all fragments were aligned using both Clustal W v2.1 (12) and Muscle v3.8.31 (13) alignment tools by joining overlapping sequences to generate the complete genome sequence of CABYV.
After the alignment, the complete genome sequence of the CABYV BL4 isolate is 5,679 nucleotides long (G+C content, 49.8%). Nucleotide BLAST searches showed that the CABYV BL4 isolate shares 85% to 97% nucleotide and 81% to 96% amino acid sequence identities with the available CABYV complete genomes in the GenBank database. The highest nucleotide (97%) and amino acid (96%) sequence similarities were observed with a Chinese isolate (GenBank accession no. EU000535) (14).
Data availability.
The complete genome sequence of the CABYV BL4 isolate was deposited in GenBank under accession no. MK055337.
ACKNOWLEDGMENTS
This publication was supported by the U.S. Department of Agriculture (USDA) Agricultural Marketing Service through grant no. 15SCBGPOK0019. Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the USDA.
REFERENCES
- 1.Ali A, Abdalla O, Bruton B, Fish W, Sikora E, Zhang S, Taylor M. 2012. Occurrence of viruses infecting watermelon, other cucurbits, and weeds in the parts of southern United States. Plant Health Prog doi: 10.1094/PHP-2012-0824-01-RS. [DOI] [Google Scholar]
- 2.King A, Adams M, Carstens E, Lefkowitz E. 2012. Virus taxonomy: ninth report of the International Committee on Taxonomy of Viruses. Academic Press, London, United Kingdom. [Google Scholar]
- 3.Lecoq H, Bourdin D, Wipf-Scheibel C, Bon M, Lot H, Lemaire O, Herrbach E. 1992. A new yellowing disease of cucurbits caused by a Luteovirus, Cucurbit aphid-borne yellows virus. Plant Pathol 41:749–761. doi: 10.1111/j.1365-3059.1992.tb02559.x. [DOI] [Google Scholar]
- 4.Dogimont C, Slama S, Martin J, Lecoq H, Pitrat M. 1996. Sources of resistance to Cucurbit aphid-borne yellows Luteovirus in a melon germ plasm collection. Plant Dis 80:1379–1382. doi: 10.1094/PD-80-1379. [DOI] [Google Scholar]
- 5.Gray S, Cilia M, Ghanim M. 2014. Circulative, “nonpropagative” virus transmission: an orchestra of virus-, insect-, and plant-derived instruments. Adv Virus Res 89:141–199. doi: 10.1016/B978-0-12-800172-1.00004-5. [DOI] [PubMed] [Google Scholar]
- 6.Lecoq H. 1999. Epidemiology of Cucurbit aphid-borne yellows virus, p 243–248. In Smith HG, Baker H (ed). The Luteoviridae. CABI Publishing, Wallingford, United Kingdom. [Google Scholar]
- 7.D’Arcy CJ, Domier LL. 2005. Luteoviridae, p 891–900. In Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA (ed). Virus taxonomy, VIIIth report of the ICTV. Elsevier/Academic Press, London, United Kingdom. [Google Scholar]
- 8.Michelle H, Veronique B. 2018. Targeted disruption of aphid transmission: a vision for the management of crop diseases caused by Luteoviridae members. Curr Opin Virol 33:24–32. doi: 10.1016/j.coviro.2018.07.007. [DOI] [PubMed] [Google Scholar]
- 9.Lemaire OJ, Gubler WD, Valencia J, Lecoq H, Falk BW. 1993. First report of Cucurbit aphid borne yellows Luteovirus in the United States. Plant Dis 77:1169. doi: 10.1094/PD-77-1169B. [DOI] [Google Scholar]
- 10.Khanal V, Ali A. 2018. First report of Cucurbit aphid-borne yellows virus infecting Cucurbita pepo in Oklahoma. Plant Dis 102:1046. doi: 10.1094/PDIS-10-17-1675-PDN. [DOI] [Google Scholar]
- 11.Ali A, Mohammad O, Khattab A. 2012. Distribution of viruses infecting cucurbit crops and isolation of potential new virus-like sequences from weeds in Oklahoma. Plant Dis 96:243–248. doi: 10.1094/PDIS-05-11-0419. [DOI] [PubMed] [Google Scholar]
- 12.Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, Remmert M, Söding J, Thompson JD, Higgins DG. 2014. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7:539. doi: 10.1038/msb.2011.75. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32:1792–1797. doi: 10.1093/nar/gkh340. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Xiang HY, Shang QX, Han CG, Li DW, Yu JL. 2008. Complete sequence analysis reveals two distinct Poleroviruses infecting cucurbits in China. Arch Virol 153:1155–1160. doi: 10.1007/s00705-008-0083-0. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The complete genome sequence of the CABYV BL4 isolate was deposited in GenBank under accession no. MK055337.