Abstract
Premise of the Study
Microsatellite markers were developed to facilitate studies of genetic diversity and structure in Glyptostrobus pensilis, a critically endangered and monotypic conifer species.
Methods and Results
Using restriction site–associated DNA sequencing (RAD‐Seq), we developed 10 polymorphic and 27 monomorphic microsatellite markers. Polymorphism was characterized using 333 individuals from nine populations. The number of alleles per locus ranged from one to 14 at the population level. The levels of observed and unbiased expected heterozygosities varied from 0.058 to 0.844 and 0.219 to 0.583, respectively. Nine of these 10 polymorphic markers were successfully cross‐amplified in Taxodium distichum, the species most closely related to G. pensilis.
Conclusions
These microsatellite markers can be used to reveal the genetic diversity in existing populations of G. pensilis, enabling its conservation and restoration.
Keywords: Cupressaceae, endangered species, genetic diversity, genetic markers, Glyptostrobus pensilis, RAD‐Seq
Glyptostrobus pensilis (Staunton ex D. Don) K. Koch (Cupressaceae) is known as “shui song” in Chinese and “water pine” or “Chinese swamp cypress” in English (Averyanov et al., 2009). As its names imply, G. pensilis is adapted to swamp habitats with an anoxic environment. The species is a relic conifer and has been recognized as monotypic based on its morphology.
In terms of biogeographic history, G. pensilis was widely distributed throughout the Northern Hemisphere from the Early Cretaceous until the early Pleistocene (LePage, 2007). However, it is currently restricted to southern China, southern Vietnam, and eastern Laos as a result of early Quaternary glaciations and subsequent desertification (Li and Xia, 2004). Recently, habitat destruction such as deforestation and urbanization has resulted in declines in both the number of individuals and the number of populations of this species. Glyptostrobus pensilis is now considered Critically Endangered according to the IUCN Red List (IUCN Red List Committee, 2011), and most of its wild populations contain only one or a few individuals. To conserve this rare and endangered species integratively, the population genetic diversity of G. pensilis should be carefully evaluated using as many populations as possible. A population genetic diversity analysis conducted by Li and Xia (2004) employed only a small fraction of the populations of this species in China and used dominant inter‐simple sequence repeat (ISSR) markers. This method was later applied to compare genetic variation among four natural and artificial populations (Wu et al., 2011). Nguyen et al. (2013) also detected the genetic variation of G. pensilis using chloroplast microsatellites but only in the Vietnam populations. In this study, almost all the global water pine populations except those in Laos are sampled (Appendix 1) and used to characterize genetic variation in the newly developed microsatellite markers. These markers are also cross‐amplified in Taxodium distichum (L.) Rich. (Appendix 1), the phylogenetically most closely related species in Cupressaceae (Hao et al., 2016).
METHODS AND RESULTS
We sampled a total of 333 individuals from China and Vietnam. In the field, most of the natural populations are small, containing only one or a few scattered individuals. For genetic diversity measurements, we grouped the populations and divided them into nine large populations based on their locations in the nation or province. All field‐collected leaf materials were dried immediately in silica gel. In the lab, DNA was extracted from these materials using a modified cetyltrimethylammonium bromide (CTAB) method (Doyle, 1991).
Restriction site–associated DNA sequencing (RAD‐Seq; Baird et al., 2008) was used to obtain partial genomic DNA sequences of G. pensilis. The microsatellites were then selected and developed based on these sequences. Two samples, one from the South China Botanical Garden and the other from Conghua District, Guangzhou Province, China, were used to construct the RAD‐Seq libraries with the restriction enzyme EcoRI (Promega Corporation, Madison, Wisconsin, USA), followed by 150‐bp paired‐end sequencing using a HiSeq X Ten genetic analyzer (Illumina, San Diego, California, USA). From the two samples, 35,615,442 and 35,297,882 raw sequences were obtained, respectively. The raw sequence data are available in the National Center for Biotechnology Information (NCBI) Sequence Read Archive database (accession no. SRR7133729 and SRR7133728). After filtering PCR duplicates and low‐quality reads for each of these raw sequences, Rainbow 2.0.4 (Chong et al., 2012) was used to assemble the sequences separately. The two assembled sequences were subsequently combined and re‐assembled by CAP3 (Huang and Madan, 1999), resulting in 3,285,999 contigs with a total length of 787,094,171 bp. The minimum and maximum lengths of the contigs were 80 bp and 2016 bp, respectively, with an average length of 173.69 bp and an N50 length of 325 bp. Microsatellites with dinucleotide and trinucleotide motifs with at least seven repeats were identified from these assembled sequences by MSATCOMMANDER 0.8.2 (Faircloth, 2008). Then, 100 microsatellites were chosen, and six individuals were initially used to characterize their polymorphisms.
We performed PCRs in a 20‐μL volume with 0.2 mM dNTPs, 0.4 μM primers, 1× PCR buffer (2.5 mM Mg2+), 50 ng of genomic DNA, and 1 unit of Taq polymerase (TaKaRa Biotechnology Co., Dalian, China). The conditions included an initial step of 95°C for 5 min; followed by 35 cycles of 94°C for 30 s, 53°C for 45 s, and 72°C for 45 s; and a final step of 72°C for 10 min. The PCR products were checked on a 2% agarose gel, and only the microsatellites with clear bands and correct sizes were retained. Subsequently, the allele size polymorphisms were analyzed by an ABI 3730 sequencer and determined by GeneMapper version 4.1 (Applied Biosystems, Carlsbad, California, USA). A total of 37 microsatellites showed clear allelic patterns, with 10 of them being polymorphic. Finally, we used an additional 327 individuals to test the full range of allelic variation in these 10 microsatellites.
All genetic diversity parameters, including the number of alleles per locus, observed heterozygosity, and unbiased expected heterozygosity were obtained with GenAlEx 6.5 (Peakall and Smouse, 2012). The fixation index was calculated using GENEPOP 4.3 (Rousset, 2008). The deviation from Hardy–Weinberg equilibrium (HWE) and genotypic linkage disequilibrium (LD) among all pairs of loci within populations were also estimated using GENEPOP 4.3 using the default parameters. Sequential Bonferroni correction (Holm, 1979) was applied to adjust the level of significance for the HWE and LD analyses.
In G. pensilis, 37 microsatellites were amplified successfully, 10 of which were polymorphic and 27 of which were monomorphic (Table 1). The number of alleles for G. pensilis ranged from one to 14 (Table 2). For the polymorphic loci, levels of observed heterozygosity and unbiased expected heterozygosity ranged from 0.058 to 0.844 and 0.219 to 0.583, respectively (Table 2). All 10 polymorphic loci showed deviation from HWE within one or more populations, mostly due to heterozygosity deficit. This is most likely the result of the artificial population groupings that were used (due to the very small population sizes and scattered distribution characters in G. pensilis), which might not follow their natural distributions. This may have resulted in a mixture of individuals with different genetic backgrounds, causing deviation from HWE by the Wahlund effect. We found no consistent deviation from LD for any loci within the populations. Nine of the 10 polymorphic markers successfully cross‐amplified in six T. distichum individuals (Table 3).
Table 1.
Characteristics of 37 microsatellite markers developed in Glyptostrobus pensilis.a
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | GenBank accession no. |
|---|---|---|---|---|
| GP_19 | F: GCCAGCAGATTATCACCCAG | (GT)9 | 314–338 | MH236836 |
| R: GGGCCACCAGAAGACATGC | ||||
| GP_43 | F: AGGTGCCTTGTCAACTAAATCC | (AC)9 | 153–161 | MH236849 |
| R: GGTCAACTTTGAATAAGGCCAAAC | ||||
| GP_46 | F: AAGGGTGGCTCATTTCCAG | (GAA)7 | 152–156 | MH236852 |
| R: TCTAGCATTGAAACATAGTGGC | ||||
| GP_57 | F: TTATATTAGTCATTTGTGGGCTCC | (GT)11 | 207–212 | MH236855 |
| R: TGGCGAGGTATAATTTGGGC | ||||
| GP_58 | F: AGAGGTAACTCCATCCATGTC | (TC)21 | 288–374 | MH236856 |
| R: GTCACATCCTATCTCAAGAATGAGC | ||||
| GP_71 | F: ACCTAGAAGGCAATAGGCCG | (AC)8 | 199–201 | MH236858 |
| R: AGGAGAAAGCATTCACTACAAGG | ||||
| GP_75 | F: TGGTTAGACTATGCTGGCAATC | (GA)7 | 149–153 | MH236862 |
| R: TCAGCCTTACTTCACAATGCTC | ||||
| GP_80 | F: TGGTTAGACCCATCCAAGCC | (CA)44 | 145–147 | MH236864 |
| R: AGAAGCACAGGTCATAGCC | ||||
| GP_89 | F: ACACTCACATCCTAGTCCGTC | (GT)8 | 332–338 | MH236868 |
| R: ATCGACCTTTATCATGCCATTC | ||||
| GP_94 | F: AGCATTTGGAACCTAAACAAGTCC | (AG)15 | 130–172 | MH236871 |
| R: ATGTCCTCAACATTCGCCC | ||||
| GP_7 | F: TGGGTCTGGATAATTGTGGC | (GT)3AT(GT)4TT(GT)39 | 332 | MH236832 |
| R: TCTCTGCAATAGGTCTGGTAAG | ||||
| GP_8 | F: ATCCTCCCTATCGTGACCC | (CTT)7 | 224 | MH236833 |
| R: AGTGGGTGTTACATGCATCC | ||||
| GP_9 | F: CGACTGATCGGTTCTTCGC | (AT)3AG(AT)12AGATCT(AT)8 | 343 | MH236834 |
| R: CATCTCCAGTGGCATATCTCG | ||||
| GP_17 | F: AATGGAGACAAGGACCATAGG | (GA)8 | 190 | MH236835 |
| R: GCCTTACAGCCATTTAAGTACC | ||||
| GP_22 | F: AAGAGGCGTTGCAGTGTTC | (GGA)7 | 232 | MH236837 |
| R: GCCCTGCCGTATAGACTACC | ||||
| GP_26 | F: ACATGTTTACCAAATTCAATGCCTC | (CT)7 | 156 | MH236839 |
| R: GAGGGAATTGGTGCCCTTC | ||||
| GP_28 | F: ACAACTCATTGGGTAAGTGGTC | (AT)8 | 179 | MH236840 |
| R: GGGATGGAAATCTAAGCAATGTC | ||||
| GP_29 | F: GGATGATGCAAAGGGACCG | (AC)8GTTATTTATAT(AC)7 | 370 | MH236841 |
| R: TCTTCCAAGCAAAGACTTCAGAC | ||||
| GP_31 | F: CGGTTACCCTCCCATCTGC | (AC)8 | 394 | MH236842 |
| R: ACCAGCTACAAATTTATTCGCC | ||||
| GP_32 | F: AGGTACATAGGGTTGAGGGC | (CT)9 | 192 | MH236843 |
| R: GGTGAGAGGTGACAACCTAGAC | ||||
| GP_35 | F: GGACTTTGAGTTTGAAGGAGCC | (GAA)8 | 251 | MH236844 |
| R: GCCATGAAAGAAGAAATTATAAGCC | ||||
| GP_36 | F: TGGGTTATCTTCTAGTGCAACTC | (AT)9 | 207 | MH236845 |
| R: CCCAATATGGATACGGCTGG | ||||
| GP_37 | F: TCTTCTCCTTCACGAAATGAGC | (CT)8 | 194 | MH236846 |
| R: TGAACTAAACTGTGGTGCCTTAC | ||||
| GP_39 | F: TGAGAGAAGATTTCTATGGTATTGTCC | (GT)9 | 153 | MH236847 |
| R: TATTGAAGTGTTTGTGCCTTACAG | ||||
| GP_41 | F: ACTCTTGGAAAGGGATAAGTGG | (GT)13 | 175 | MH236848 |
| R: ATCCATCTTGTACTTGCATCAC | ||||
| GP_44 | F: TCAGGACCCAGCTCAAACC | (GT)12 | 185 | MH236850 |
| R: TCAGATCCTTATCTTCTTGAGGC | ||||
| GP_47 | F: ACATTGTGTTCCTTCTCTTAACCC | (AC)15 | 176 | MH236853 |
| R: ATGTTGGAAGATTGAACCCAGC | ||||
| GP_56 | F: TGGAATCTTTAGGGCTTTACTGC | (CT)8 | 213 | MH236854 |
| R: GCTTGTGACATCAGGGTTGG | ||||
| GP_64 | F: TTGCTTCACCTAGTGGGAC | (AC)10 | 184 | MH236857 |
| R: TGTTGGAGAGTTTGTACCTATTGAG | ||||
| GP_72 | F: CGGTTTGTGGATCTTAACTAGTGC | (GT)8 | 167 | MH236859 |
| R: AAGTGTTTGTGCCTCGCAG | ||||
| GP_73 | F: ACCATTGCATCTACAGCACG | (GT)9 | 227 | MH236860 |
| R: CCACACATCTAATGGTTTATTGAAG | ||||
| GP_74 | F: TATCGACCTGCTCCTAGCC | (GT)13 | 203 | MH236861 |
| R: ACTACTGATTTCATCCGGTCG | ||||
| GP_78 | F: CCTTTGCCTCAAATTAATCGCAC | (AC)8 | 160 | MH236863 |
| R: AGAATCACTTTAACTAGGGTGCTC | ||||
| GP_83 | F: TGGTCATGCTAGTTGTATCCC | (GT)8 | 177 | MH236865 |
| R: GCACTTTGATTCTTTACCAATTGTC | ||||
| GP_84 | F: CGTGCATCGAGATACTGAAGG | (AT)9 | 152 | MH236866 |
| R: TGATCGTATTGCACGCAACC | ||||
| GP_88 | F: ACTACTTTGTCGCTTGCATAC | (AC)9 | 198 | MH236867 |
| R: AGATCTGTGAAGTTTGACTTGG | ||||
| GP_96 | F: TGTCTTCACTTTAGGCTTTGGG | (TTC)6TTTC | 173 | MH236872 |
| R: TGGAAGTAGAAACCCTAGTATCCTC |
For all loci, the annealing temperature was 53°C and the forward sequence was fluorescently labeled with FAM.
Table 2.
Genetic diversities of 10 polymorphic microsatellites developed for Glyptostrobus pensilis in eight Chinese populations and one Vietnamese population.a
| Locus | JX (n = 59) | HN (n = 6) | Đắk Lắk (n = 59) | HK (n = 6) | FJ (n = 81) | GD (n = 74) | GX (n = 31) | ZJ (n = 6) | HB (n = 11) | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | H o | uH e | A | H o | uH e | A | H o | uH e | A | H o | uH e | A | H o | uH e | A | H o | uH e | A | H o | uH e | A | H o | uH e | A | H o | uH e | |
| GP_19 | 2 | 0.000 | 0.066b | 2 | 0.000 | 0.303 | 1 | 0.000 | 0.000 | 2 | 0.333 | 0.303 | 2 | 0.000 | 0.048b | 3 | 0.192 | 0.425b | 4 | 0.000 | 0.649b | 1 | 0.000 | 0.000 | 2 | 0.000 | 0.173 |
| GP_43 | 2 | 0.983 | 0.504b | 2 | 0.200 | 0.200 | 2 | 1.000 | 0.504b | 1 | 0.000 | 0.000 | 2 | 0.938 | 0.501b | 3 | 0.137 | 0.199 | 3 | 0.167 | 0.159 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 |
| GP_46 | 1 | 0.000 | 0.000 | 2 | 0.167 | 0.409 | 3 | 0.237 | 0.217 | 2 | 0.333 | 0.485 | 3 | 0.086 | 0.106 | 3 | 0.297 | 0.467b | 3 | 0.192 | 0.520b | 3 | 0.167 | 0.318 | 3 | 0.273 | 0.394 |
| GP_57 | 2 | 0.017 | 0.017 | 2 | 0.000 | 0.303 | 2 | 0.069 | 0.067 | 2 | 0.667 | 0.485 | 2 | 0.025 | 0.025 | 2 | 0.264 | 0.503b | 4 | 0.379 | 0.475b | 2 | 0.500 | 0.571 | 1 | 0.000 | 0.000 |
| GP_58 | 3 | 0.068 | 0.187b | 2 | 0.000 | 0.356 | 9 | 0.130 | 0.758b | 8 | 0.667 | 0.894 | 2 | 0.049 | 0.072 | 14 | 0.479 | 0.882b | 6 | 0.464 | 0.779b | 4 | 0.333 | 0.697 | 4 | 0.364 | 0.619 |
| GP_71 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.167 | 0.530 | 2 | 0.000 | 0.472b | 2 | 0.219 | 0.503b | 2 | 0.067 | 0.282b | 2 | 0.333 | 0.545 | 2 | 0.500 | 0.521 |
| GP_75 | 2 | 1.000 | 0.504b | 2 | 1.000 | 0.545 | 2 | 1.000 | 0.504b | 2 | 1.000 | 0.545 | 2 | 0.827 | 0.488b | 2 | 0.903 | 0.499b | 2 | 0.931 | 0.506b | 2 | 0.833 | 0.530 | 2 | 0.100 | 0.100 |
| GP_80 | 1 | 0.000 | 0.000 | 2 | 0.833 | 0.530 | 2 | 1.000 | 0.504b | 2 | 0.333 | 0.303 | 1 | 0.000 | 0.000 | 2 | 0.425 | 0.352 | 2 | 0.567 | 0.481 | 2 | 1.000 | 0.545 | 2 | 0.091 | 0.091 |
| GP_89 | 2 | 0.017 | 0.017 | 3 | 0.167 | 0.439 | 2 | 0.017 | 0.017 | 2 | 0.500 | 0.409 | 3 | 0.025 | 0.108b | 4 | 0.403 | 0.513b | 3 | 0.400 | 0.674b | 3 | 0.667 | 0.682 | 3 | 0.455 | 0.567 |
| GP_94 | 2 | 0.017 | 0.017 | 2 | 0.200 | 0.200 | 1 | 0.000 | 0.000 | 3 | 0.333 | 0.530 | 4 | 0.188 | 0.260 | 7 | 0.250 | 0.545b | 3 | 0.100 | 0.267b | 1 | 0.000 | 0.000 | 3 | 0.000 | 0.329b |
| Overall | – | 0.210 | 0.131 | – | 0.257 | 0.329b | – | 0.345 | 0.257b | – | 0.433 | 0.448b | – | 0.214 | 0.208b | – | 0.357 | 0.489b | – | 0.327 | 0.479b | – | 0.383 | 0.389b | – | 0.178 | 0.279b |
A = number of alleles; F = fixation index; H o = observed heterozygosity; n= sample size; uH e = unbiased expected heterozygosity.
See Appendix 1 for locality and voucher information.
Significant deviation from Hardy–Weinberg equilibrium after Holm's sequential Bonferroni correction (P < 0.05).
Table 3.
Cross‐amplification of 10 polymorphic microsatellite loci developed for Glyptostrobus pensilis in Taxodium distichum.a
| Locus | A | H o | uH e | F | Adjusted P value |
|---|---|---|---|---|---|
| GP_19 | 4 | 0.833 | 0.773 | –0.087 | 0.526 |
| GP_43 | 1 | 0.000 | 0.000 | — | — |
| GP_46 | 2 | 0.833 | 0.530 | –0.667 | 0.242 |
| GP_57 | 3 | 0.750 | 0.679 | –0.125 | 0.571 |
| GP_58 | 6 | 0.800 | 0.844 | –0.059 | 0.863 |
| GP_71 | — | — | — | — | — |
| GP_75 | 2 | 1.000 | 0.545 | –1.000 | 0.069 |
| GP_80 | 2 | 1.000 | 0.545 | –1.000 | 0.069 |
| GP_89 | 1 | 0.000 | 0.000 | — | — |
| GP_94 | 2 | 1.000 | 0.545 | –1.000 | 0.069 |
| Overall | — | 0.691 | 0.496 | –0.488* | 0.000 |
A = number of alleles; F = fixation index; H o = observed heterozygosity; uH e = unbiased expected heterozygosity.
See Appendix 1 for locality and voucher information.
Indicates a significant deviation from Hardy–Weinberg equilibrium after Holm's sequential Bonferroni correction (P < 0.05).
CONCLUSIONS
In this study, 10 polymorphic and 27 monomorphic microsatellite markers were developed for G. pensilis. The cross‐amplification test indicated that nine of the 10 polymorphic markers can be successfully amplified in the phylogenetically closely related T. distichum. These markers will offer valuable tools for future investigations of genetic diversity and structure, level of gene flow, and conservation genetic studies in these two species.
AUTHOR CONTRIBUTIONS
R.J.W. conceived and designed the project. R.J.W., G.T.W., and D.L. carried out the field collection. G.T.W., Z.F.W., and G.B.J. carried out the laboratory procedures. G.T.W. and Z.F.W. analyzed the data. All authors read and approved the final version of the manuscript.
ACKNOWLEDGMENTS
The authors thank Z. Wang, X. J. Liu, and B. Chen for their field assistance in collecting samples. This study was supported by the Guangzhou Wild Life Conservation and Management Office (SYZFCG‐[2017]032, Guangzhou Water Pine Germplasm Resource Conservation Program), Guangdong Forestry Department Program for Rare and Endangered Plant Conservation, Botanical Gardens Conservation International (BGCI) G. pensilis Conservation Program, and the STS Program of the Chinese Academy of Sciences (KFJ‐3W‐No1‐1).
Appendix 1. Locality information for the Glyptostrobus pensilis and Taxodium distichum samples used in this study.a
| Species | Population code | N | Collection locality | Voucher no. |
|---|---|---|---|---|
| Glyptostrobus pensilis (Staunton ex D. Don) K. Koch | JX | 59 | Shangrao, Jiangxi Province, China | IBSC799028 |
| Yingtan, Jiangxi Province, China | IBSC799072 | |||
| HN | 6 | Zixing, Hunan Province, China | IBSC799035, 799034, 799082 | |
| HK | 6 | The Chinese University of Hong Kong, China | IBSC799085 | |
| FJ | 81 | Ningde, Fujian Province, China | IBSC799064 | |
| Sanming, Fujian Province, China | IBSC799019 | |||
| Quanzhou, Fujian Province, China | IBSC799016, 799075 | |||
| Fuzhou, Fujian Province, China | IBSC799068 | |||
| GD | 74 | Guangzhou, Guangdong Province, China | IBSC799061, 799020, 799014, 799078, 799079, 799041, 799042, 799054, 799083, 799084 | |
| Zhuhai, Guangdong Province, China | IBSC799080, 799022 | |||
| Huaiji, Guangdong Province, China | IBSC799056 | |||
| Meizhou, Guangdong Province, China | IBSC799021, 799018, 799032 | |||
| Huizhou, Guangdong Province, China | IBSC799066, 799057, 799031, 799030 | |||
| GX | 31 | Tiandeng, Guangxi Province, China | IBSC799047 | |
| Qinzhou, Guangxi Province, China | IBSC799048 | |||
| Guilin, Guangxi Province, China | IBSC799049 | |||
| Cangwu, Guangxi Province, China | IBSC799051 | |||
| Luchuan, Guangxi Province, China | IBSC799044 | |||
| Funing, Yunnan Province, China | IBSC799046 | |||
| ZJ | 6 | Hangzhou, Zhejiang Province, China | IBSC799050 | |
| Shanghai, China | IBSC799069 | |||
| HB | 11 | Wuhan, Hubei Province, China | IBSC799053 | |
| Xinyang, Henan Province, China | IBSC799055 | |||
| Đa˘΄k La˘΄k | 59 | Ea H'leo, Đa˘΄k La˘΄k Province, Vietnam | HN11357, 7111, 11946, 11950 | |
| Taxodium distichum (L.) Rich. | T. distichum | 6 | South China Botanical Garden, Guangzhou, Guangdong Province, China (23°10′51”N, 113°21′08”E) | IBSC799015 |
N = number of individuals sampled.
All voucher specimens were deposited in the South China Botanical Garden Herbarium (IBSC), Guangzhou, China, or the Vietnam Academy of Science and Technology Herbarium (HN), Hanoi, Vietnam.
Wang, G.‐T. , Wang Z.‐F., Wang R.‐J., Liang D., and Jiang G.‐B.. 2019. Development of microsatellite markers for a monotypic and globally endangered species, Glyptostrobus pensilis (Cupressaceae). Applications in Plant Sciences 7(2): e1217.
Contributor Information
Zheng‐Feng Wang, Email: wangrj@scbg.ac.cn.
Rui‐Jiang Wang, Email: wzf@scbg.ac.cn.
DATA ACCESSIBILITY
The microsatellites and raw sequences developed in this article have been deposited in the National Center for Biotechnology Information (NCBI). The GenBank accession numbers for the microsatellites are provided in Table 1, and the accession numbers for the raw sequences in the NCBI Sequence Read Archive are SRR7133729 and SRR7133728.
LITERATURE CITED
- Averyanov, L. V. , Phan K. L., Nguyen T. H., Nguyen S. K., Nguyen T. V., and Pham T. D.. 2009. Preliminary observation of native Glyptostrobus pensilis (Taxodiaceae) stands in Vietnam. Taiwania 54: 191–212. [Google Scholar]
- Baird, N. A. , Etter P. D., Atwood T. S., Currey M. C., Shiver A. L., Lewis Z. A., Selker E. U., et al. 2008. Rapid SNP discovery and genetic mapping using sequenced RAD markers. PLoS ONE 3: e3376. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chong, Z. , Ruan J., and Wu C. I.. 2012. Rainbow: An integrated tool for efficient clustering and assembling RAD‐seq reads. Bioinformatics 28: 2732–2737. [DOI] [PubMed] [Google Scholar]
- Doyle, J. J. 1991. DNA protocols for plants–CTAB total DNA isolation In Hewitt G. M. and Johnston A. [eds.], Molecular techniques in taxonomy, 283–293. Springer‐Verlag, Berlin, Germany. [Google Scholar]
- Faircloth, B. C. 2008. MSATCOMMANDER: Detection of microsatellite repeat arrays and automated, locus‐specific primer design. Molecular Ecology Resources 8: 92–94. [DOI] [PubMed] [Google Scholar]
- Hao, Z. D. , Cheng T., Zheng R. H., Xu H. B., Zhou Y. W., Li M. P., Lu F. J., et al. 2016. The complete chloroplast genome sequence of a relict conifer Glyptostrobus pensilis: Comparative analysis and insights into dynamics of chloroplast genome rearrangement in Cupressophytes and Pinaceae. PLoS ONE 11: e0161809. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Holm, S. 1979. A simple sequentially rejective multiple test procedure. Scandinavian Journal of Statistics 6: 65–70. [Google Scholar]
- Huang, X. , and Madan A.. 1999. CAP3: A DNA sequence assembly program. Genome Research 9: 868–877. [DOI] [PMC free article] [PubMed] [Google Scholar]
- IUCN Red List Committee . 2011. The IUCN Red List of Threatened Species. Website http://www.iucnredlist.org/details/32312/0/ [accessed 14 December 2010].
- LePage, B. A. 2007. The taxonomy and biogeographic history of Glyptostrobus Endlicher (Cupressaceae). Bulletin of the Peabody Museum of Natural History 48: 359–426. [Google Scholar]
- Li, F. G. , and Xia N. H.. 2004. The geographical distribution and cause of threat to Glyptostrobus pensilis (Taxodiaceae). Journal of Tropical and Subtropical Botany 12: 13–20. [Google Scholar]
- Nguyen, M. T. , Vu D. D., Bui T. T. X., and Nguyen M. D.. 2013. Genetic variation and population structure in Chinese water pine (Glyptostrobus pensilis): A threatened species. Indian Journal of Biotechnology 12: 499–503. [Google Scholar]
- Peakall, R. , and Smouse P.. 2012. GenAlEx 6.5 (version 6.5): Genetic analysis in Excel. Population genetic software for teaching and research–an update. Bioinformatics 28: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rousset, F. 2008. GENEPOP'007: A complete re–implementation of the genepop software for Windows and Linux. Molecular Ecology Resources 8: 103–106. [DOI] [PubMed] [Google Scholar]
- Wu, Z. Y. , Liu J. F., Hong W., Pan D. M., and Zheng S. Q.. 2011. Genetic diversity of natural and planted Glyptostrobus pensilis populations: A comparative study. Chinese Journal of Applied Ecology 22: 873–879. [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The microsatellites and raw sequences developed in this article have been deposited in the National Center for Biotechnology Information (NCBI). The GenBank accession numbers for the microsatellites are provided in Table 1, and the accession numbers for the raw sequences in the NCBI Sequence Read Archive are SRR7133729 and SRR7133728.