Abstract
In the present study, an Escherichia coli whole cell system with overexpression of a cytochrome P450 oxidase SlgO1 involved in streptolydigin biosynthetic pathway, an E. coli flavodoxin NADP+ oxidoreductase (EcFLDR), and an E. coli flavodoxin A (EcFLDA) were constructed. Biotransformation experiments revealed that SlgO1 can convert tirandamycin C to tirandamycin F, indicating that it can introduce a hydroxyl group into the C-10 position of tirandamycin C. Subsequently, slgO1 was cloned into pSET152AKE vector under the downstream of ermE* promoter, which was, respectively, introduced into Streptomyces sp. SCSIO1666 (tirandamycin B producer), Streptomyces sp. Ju1008 (tirandamycin C producer), and Streptomyces sp. Ju1009 (tirandamycin E producer). A novel tirandamycin derivative tirandamycin L accumulated in the engineered strain Streptomyces sp. Ju1008::slgO1 was isolated and its structure was determined on the basis of nuclear magnetic resonance (NMR) and mass spectrometry. Unlike most of the identified tirandamycins, tirandamycin L possessed a rare C-11–C-12 saturated bond as well as a C-10 ketone moiety. In addition, tirandamycin L showed weaker antibacterial activity. Based on the structure of tirandamycin L, SlgO1 was proposed to be responsible for multiple modifications toward tirandamycin C, including the formation of C-10 hydroxyl and C-11–C-12 saturated bond.
Electronic supplementary material
The online version of this article (10.1007/s13205-019-1611-1) contains supplementary material, which is available to authorized users.
Keywords: Tirandamycins, Streptolydigin, Cytochrome P450 oxidase SlgO1, Combinatorial biosynthesis
Introduction
The cytochrome P450 oxidases (CYP450s) are heme-dependent enzymes which are ubiquitous in a wild range of organisms (Coon 2005; Munro et al. 2013). The enzymes of this family are involved in diverse reactions, and play important roles in steroid synthesis, xenobiotic catabolism, and biosynthesis of secondary metabolites (Lewis and Wiseman 2005; Munro et al. 2013; Alkhalaf et al. 2019). In biosynthetic pathways of microbial secondary metabolites, the CYP450s often catalyze regio- and stereo-selectivity oxidations of precursors, leading to the structural diversification of the parental compounds as well as improved biological properties (Cochrane and Vederas 2014; Rudolf et al. 2017; Zhang and Li 2017). Up to now, a great number of CYP450s involved in biosynthetic pathways of natural products have been characterized, and many CYP450s catalyzing uncommon reactions have emerged (Rudolf et al. 2017; Zhang and Li 2017). Nowadays, CYP450s are important biocatalysts and making fundamental contributions to synthetic biology and biosynthesis of natural products (Bernhardt and Urlacher 2014; Girvan and Munro 2016; Zhou et al. 2019).
Tirandamycins, streptolydigin, and nocamycins belong to a small family of tetramic acid natural products featured with a bicyclic ketal moiety (Fig. 1) (Mo et al. 2014). Biosynthetically, the backbones of tirandamycin, streptolydigin, and nocamycins are assembled by hybrid type I polyketide synthase and non-ribosomal peptide synthetase (Olano et al. 2009; Carlson et al. 2010; Mo et al. 2011a, 2017). In tirandamycin biosynthetic pathway, the multifunctional CYP450 TamI catalyzes the formation of C-10 hydroxyl, C-11 and C-12 epoxy ring, and C-18 hydroxyl group (Carlson et al. 2011). As for streptolydigin, two CYP450s, SlgO1 and SlgO2, are located within the biosynthetic gene cluster, and SlgO2 has been proposed to be involved in the formation of bicyclic ketal moiety on basis of gene disruption experiment (Gómez et al. 2012). For the high similarity between SlgO1 and TamI, Gómez et al. (2012) have suggested that SlgO1 might catalyze the formation of epoxy moiety during streptolydigin biosynthesis. By comparison of TrdI and SlgO1 sequences, it has been found that SlgO1 shows 70% identity/82% similarity to TamI/TrdI. Considering the high structural similarity in bicyclic ketal moiety, we assume that SlgO1 might modify the structure of tirandamycins.
Fig. 1.
The structures of tirandamycins, streptolydigin, and nocamycin I
In the current study, an Escherichia coli whole cell system with overexpression of SlgO1, an E. coli flavodoxin NADP+ oxidoreductase (EcFLDR), and an E. coli flavodoxin A (EcFLDA) were constructed, which can catalyze the biotransformation of tirandamycin C to tirandamycin F. Moreover, slgO1 gene was also introduced into various tirandamycin-producing strains, including tirandamycin B (1) producer Streptomyces sp. SCSIO1666 (Duan et al. 2010), tirandamycin C (3) producer Streptomyces sp. Ju1008 (Mo et al. 2011a), and tirandamycin E (5) producer Streptomyces sp. Ju1009 (Mo et al. 2011b). From the engineered strain Streptomyces sp. Ju1008::slgO1, we isolated an unexpected derivative tirandamycin L. By comparison with tirandamycin B, tirandamycin L showed inferior antibacterial activity.
Materials and methods
Bacteria, plasmids, primers, and culture conditions
The bacteria and plasmids used in this study are listed in Table 1. The primers used in this study are listed in Table 2. The culture conditions used for all the Streptomycetes in agar or liquid media were followed as the literature described previously (Mo et al. 2011a). All E. coli strains were cultured on Luria–Bertani (LB) medium with appropriate antibiotics (Mo et al. 2011a).
Table 1.
Bacteria and plasmids used in this study
| Strains or plasmids | Description | Reference or source |
|---|---|---|
| Strains | ||
| E. coli DH5α | Host strain for general clone | Stratagene |
| E. coli ET12567/pUZ8002 | Host strain for conjugation, KanR, CmlR | Macneil et al. (1992) |
| E. coli BL21 (DE3) | Host strain for protein expression | Stratagene |
| E. coli FLDR/FLDA/slgO1 | E. coli BL21 (DE3) carrying plasmids pACYCDuet-1/FLDR/FLDA and pET-28a/slgO1 | This study |
| E. coli FLDR/FLDA/pET | E. coli BL21 (DE3) carrying pACYCDuet-1/FLDR/FLDA and empty pET-28a(+) | This study |
| Streptomyces lydicus | Streptolydigin producing strain, harboring slgO1 | NRRL2433 |
| Streptomyces sp. SCSIO1666 | Tirandamycin B producing strain | Duan et al. (2010) |
| Streptomyces sp. Ju1008 | Terminal product is tirandamycin C, ΔtrdI, AprR | Mo et al. (2011a) |
| Streptomyces sp. Ju1009 | Terminal product is tirandamycin E, ΔtrdL, AprR | Mo et al. (2011b) |
| Streptomyces sp. SCSIO1666::slgO1 | Heterologous expression of slgO1 in Streptomyces sp. SCSIO1666, AprR, KanR | This study |
| Streptomyces sp. Ju1008::slgO1 | Heterologous expression of slgO1 in Streptomyces sp. Ju1008, AprR, KanR | This study |
| Streptomyces sp. Ju1009::slgO1 | Heterologous expression of slgO1 in Streptomyces sp. Ju1009, AprR, KanR | This study |
| Bacillus subtilis | Antibiotic sensitive strain, indicator for antibacterial assay | CCTCC AB2013121 |
| Bacillus thuringiensis | Antibiotic sensitive strain, indicator for antibacterial assay | CCTCC AB2013119 |
| Staphylococcus aureus | Antibiotic sensitive strain, indicator for antibacterial assay | ATCC 29213 |
| Plasmids | ||
| pCR™2.1 | Vector for TA clone, KanR, AmpR | ThermoFisher |
| pSET152AKE | oriT, integrase gene, intΦ31 site, AprR, KanR, emrE* | Ma et al. (2011) |
| pSET152AKE/slgO1 | Derived from pSET152AKE, harboring slgO1 gene | This study |
| pACYCDuet-1 | Vector for protein co-expression, CmlR | Novagen |
| pACYCDuet-1/FLDR/FLDA | Co-expression plasmid carrying E. coli flavodoxin NADP+ oxidoreductase and flavodoxin A gene | This study |
KanR, kanamycin resistant; AprR, apramycin resistant; CmlR, chloramphenicol resistant; AmpR, ampicillin resistance
Table 2.
The primers used in this study
| Primer name | Sequence (5′–3′)a | Restriction enzyme site |
|---|---|---|
| SlgO1-expF | GTACATACATATGATGTCAGAGAACCCGGTCCG | NdeI |
| SlgO1-expR1 | ATCGGATCCTCACGCGCGGTGCAGACGGA | BamHI |
| SlgO-expR2 | TCACTAGTTCACGCGCGGTGCAGACGGA | SpeI |
| Fpr2-F | GGATCCTATGGCTGATTGGGTAACAGGCAAAG | BamHI |
| Fpr2-R | GCGGCCGCTTACCAGTAATGCTCCGCTGTCATA | NotI |
| FldA2-F | GATATCCATGGCTATCACTGGCATCTTTTTCG | EcoRV |
| FldA2-R | CTCGAGTCAGGCATTGAGAATTTCGTCGAG | XhoI |
| SlgO1-tF | ATGTCAGAGAACCCGGTCCG | |
| SlgO1-tR | TCACGCGCGGTGCAGACGGA |
aUnderline is the restriction endonuclease cleavage site
Construction of an E. coli strain for co-expression of SlgO1, EcFLDR, and EcFLDA and in vivo biotransformation of tirandamycins
The slgO1 gene fragment (accession No. CBA11578) was amplified from the Streptomyces lydicus genomic DNA with the primer pair SlgO1-expF and SlgO1-expR1. The primer pairs Fpr2-F/Fpr2-R and FldA2-F/FldA2-R were used to amplify EcFLDR gene and EcFLDA gene from E. coli genomic DNA, respectively. The PCR products with expected size were recovered, ligated into pCR™ 2.1 vector, and introduced into E. coli DH5α, respectively. After confirming the inserted fragments by sequencing, the EcFLDR gene and EcFLDA gene fragments were excised by appropriate restriction enzymes and directly cloned into pACYCDuet-1 vector digested by the same enzymes to yield plasmid pACYCDuet-1/FLDR/FLDA. The slgO1 gene was excised from pCR™ 2.1 vector and cloned into pET-28a to afford plasmid pET-28a/slgO1. Then, the plasmids pACYCDuet-1/FLDR/FLDA and pET-28a/slgO1 were co-transformed into E. coli BL21 (DE3) to afford E. coli FLDR/FLDA/slgO1. And the plasmid pACYCDuet-1/FLDR/FLDA and empty pET-28a(+) vector were introduced into E. coli BL21 (DE3) to yield E. coli FLDR/FLDA/pET as an negative control strain.
The procedures for biotransformation were described as follows: 30 µL overnight cultures of E. coli FLDR/FLDA/slgO1 or E. coli FLDR/FLDA/pET were inoculated in 3 mL LB broth with the antibiotic chloramphenicol (25 µg/mL) and kanamycin (50 µg/mL). When E. coli BL21 were grown to OD600 about 0.6, isopropyl β-d-1-thiogalactopyranoside (IPTG) and tirandamycin derivatives (tirandamycin C, tirandamycin D, tirandamycin A, and tirandamycin E) were added at a final concentration of 0.1 mM. After additional 36 h culture at 28 °C, 200 rpm, the broths were collected and extracted by ethyl acetate. The organic phase was evaporated into dryness and re-dissolved in 100 µL methanol, and 40 µL was subjected to HPLC for analysis.
Construction of the plasmid pSET152AKE/slgO1
The primer pair SlgO1-expF and SlgO-expR2 was used to amplify the slgO1 gene fragment. The resultant PCR product was digested with SpeI–NdeI and cloned into the downstream of ermE* promoter of the vector pSET152AKE. The plasmid with inserted DNA was sequenced for verification, and the plasmid with the correct sequences was designated as pSET152AKE/slgO1.
Construction, fermentation, and HPLC analysis of the engineered strains derived from Streptomyces sp. SCSIO1666
The plasmids pSET152AKE and pSET152AKE/slgO1 were independently introduced into E. coli ET12567/pUZ8002 to afford E. coli ET12567/pUZ8002/pSET152AKE and E. coli ET12567/pUZ8002/pSET152AKE/slgO1, which were used for further conjugation with Streptomyces sp. SCSIO1666, Streptomyces sp. Ju1008, and Streptomyces sp. Ju1009, respectively. The procedures for conjugation are followed the literature reported previously (Mo et al. 2011a). The exconjugants were first screened by the phenotype KanRAprR, and their genotypes were further confirmed using PCR with the primer pair SlgO1-tF and SlgO1-tR targeted the slgO1 gene. The expected PCR fragments were sequenced and the correct strains were designated as Streptomyces sp. SCSIO1666::slgO1, Streptomyces sp. Ju1008::slgO1, Streptomyces sp. Ju1009::slgO1, Streptomyces sp. SCSIO1666::pSET152AKE, Streptomyces sp. Ju1008::pSET152AKE, and Streptomyces sp. Ju1009::pSET152AKE, which were cultured using AM2 medium for 7 days and the broths were analyzed by HPLC as reported previously (Mo et al. 2011a).
Isolation and spectroscopic analyses of the newly produced compound from Streptomyces sp. Ju1008::slgO1
For structural characterization of the newly produced derivative, Streptomyces sp. Ju1008::slgO1 was fermented with AM2 medium in a large scale (6 L). After incubation, the culture broth was harvested and centrifuged. The supernatant was extracted by ethyl acetate and the mycelium was extracted by acetone, respectively. Subsequently, the entire organic phase was evaporated to dryness to yield crude extract. The crude extract was dissolved in a mixture of CH3OH:CHCl3 (1:1), mixed with appropriate amount of silica gel, which was applied on normal phase silica gel column chromatography and eluted with CHCl3/CH3OH (100/0, 98/2, 96/4, 94/6, 90/10, 85/15, 80/20, 70/30, 60/40, 50/50, v/v, each gradient was 300 mL) to give ten fractions (Fr.1–Fr.10). All fractions were analyzed by HPLC. Fractions 3 and 4 contained the targeted compound. The fractions 3 and 4 were combined and further purified on reverse phase C-18 silica gel eluted by a linear gradient from 20 to 90% CH3CN in water. The 80–85% CH3CN elution fraction which contained targeted compound was collected and further purified by preparative HPLC to afford compound 7.
The purified compound was subjected to high-resolution mass spectroscopy (HR-MS), 1H, and 13C NMR spectra analysis. 1H and 13C NMR spectra were recorded on Bruker AV 500 instrument at 25 °C. HR–MS spectra data were acquired on a Waters micro MS Q-Tof spectrometer.
Antibacterial assays of tirandamycin B and tirandamycin L
The antibacterial activities of tirandamycin B and tirandamycin L toward Bacillus subtilis, Bacillus thuringiensis, and Staphylococcus aureus were evaluated. The minimal inhibitory concentrations (MICs) were determined by the broth microdilution method (Xiao et al. 2013).
Results
Biotransformation of tirandamycins using E. coli whole cell system with overexpression of SlgO1, EcFLDR, and EcFLDA
For bacterial CYP450s, two redox partner proteins are required, which are not often adjacent to CYP450s. In both biosynthetic gene cluster of tirandamycin and streptolydigin, the ferredoxin and ferredoxin reductase are not clustered with the CYP450s. Since some CYP450s activities have been reconstructed using redox partner proteins EcFLDR and EcFLDA derived from E. coli (McIver et al. 1998), we here constructed an E. coli BL21 (DE3) whole cell system with co-expression of SlgO1, EcFLDR, and EcFLDA.
The biotransformation capability of tirandamycin C, D, E, and A was investigated using E. coli BL21 (DE3) whole cell system carrying SlgO1, EcFLDR, and EcFLDA. As shown in Fig. 2, when tirandamycin C was used as a substrate, a new polar peak with the characterized UV absorption spectra to tirandamycins appeared. The new peak showed the identical retention time to that of the authentic tirandamycin F. Furthermore, LC–MS analysis demonstrated that it had the same molecular mass to tirandamycin F. Therefore, these results demonstrated that SlgO1 can catalyze the hydroxylation in the C-10 position to yield tirandamycin F. No biotransformation of other tirandamycins was observed in the other samples.
Fig. 2.
HPLC analysis of in vivo biotransformation: (I) tirandamycin C (3) with control strain E. coli FLDR/FLDA/pET, (II) 3 with E. coli FLDR/FLDA/slgO1, (III) tirandamycin D (4) with E. coli FLDR/FLDA/pET, (IV) 4 with E. coli FLDR/FLDA/slgO1, (V) tirandamycin E (5) with control E. coli FLDR/FLDA/pET, (VI) 5 with E. coli FLDR/FLDA/slgO1, (VII) tirandamycin A (2) with control E. coli FLDR/FLDA/pET, (VIII) 2 with E. coli FLDR/FLDA/slgO1, and (IX) tirandamycin F (6) standard
Construction, fermentation, and HPLC analysis of strains derived from Streptomyces sp. SCSIO1666
It has been widely found that the substrate preference and catalysis efficiency of CYP450s are associated with the redox partner proteins (Munro et al. 2007). To use the redox partner proteins originated from tirandamycin-producing strains, the slgO1 gene was cloned into pSET152AKE vector under the downstream of ermE* promoter, which was then introduced into Streptomyces sp. SCSIO1666 and its derived strains such as Streptomyces sp. Ju1008 (tirandamycin C producer; deletion of CYP450 gene trdI) and Streptomyces sp. Ju1009 (tirandamycin E producer; deletion of FAD-dependent oxidase gene trdL). Subsequently, a series of Streptomyces sp. SCSIO1666 derivatives carrying emerE*–slgO1 cassette were constructed (Table 1, Figure S1). The fermentation broths of Streptomyces sp. 1666::slgO1, Streptomyces sp. Ju1008::slgO1, and Streptomyces sp. Ju1009::slgO1 were analyzed by HPLC. By comparison of Streptomyces sp. Ju1008::pSET152AKE, a new polar peak with the characterized UV absorption spectra to tirandamycin was detected in the extract of Streptomyces sp. Ju1008::slgO1 (Fig. 3a). However, no additional tirandamycin derivatives were detected in the extracts of the engineered strains Streptomyces sp. SCSIO1666::slgO1 and Streptomyces sp. Ju1009::slgO1 (Fig. 3a).
Fig. 3.
a Results of HPLC analysis of the extracts of the fermentation broth from (I) Streptomycetes sp. SCSIO1666::slgO1, (II) Streptomycetes sp. SCSIO1666::pSET152AKE, (III) Streptomycetes sp. Ju1009::slgO1, (IV) Streptomycetes sp. Ju1009::pSET152AKE, (V) Streptomycetes sp. Ju1008::slgO1, (VI) Streptomycetes sp. Ju1008::pSET152AKE. 1: tirandamycin B, 2: tirandamycin A, 5: tirandamycin E, 3: tirandamycin C, and 7: tirandamycin L. b The HR–MS data of tirandamycin L (7). The molecular of 7 is C22H29NO6 (m/z for [M+Na]+ 426.1890 and m/z for [2M+Na]+ 829.3876). c The structure of tirandamycin L (7)
Isolation and structural characterization of the newly produced tirandamycin derivative
To elucidate the structure of the newly produced derivative, the Streptomyces sp. Ju1008::slgO1 was fermented in a 6-L scale, enabling us to isolate the newly produced compound 7 (6.1 mg). Next, the structure of compound 7 was determined by a series of spectroscopic analyses. Compound 7 was isolated as a white, amorphous powder. Its molecular formula was determined as C22H29NO6 on basis of HR–MS at m/z 426.1890 [M+Na]+ and m/z 829.3876 [2M+Na]+ (Fig. 3b), indicting 9 degrees of unsaturation, which was one less than found for the known compound tirandamycin D. The 1H and 13C NMR spectroscopic data of compound 7 disclosed three olefin proton signals (δH 7.61, 7.16, and 6.29) including a trans double bond on the basis of the coupling constants of 15.5 Hz, five methyl proton signals (δH 1.91, 1.43, 1.17, 1.11, and 0.72), two methylene proton signals (δH 2.13, 2.78, and 3.85), and five methine proton signals (δH 1.92, 2.37, 2.85, 3.7, and 4.0) (Figures S2, S3; Table 3). Full comparisons of the 1H and 13C NMR spectroscopic data for compound 7 and tirandamycin D suggested that they possessed similar structures, except for the absence of a double bond between C-11 and C-12 in tirandamycin D (Figures S2, S3). In turn, a saturated C-11/C-12 bond was formed in compound 7. This finding was confirmed by 1H–1H COSY correlations of H-11/H-12, which was further validated by HMBC correlations from H-9, H-18 to C-11, and from H-11 to C-10, C-12 and C-13 (Figures S4–S7). Further 2D NMR data acquired thereby allowed the full assignment of the other signals (Figures S3–S7). Consequently, the structure of compound 7 was elucidated and it was designated as tirandamycin L (Fig. 3c).
Table 3.
1H and 13C NMR spectroscopic data for tirandamycin L (7) recorded in CDCl3
| Position | δ C type | δ H mult. (J in Hz) |
|---|---|---|
| 1 | 175.6 | |
| 2 | 116.5 | 7.16, d (15.5) |
| 3 | 150.6 | 7.61, d (15.5) |
| 4 | 134.7 | |
| 5 | 145.2 | 6.26, d (10.0) |
| 6 | 35.5 | 2.85, m |
| 7 | 78.5 | 3.7, m |
| 8 | 32.6 | 1.92, m |
| 9 | 80.5 | 4.0, d (6.0) |
| 10 | 207.3 | |
| 11 | 45.9 | 2.13, d (10.6); 2.78, dd (8.8, 2.0) |
| 12 | 39.2 | 2.37, m |
| 13 | 97.7 | |
| 14 | 26.8 | 1.43, s |
| 15 | 12.46 | 1.91, s |
| 16 | 17.3 | 1.17, d (6.9) |
| 17 | 11.9 | 0.72, d (7.0) |
| 18 | 14.2 | 1.11, d (6.9) |
| 1′(N) | ||
| 2′ | 176.7 | |
| 3′ | Not observed | |
| 4′ | 192.6 | |
| 5′ | 51.8 | 3.85, s |
Antibacterial activity of tirandamycin B and tirandamycin L
Both tirandamycin B and tirandamycin L showed no inhibitory activity against B. subtilis and S. aureus ATCC 29213 at the concentration of > 128 µg/mL. Notably, tirandamycin B (MIC = 32 µg/mL) showed much more potent antibacterial activity toward B. thuringiensis compared with tirandamycin L (MIC = 128 µg/mL), indicating that the oxygenation level affected the antibacterial activity of tirandamycin derivatives.
Discussion
During the biosynthesis of microbial secondary metabolites, CYP450s often catalyze the oxidation reactions to diversify the parental compounds (Cochrane and Vederas 2014; Rudolf et al. 2017; Zhang and Li 2017). Nowadays, more and more CYP450s make fundamental contributions to engineering of natural products. The CYP450 SlgO1, derived from streptolydigin biosynthetic gene cluster, shows high similarity to the multifunctional CYP450 TrdI/TamI involved in tirandamycin biosynthetic pathway (Mo et al. 2011a; Gómez et al. 2012). In this study, we demonstrated that SlgO1 play a modification role in tirandamycin biosynthetic pathway. We introduced the heterologous CYP450 SlgO1 into various tirandamycin-producing strains and obtained a new derivative tirandamycin L, which possessed a C-11–C-12 saturated bond as well as a C-10 ketone moiety.
SlgO1 was initially proposed to be responsible for the formation of epoxy ring in bicyclic ketal moiety in streptolydigin biosynthetic pathway (Gómez et al. 2012). Therefore, a tirandamycin derivative with an epoxy ring in C-11–C-12 position or an epoxy ring in C-12–C-18 position was expected to be accumulated in our engineered strains capable of heterologously expressing SlgO1. Surprisingly, the new derivative tirandamycin L had no epoxy moiety and it possessed a saturated bond in C-11–C-12 position. For all the identified tirandamycin derivatives, only tirandamycin E′ and pre-tirandamycin have a C-11–C-12 saturated bond as well as a C-11 hydroxyl group (Yu et al. 2011; Mo et al. 2012). In terms of biosynthesis, the elimination of C-11 hydroxyl results in a double bond in C-11–C-12 position. Pre-tirandamycin undergoes a dehydration step to generate tirandamycin C with a C-11–C-12 double bond, which is the direct precursor of the cytochrome P450 oxidase TrdI for further oxygenation modification (Carlson et al. 2011) (Fig. 4). For Streptomyces sp. SCSIO1666::slgO1 and Streptomyces sp. Ju1009::slgO1, the native P450 oxidase TrdI is ready to catalyze the formation of C-11–C-12 epoxy ring and C-10 hydroxyl group (Fig. 4) to afford tirandamycin A and tirandamycin E, respectively. Then, SlgO1 could not introduce further modifications in C-10, C-11, and C-12 positions. Consequently, it is rational that SlgO1 showed no other modifications toward tirandamycins to generate new derivatives in Streptomyces sp. SCSIO1666::slgO1 and Streptomyces sp. Ju1009::slgO1. However, tirandamycin C with low oxygenation level is the terminal product of trdI deletion strain Streptomyces sp. Ju1008 (Mo et al. 2011a), SlgO1 could introduce further modifications toward tirandamycin C in C-11, C-12, and C-10 positions. For Streptomyces sp. Ju1008::slgO1, SlgO1 catalyzed the hydroxylation reaction to give rise to tirandamycin F, evidenced using the E. coli whole cell biotransformation experiments. Then, tirandamycin F undergoes a dehydrogenation step catalyzed by the FAD-dependent dehydrogenase TrdL to afford tirandamycin D with a C-10 ketone group (Mo et al. 2011b) (Fig. 4). The unique feature of tirandamycin L was its C-11–C-12 saturated bond, and SlgO1 was proposed to introduce a reduction reaction of C-11–C-12 double bond, giving rise to tirandamycin L (Fig. 4). The modifications introduced by SlgO1 were proposed to be a post-tailoring step. Otherwise, additional tirandamycin derivatives should also be detected in Streptomyces sp. SCSIO1666::slgO1 and Streptomyces sp. Ju1009::slgO1. These results implied that SlgO1 could introduce multiple modifications toward tirandamycin C, although the exact role of SlgO1 in streptolydigin biosynthesis remained largely unexplored. The uncommon reaction catalyzed by SlgO1 expanded the chemical space of tirandamycin and made it a potential candidate in synthetic biology.
Fig. 4.
The proposed modification steps introduced by SlgO1
Conclusion
In this study, an E. coli whole cell system with overexpression of SlgO1, EcFLDR, and EcFLDA was constructed. In vivo biotransformation experiments with this whole cell system demonstrated that SlgO1 could introduce a hydroxyl group in C-10 position of tirandamycin C, leading to form tirandamycin F. By introducing the emerE*–slgO1 cassette into a series of tirandamycins producing strains derived from Streptomycetes sp. SCSIO1666, a novel derivative tirandamycin L accumulated in Streptomycetes sp. Ju1008::slgO1. Tirandamycin L possessed an unusual C-11–C-12 saturated bond and a C-10 ketone moiety. On basis of structure of tirandamycin L, SlgO1 was proposed to be responsible for multiple modifications toward tirandamycin C. Compared to tirandamycin B, tirandamycin L displayed weak antibacterial activity, indicating that oxygenation modification was important in antibacterial activity of tirandamycins.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
We are very grateful to Professor Jianhua Ju for providing the tirandamycin-producing strains. Research in this work was supported by Natural Science Foundation of Shandong Province (No. ZR2013CL020) and Research Foundation for Advanced Talents of Qingdao Agricultural University (No. 631301).
Compliance with ethical standards
Conflict of interest
All the authors declare no conflict of interest with respect to this paper.
References
- Alkhalaf LM, Barry S, Rea D, Gallo A, Griffiths D, Lewandowski J, Fülöp V, Challis GL. Binding of distinct substrate conformations enables hydroxylation of remote sites in thaxtomin D by cytochrome P450 TxtC. J Am Chem Soc. 2019;141(1):216–222. doi: 10.1021/jacs.8b08864. [DOI] [PubMed] [Google Scholar]
- Bernhardt R, Urlacher VB. Cytochromes P450 as promising catalysts for biotechnological application: chances and limitations. Appl Microbiol Biotechnol. 2014;98(14):6185–6203. doi: 10.1007/s00253-014-5767-7. [DOI] [PubMed] [Google Scholar]
- Carlson JC, Fortman JL, Anzai Y, Li S, Burr DA, Sherman DH. Identification of the tirandamycin biosynthetic gene cluster from Streptomyces sp. 307-9. ChemBioChem. 2010;11(4):564–572. doi: 10.1002/cbic.200900658. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Carlson JC, Li S, Gunatilleke SS, Anzai Y, Burr DA, Podust LM, Sherman DH. Tirandamycin biosynthesis is mediated by co-dependent oxidative enzymes. Nat Chem. 2011;3(8):628–633. doi: 10.1038/nchem.1087. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cochrane RV, Vederas JC. Highly selective but multifunctional oxygenases in secondary metabolism. Acc Chem Res. 2014;47(10):3148–3161. doi: 10.1021/ar500242c. [DOI] [PubMed] [Google Scholar]
- Coon MJ. Cytochrome P450: nature’s most versatile biological catalyst. Annu Rev Pharmacol Toxicol. 2005;45:1–25. doi: 10.1146/annurev.pharmtox.45.120403.100030. [DOI] [PubMed] [Google Scholar]
- Duan C, Yao Y, Wang Z, Tian X, Zhang S, Zhang C, Ju J. Fermentation optimization, isolation and identification of tirandamycins A and B from marine-derived Streptomyces sp. SCSIO 1666. Chin J Mar Drugs. 2010;29(6):12–20. [Google Scholar]
- Girvan HM, Munro AW. Applications of microbial cytochrome P450 enzymes in biotechnology and synthetic biology. Curr Opin Chem Biol. 2016;31:136–145. doi: 10.1016/j.cbpa.2016.02.018. [DOI] [PubMed] [Google Scholar]
- Gómez C, Olano C, Palomino-Schätzlein M, Pineda-Lucena A, Carbajo RJ, Braña AF, Méndez C, Salas JA. Novel compounds produced by Streptomyces lydicus NRRL2433 engineered mutants altered in the biosynthesis of streptolydigin. J Antibiot. 2012;65(7):341–348. doi: 10.1038/ja.2012.37. [DOI] [PubMed] [Google Scholar]
- Lewis DFV, Wiseman A. A selective review of bacterial forms of cytochrome P450 enzymes. Enzym Microb Technol. 2005;36(4):377–384. doi: 10.1016/j.enzmictec.2004.07.018. [DOI] [Google Scholar]
- Ma J, Wang Z, Huang H, Luo M, Zuo D, Wang B, Sun A, Cheng YQ, Zhang C, Ju J. Biosynthesis of himastatin: assembly line and characterization of three cytochrome P450 enzymes involved in the post-tailoring oxidative steps. Angew Chem Int Ed. 2011;50(34):7797–7802. doi: 10.1002/anie.201102305. [DOI] [PubMed] [Google Scholar]
- Macneil DJ, Gewain KM, Ruby CL, Dezeny G, Gibbons PH, Macneil T. Analysis of Streptomyces avermitilis genes required for avermectin biosynthesis utilizing a novel integration vector. Gene. 1992;111:61–68. doi: 10.1016/0378-1119(92)90603-M. [DOI] [PubMed] [Google Scholar]
- McIver L, Leadbeater C, Campopiano DJ, Baxter RL, Daff SN, Chapman SK, Munro AW. Characterisation of flavodoxin NADP+ oxidoreductase and flavodoxin; key components of electron transfer in Escherichia coli. Eur J Biochem. 1998;257(3):577–585. doi: 10.1046/j.1432-1327.1998.2570577.x. [DOI] [PubMed] [Google Scholar]
- Mo X, Wang Z, Wang B, Ma J, Huang H, Tian X, Zhang S, Zhang C, Ju J. Cloning and characterization of the biosynthetic gene cluster of the bacterial RNA polymerase inhibitor tirandamycin from marine-derived Streptomyces sp. SCSIO1666. Biochem Biophys Res Commun. 2011;406(3):341–347. doi: 10.1016/j.bbrc.2011.02.040. [DOI] [PubMed] [Google Scholar]
- Mo X, Huang H, Ma J, Wang Z, Wang B, Zhang S, Zhang C, Ju J. Characterization of TrdL as a 10-hydroxy dehydrogenase and generation of new analogues from an tirandamycin biosynthetic pathway. Org Lett. 2011;13(9):2212–2215. doi: 10.1021/ol200447h. [DOI] [PubMed] [Google Scholar]
- Mo X, Ma J, Huang H, Wang Z, Wang B, Zhang S, Zhang C, Ju J. ∆(11,12) double bond formation in tirandamycin biosynthesis is atypically catalyzed by TrdE, a glycoside hydrolase family enzyme. J Am Chem Soc. 2012;134(6):2844–2847. doi: 10.1021/ja206713a. [DOI] [PubMed] [Google Scholar]
- Mo X, Li Q, Ju J. Naturally occurring tetramic acid products: isolation, structure elucidation and biological activity. RSC Adv. 2014;4:450566–450593. doi: 10.1039/C4RA09047K. [DOI] [Google Scholar]
- Mo X, Shi C, Gui C, Zhang Y, Ju J, Wang Q. Identification of nocamycin biosynthetic gene cluster from Saccharothrix syringae NRRL B-16468 and generation of new nocamycin derivatives by manipulating gene cluster. Microb Cell Fact. 2017;16(1):100. doi: 10.1186/s12934-017-0718-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Munro AW, Girvan HM, McLean KJ. Cytochrome P450-redox partner fusion enzymes. Biochim Biophys Acta. 2007;1770(3):345–359. doi: 10.1016/j.bbagen.2006.08.018. [DOI] [PubMed] [Google Scholar]
- Munro AW, Girvan HM, Mason AE, Dunford AJ, McLean KJ. What makes a P450 tick? Trends Biochem Sci. 2013;38(3):140–150. doi: 10.1016/j.tibs.2012.11.006. [DOI] [PubMed] [Google Scholar]
- Olano C, Gómez C, Pérez M, Palomino M, Pineda-Lucena A, Carbajo RJ, Braña AF, Méndez C, Salas JA. Deciphering biosynthesis of the RNA polymerase inhibitor streptolydigin and generation of glycosylated derivatives. Chem Biol. 2009;16(10):1031–1044. doi: 10.1016/j.chembiol.2009.09.015. [DOI] [PubMed] [Google Scholar]
- Rudolf JD, Chang CY, Ma M, Shen B. Cytochromes P450 for natural product biosynthesis in Streptomyces: sequence, structure, and function. Nat Prod Rep. 2017;34(9):1141–1172. doi: 10.1039/C7NP00034K. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xiao J, Zhang Q, Zhu Y, Li S, Zhang G, Zhang H, Saurav K, Zhang C. Characterization of the sugar-O-methyltransferase LobS1 in lobophorin biosynthesis. Appl Microbiol Biotechnol. 2013;97(20):9043–9053. doi: 10.1007/s00253-013-5083-7. [DOI] [PubMed] [Google Scholar]
- Yu Z, Vodanovic-Jankovic S, Ledeboer N, Huang SX, Rajski SR, Kron M, Shen B. Tirandamycins from Streptomyces sp. 17944 inhibiting the parasite Brugia malayi asparagines tRNA synthetase. Org Lett. 2011;13(8):2034–2037. doi: 10.1021/ol200420u. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang X, Li S. Expansion of chemical space for natural products by uncommon P450 reactions. Nat Prod Rep. 2017;34(9):1061–1089. doi: 10.1039/C7NP00028F. [DOI] [PubMed] [Google Scholar]
- Zhou H, Wang B, Wang F, Yu X, Ma L, Li A, Reetz MT. Chemo- and regioselective dihydroxylation of benzene to hydroquinone enabled by engineered cytochrome P450 monooxygenase. Angew Chem Int Ed Engl. 2019;58(3):764–768. doi: 10.1002/anie.201812093. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.