Skip to main content
NCBI home page
Applications in Plant Sciences logoLink to Applications in Plant Sciences
. 2019 Feb 21;7(2):e01222. doi: 10.1002/aps3.1222

Isolation and characterization of microsatellite loci for Rhododendron shanii (Ericaceae)

Tao Pan 1,2,†, Ya‐Li Pei 1,†, Kai Zhao 3,✉, Xin‐Yue Liu 1, Chen‐Cheng Wang 1, Bao‐Wei Zhang 1
PMCID: PMC6384321  PMID: 30828508

Abstract

Premise of the Study

We developed microsatellite primers for Rhododendron shanii (Ericaceae), a narrowly distributed species found in the Dabie Mountains, China, to study the genetic diversity, population structure, and evolutionary history of the species.

Methods and Results

Two terminal sequencing modes of the Illumina HiSeq platform were used to mine simple sequence repeat markers from large‐scale transcriptional groups. In this study, 24 microsatellite loci were screened. The number of alleles ranged from one to 20, and the levels of observed and expected heterozygosity ranged from 0.000 to 1.000 and 0.000 to 0.918, respectively. Most of these primers were successfully amplified in eight congeneric species (R. annae, R. chihsinianum, R. decorum, R. denudatum, R. fortunei, R. neriiflorum, R. rex, and R. simiarum).

Conclusions

These newly developed microsatellite loci will be useful for studying the genetic diversity and population structure of R. shanii and congeneric species.

Keywords: Ericaceae, genetic diversity, microsatellite, polymorphism, Rhododendron shanii

Rhododendron L. (Ericaceae, Ericales) is a genus of 1024 species of evergreen or deciduous woody plants in the heath family that are mainly distributed in Asia and the highlands of the Appalachian Mountains in North America. Most species have bright flowers that bloom from the end of winter to early summer. One member of the genus, R. shanii W. P. Fang, is endemic to the southern Dabie Mountains (Zhao et al., 2010). According to the IUCN Red List of Threatened Species (IUCN, 2018), R. shanii is classified as Vulnerable (VU) (Zhao et al., 2012). Analysis of the genetic diversity of endangered species is a primary focus of conservation biology because it can provide crucial information for the protection of rare and endangered species. In recent decades, microsatellites (also known as simple sequence repeat [SSR] markers) have been widely used as genetic markers for population genetics, phylogeography, and conservation genetics due to their high abundance, high levels of polymorphism, codominance, and transferability (Moriguchi et al., 2015). SSR markers have previously been developed for several species in Rhododendron (e.g., Delmas et al., 2011; Liu et al., 2017). However, as there are thousands of species in Rhododendron, these existing primers are not sufficient for population genetic research, particularly in the rare species R. shanii. In addition, although inter‐simple sequence repeat (ISSR) markers have been used to examine genetic diversity in R. shanii, these studies have not clearly revealed the genetic structure and population demographics of this species (Zhao et al., 2013). Therefore, it is important to develop microsatellite loci for R. shanii to facilitate extensive genetic studies of this species.

Here we developed a set of SSR markers to probe the genetic diversity in five wild populations of R. shanii, thereby guiding the conservation of this species. In addition, we tested the versatility and polymorphism of these primer sets in eight congeneric phylogenetically related species of Rhododendron (i.e., R. annae Franch., R. chihsinianum Chun & W. P. Fang, R. decorum Franch., R. denudatum H. Lév., R. fortunei Lindl., R. neriiflorum Franch., R. rex H. Lév., and R. simiarum Hance).

Methods and Results

Total RNA was extracted from dried leaves of multiple R. shanii plants (DZJ population; Appendix 1) using an EasyPure Plant RNA Kit following the manufacturer's instructions (TransGen Biotech Inc., Beijing, China). RNA integrity and quality were evaluated by agarose gel electrophoresis and spectrophotometry. A cDNA library was prepared using a TruSeq Stranded Total RNA Sample Prep Kit (Illumina, San Diego, California, USA), and sequencing was performed using the Illumina HiSeq 3000 platform (Illumina) as described by Berkman and Edwards (2012). For quality control of raw data, Trim Galore version 0.4.4 (Babraham Bioinformatics, http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/) was used to dynamically remove those low‐quality fragments with 10% chance of error in the base call from the 3′ ends of the sequencing data. The quality of the pre‐processed data was analyzed using FastQC version 0.11.5 (Andrews, 2010). A total of 78,354 contigs were obtained by de novo assembly using Trinity version 2.3.2 (Grabherr et al., 2011). All of the assembled contigs were searched for microsatellite loci using BatchPrimer 3 (You et al., 2008), with minimum repeat number of six for dinucleotides and five for tri‐, tetra‐, penta‐, and hexanucleotides. Primer sets were designed with Primer3 with default parameters (Untergasser et al., 2012). A total of 25,564 SSRs were identified from 23,264 contigs and used to design 17,251 microsatellite primer sets. Of these, 24 primer sets that amplified di‐ and tetranucleotide repeats with a minimum of five repeats (range 5–26) were selected at random to test for polymorphism. Raw transcriptome data were deposited in the National Center for Biotechnology Information (NCBI) Short Read Archive (SRA; BioProject no. PRJNA451306, BioSample no. SAMN08967869).

One hundred R. shanii samples were collected from five populations (Baimajian [BMJ], Duozhijian [DZJ], Shibigou [SBG], Tianhejian [THJ], and Tuojian [TJ]; Appendix 1). The leaves collected from one individual were regarded as a single sample. A modified cetyltrimethylammonium bromide (CTAB) method was used to extract total genomic DNA from 0.20 mg of leaf tissue (Wang et al., 2010). Each PCR amplification reaction contained 1 μL of DNA (100 ng), 0.5 μL of each primer (10 μM) (forward primer fluorescently labeled with FAM, HEX, or TAMRA; Table 1), 7.5 μL of 2× EasyTaq PCR Supermix (TransGen Biotech), and 5.5 μL of sterilized deionized water in a total volume of 15 μL. Amplification was performed on an ABI 2720 Thermal Cycler (Applied Biosystems, Waltham, Massachusetts, USA) under the following conditions: initial denaturation at 95°C for 5 min; followed by 35 cycles of 30 s at 95°C, at an annealing temperature of 53°C for 30 s, and at 72°C for 20 s; and a final extension at 72°C for 10 min. In order to read the SSR data clearly, the PCR products were individually processed on an ABI PRISM 3730 Genetic Analyzer (Applied Biosystems) with a GeneScan 500 Size Standard and analyzed using GeneMarker (version 1.3; SoftGenetics, State College, Pennsylvania, USA). MICRO‐CHECKER (van Oosterhout et al., 2004) was used to detect the presence of null alleles and errors in the microsatellite genotyping. The number of effective alleles (A e), observed heterozygosity (H o), and expected heterozygosity (H e) were calculated using GENETIX version 4.0 (Belkhir et al., 2001). All population genetic parameters were calculated for each population and across all populations of R. shanii. Deviations from Hardy–Weinberg equilibrium (HWE) were tested using GENEPOP version 3.4 (Rousset, 2008) using the following parameters: 10,000 dememorization steps, 20 batches, and 5000 iterations per batches. The function of each locus was determined by a BLAST search of the NCBI database.

Table 1.

Characteristics of the 24 microsatellite loci developed in Rhododendron shanii

Locus Primer sequences (5′–3′) Repeat motif Allele size range (bp) T a (°C) Function [Organism] E‐value GenBank accession no.
Rho01 F: TAMRA‐TCCGAGTTCTGATATTGAATGTGT (TTCT)5 265–284 55 Unknown Unknown MH211009
R: AAGACCAAAGTTGCCACCGA
Rho02 F: TAMRA‐CCAATGCTCGATCTTCTGC (AAAG)5 264–288 55 Phaseolus vulgaris hypothetical protein [Phaseolus vulgaris] 1e‐64 MH211010
R: TGCCCAGTTCGTTGTCTAGG
Rho03* F: FAM‐GAGTCGGATCGTAGGCTTGG (CTTC)5 178–215 54 Proline rich coiled‐coil 2C [Seriola lalandi dorsalis] 5e‐07 MH211011
R: TTGCAGGGTCAGGGAGAAAG
Rho04* F: TAMRA‐GGTGGCGAAGTTGGTAATGC (GTCT)5 248–275 55 Uncharacterized LOC104098765 [Nicotiana tomentosiformis] 2e‐72 MH211012
R: ACTGCGCCCAAGGTTGTTAT
Rho05* F: FAM‐TCTCTCTCCCTCCCTTCAGC (TGTC)5 145–164 55 B. verrucosa Betv III [Betula pendula] 2e‐49 MH211013
R: TCACTTGAGCCAATCCCAGG
Rho07 F: HEX‐ACAACACCTACCTTGGAGCG (TGAT)5 180–199 54 Hypothetical protein [Populus trichocarpa] 1e‐65 MH211014
R: TCTCCGTTGCCTTTACCGAC
Rho09* F: FAM‐TATATGGCTGGGGTCCGTGA (TTTA)5 130–158 55 Unknown Unknown MH211015
R: ATATGGGCGGATTGGGTTGG
Rho11* F: TAMRA‐TGTGTTTCTTCGGCCATGGA (AGAA)6 230–254 55 Unknown Unknown MH211016
R: TCTGTTTACTTGGAATATTGGGTTGT
Rho12 F: HEX‐CTAGACGAGATCCCCACCCA (AGAC)6 226–268 55 60S ribosomal protein L6‐3‐like [Raphanus sativus] 6e‐28 MH211017
R: GTTGCTGAGCGGGTTTCTTG
Rho14 F: FAM‐TCACCTCCCTCTCACTCCTC (TC)26 102–155 55 Cultivar Brigitta calmodulin‐1 [Vaccinium corymbosum] 5e‐48 MH211018
R: GATCCGCCATTTCGATTGCC
Rho15 F: FAM‐AATCCCACCTCTCAAACCCT (TC)25 143–176 55 Unknown Unknown MH211019
R: AGGCTACAAAGAAACGGACGA
Rho16 F: HEX‐CTCCCCATTCACACAACCCA (TC)24 150–210 55 Auxin early response protein AUX/IAA4 [Camellia sinensis] 5e‐144 MH211020
R: ACCCTCATACAACACGGAGC
Rho17 F: TAMRA‐TCCCTTTCACTAAACCCTACAGA (CT)23 240–274 56 DEAD‐box ATP‐dependent RNA helicase 53 [Vitis vinifera] 7e‐122 MH211021
R: GCCGGAGATTGCATTTGTGG
Rho18 F: HEX‐CGTCAGGTGCAAAGGGTTTC (GA)23 151–191 54 Uncharacterized LOC17898248 [Capsella rubella] 8e‐67 MH211022
R: TCTCTTTCTCTTTCCACAACACC
Rho20 F: FAM‐GAGGGAGATCTCTGTCGGGT (GA)21 96–125 55 Mannosyl‐oligosaccharide
1,2‐alpha‐mannosidase [Vitis vinifera] 		0.0 MH211023
R: CTTTGCTTCGGAGTCCTCGT
Rho21 F: HEX‐GATTGAAGTTCGGCCCAACG (CT)21 160–210 54 Uncharacterized LOC100854951 [Vitis vinifera] 1e‐68 MH211024
R: ACTCTCTCCATCCAAACGACC
Rho22 F: HEX‐GAGAAGCGGCAGTTGAGAGT (AG)21 201–229 56 Unknown Unknown MH211025
R: TCATCTTCACACACGGCACC
Rho23 F: FAM‐TCACCTCCCTCTCACTCCTC (TC)21 98–146 55 Cultivar Brigitta calmodulin‐1 [Vaccinium corymbosum] 5e‐48 MH211026
R: GATCCGCCATTTCGATTGCC
Rho27 F: HEX‐AACACGAACGGCAAAGAACG (GA)20 172–210 55 Sphingoid long‐chain bases kinase 2 [Cynara cardunculus] 0.0 MH211027
R: AGGGACCACAATGAACCTTACA
Rho29 F: FAM‐TCACCCCACCCATCTCTCAA (AG)17 82–110 55 Transcript variant X1 [Quercus suber] 0.0 MH211028
R: GAAGCACACCCAGTACCCAT
Rho30 F: FAM‐ TGGCTCTCCTCTTCATTTATTAGAA (CT)16 85–115 56 Unknown [Diplarche multiflora] 7e‐17 MH211029
R: TCATCTTCACACACGGCACC
Rho31 F: FAM‐CAGGAGATGAGAGACAGCCG (TC)16 106–140 55 Unknown Unknown MH211030
R: AATCACTGCTCCCAACCTCC
Rho32 F: HEX‐ACAACAACTGGACCCTGCTT (CT)16 126–165 55 Unknown Unknown MH211031
R: AGATGATTGATGGGATGAAGATGA
Rho33 F: HEX‐TCTCTCCTCTCCATCGATCGT (GA)23 185–235 54 Uncharacterized LOC108988035 [Juglans regia] 3e‐39 MH211032
R: CCGTTCTGGTGTTGCTGTTG
Open in a new tab

T a = annealing temperature.

*

Indicates significant deviation from Hardy–Weinberg equilibrium after Bonferroni correction for the total population (P < 0.01).

In this study, we screened 24 microsatellite loci, revealing a total of 291 alleles. Considering all populations, five loci were found to deviate from HWE (P < 0.01) in R. shanii (Table 1). The nuclear genetic diversity varied between populations, with A e ranging from 5.83 (SBG) to 7.54 (THJ), H o from 0.650 (SBG) to 0.718 (DZJ), and H e from 0.591 (SBG) to 0.685 (THJ). Overall, SBG showed the lowest genetic diversity of the five populations (Table 2). The deviation from HWE was likely related to sample size, substructuring of the samples, or intra‐population inbreeding. Across all five populations of R. shanii using the 24 loci, the number of alleles ranged from one to 20, H o ranged from 0.000 to 1.000, and H e ranged from 0.000 to 0.918 (Table 2). Putative functions were identified for 17 microsatellite loci through BLAST searches (Table 1). We next tested these 24 primer sets for cross‐amplification in R. annae, R. chihsinianum, R. decorum, R. denudatum, R. fortunei, R. neriiflorum, R. rex, and R. simiarum (Appendix 1). Most of the primers also amplified products in these eight species and no null alleles were found (Table 3).

Table 2.

Genetic diversity of the 24 newly developed microsatellites in five populations of Rhododendron shanii.a

Locus BMJ (n = 20) DZJ (n = 20) SBG (n = 20) THJ (n = 20) TJ (n = 20) Total
A H o H e A H o H e A H o H e A H o H e A H o H e A H o H e
Rho1 4 0.970* 0.759 4 1.000* 0.616 4 0.885* 0.607 4 0.500* 0.523 4 0.722* 0.627 4 0.800 0.698
Rho2 5 0.515* 0.520 6 0.667* 0.731 5 0.192* 0.251 2 0.467 0.398 3 0.444 0.387 6 0.450 0.481
Rho3 7 0.788 0.812 8 0.697 0.808 6 0.500 0.596 6 0.500 0.785 6 0.583 0.746 8 0.630 0.784
Rho4 6 0.364 0.632 3 0.455 0.363 6 0.346 0.569 5 0.367 0.490 5 0.629 0.684 8 0.400 0.596
Rho5 3 0.152* 0.455 5 0.424* 0.642 2 0.000* 0.145 1 0.000 0.000 2 0.000* 0.407 5 0.061 0.407
Rho7 8 0.606* 0.753 5 0.667* 0.683 4 0.154 0.389 4 0.321 0.611 7 0.361 0.585 10 0.343 0.637
Rho9 2 0.333 0.282 1 0.000 0.000 1 0.000 0.000 3 0.393 0.495 2 0.083 0.081 3 0.163 0.206
Rho11 5 0.182 0.394 2 0.424 0.339 3 0.577 0.446 6 0.393* 0.720 4 0.233 0.445 6 0.344 0.461
Rho12 4 0.212* 0.276 4 0.697* 0.592 2 0.038 0.038 2 0.333 0.325 2 0.278 0.243 4 0.300 0.298
Rho14 10 0.939 0.870 12 1.000 0.897 12 0.923 0.900 13 0.929 0.890 12 0.917 0.868 16 0.939 0.909
Rho15 13 0.969 0.902 12 1.000 0.863 10 0.846 0.827 12 0.828 0.910 12 0.943 0.904 15 0.928 0.901
Rho16 12 0.788 0.858 10 0.656 0.874 9 0.731 0.749 13 0.967 0.845 20 0.972 0.910 20 0.778 0.879
Rho17 12 0.848 0.834 9 1.000 0.837 6 0.654 0.659 13 0.821 0.845 13 0.941 0.853 16 0.842 0.860
Rho18 13 0.844 0.855 9 0.750 0.864 10 0.808 0.869 15 0.963 0.892 14 0.742 0.875 19 0.832 0.885
Rho20 8 0.879 0.798 7 0.970 0.657 7 1.000* 0.716 9 0.931 0.835 9 0.972 0.784 13 0.940 0.778
Rho21 12 0.879 0.809 8 1.000* 0.836 8 0.731 0.741 11 0.929 0.839 10 0.806 0.776 14 0.867 0.844
Rho22 7 0.938 0.697 7 0.938 0.654 6 0.962 0.644 6 0.967 0.703 6 0.970 0.684 9 0.948 0.680
Rho23 10 0.879 0.877 16 0.970 0.918 12 0.885 0.893 14 0.900* 0.901 11 0.833 0.848 16 0.897 0.902
Rho27 8 0.871 0.775 5 0.688 0.761 10 0.731 0.807 11 0.900 0.815 13 0.917 0.846 19 0.776 0.820
Rho29 11 1.000 0.869 5 0.909 0.702 7 0.885 0.729 9 0.867 0.841 9 0.861 0.831 11 0.920 0.814
Rho30 6 0.909 0.638 8 0.758 0.590 4 0.962 0.575 6 0.828 0.606 5 0.833 0.590 10 0.870 0.605
Rho31 6 1.000 0.622 6 0.939 0.683 4 1.000* 0.667 6 0.967 0.754 6 0.917 0.697 10 0.940 0.689
Rho32 13 1.000 0.888 7 0.727* 0.790 9 0.800 0.805 14 0.828 0.851 13 0.972 0.864 16 0.848 0.889
Rho33 12 0.970 0.886 6 0.879 0.776 6 0.962 0.790 12 0.931 0.897 12 0.912 0.851 12 0.918 0.863
Total loci 7.21±0.61 0.707±0.058 0.674±0.040 6.00±0.51 0.718±0.057 0.671±0.042 5.83±0.55 0.650±0.070 0.591±0.051 7.54±0.80 0.712±0.057 0.685±0.044 7.21±0.79 0.700±0.066 0.674±0.044 6.76±0.30 0.697±0.027 0.659±0.020
Open in a new tab

A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; n = number of individuals.

a

Voucher and locality information are provided in Appendix 1.

*

Indicates significant deviation from Hardy–Weinberg equilibrium after Bonferroni correction for each population (P < 0.01).

Table 3.

Cross‐amplification results for the 24 microsatellite loci developed for Rhododendron shanii in eight species of Rhododendron, as indicated by allele size ranges.a , b

Locus R. decorum R. chihsinianum R. simiarum R. denudatum R. neriiflorum R. fortunei R. annae R. rex
Rho1 268–270 268–270 268–280 268–280 266–268 264–268 268 270
Rho2 266–274 266–270 270–276 274–276 276–286 266–270 266–276 270–274
Rho3 185–189 189–203 183–197 189–203 211–213 197–199 187–199 197–199
Rho4 261–263 267–273 257–259 257–259 257–259 257–261 257–259 253–257
Rho5 152–156 152–156 156 156–162 152–162 152–156 152 148–152
Rho7 181–189 181–189 189–197 181–189 189–197 189–197 189–197 189–193
Rho9 — 131 — — — 131 — —
Rho11 235 231–235 231–235 243–247 243–247 243–247 231–235 235–239
Rho12 240–264 254 236 230–234 230 250 230–252 230
Rho14 132–138 126–128 116–124 128–130 112–118 116–126 116–132 120–130
Rho15 150–154 156–158 146–158 144–158 160–162 154 146–154 150–164
Rho16 161–199 177–185 177–203 175–185 151–183 159–163 185–195 175–179
Rho17 251–259 251–163 251–255 247–259 249–261 245–257 247–257 249–257
Rho18 162 176–178 152 158 160 178 160–188 152–158
Rho20 104–108 100–102 98–100 100–102 98–102 100–110 98–100 100–102
Rho21 180 180 194 162–178 178–192 180 180 180
Rho22 202–204 220–222 206 208–218 208–218 206–208 — 208–210
Rho23 132–138 126–128 116–124 126–130 106–112 120–126 98–116 98–130
Rho27 177–179 179–193 191–195 173–177 183–193 177–201 177–181 181–207
Rho29 97–107 93–101 93–101 97–101 85–91 105–107 91–97 89–97
Rho30 87–97 99–101 87–89 85–89 — 85–97 87–97 87–97
Rho31 114–136 124–136 118–136 112 108–118 136 136 —
Rho32 146 146 150–154 146–158 146 128–146 146 152–156
Rho33 209–231 201–211 201–233 187–211 213–215 205–211 193–209 195
Open in a new tab

— = unsuccessful amplification.

a

N = 6 for all species.

b

Voucher and locality information are provided in Appendix 1.

Conclusions

We identified 25,564 SSRs from 23,264 contigs and designed 17,251 microsatellite primers. The 24 novel microsatellite markers identified in this study are valuable tools that will be useful for investigating population structure, gene flow levels, and mating systems, as well as for conservation genetic studies of R. shanii. These microsatellite primers could also be used to genotype congeneric species (R. annae, R. chihsinianum, R. decorum, R. denudatum, R. fortunei, R. neriiflorum, R. rex, and R. simiarum).

Acknowledgments

The authors thank the College of Resources and Environment of Anqing Normal University for the Rhododendron samples. This work was supported by the Graduate Student Academic Innovation Research of Anhui University (yqh100113) and Research start‐up funds of Anhui Normal University (751865).

Appendix 1. Voucher information for the Rhododendron species used in this study.

Species Population Collection locality Geographic coordinates n Voucher IDa
R. shanii BMJ Baimajian, Anhui, China 31°7′N, 116°11′E 20 AHD‐dz‐bmj‐201703
DZJ Duozhijian, Anhui, China 30°59′N, 116° 7′E 20 AHD‐dz‐dzj‐201703b
SBG Shibigou, Anhui, China 30°58′N, 116° 5′E 20 AHD‐dz‐sbg‐201703
THJ Tianhejian, Anhui, China 31°4′N, 116°11′E 20 AHD‐dz‐thj‐201703
TJ Tuojian, Anhui, China 30°55′N, 116° 5′E 20 AHD‐dz‐tj‐201703
R. annae Franch. Lushan Botanical Garden, Jiangxi, China 29°51′N, 115°59′E 6 AHD‐ty‐201709
R. chihsinianum Chun & W. P. Fang Lushan Botanical Garden, Jiangxi, China 29°51′N, 115°59′E 6 AHD‐ht‐201709
R. decorum Franch. Lushan Botanical Garden, Jiangxi, China 29°51′N, 115°59′E 6 AHD‐dbh‐201709
R. denudatum H. Lév. Lushan Botanical Garden, Jiangxi, China 29°51′N, 115°59′E 6 AHD‐zy‐201709
R. fortunei Lindl. Lushan Botanical Garden, Jiangxi, China 29°51′N, 115°59′E 6 AHD‐yj‐201709
R. neriiflorum Franch. Lushan Botanical Garden, Jiangxi, China 29°51′N, 115°59′E 6 AHD‐hh‐201709
R. rex H. Lév. Lushan Botanical Garden, Jiangxi, China 29°51′N, 115°59′E 6 AHD‐dw‐201709
R. simiarum Hance Lushan Botanical Garden, Jiangxi, China 29°51′N, 115°59′E 6 AHD‐htdj‐201709
Open in a new tab

n = number of individuals.

a

All voucher specimens were collected by Kai Zhao and deposited at Anhui University (AHU), Heifei, Anhui, China.

b

Voucher used for RNA extraction.

Pan, T. , Pei Y.‐L., Zhao K., Liu X.‐Y., Wang C.‐C., and Zhang B.‐W.. 2019. Isolation and characterization of microsatellite loci for Rhododendron shanii (Ericaceae). Applications in Plant Sciences 7(2): e1222.

Data Accessibility

Raw transcriptome data were deposited in the National Center for Biotechnology Information (NCBI) Short Read Archive (BioProject no. PRJNA451306, BioSample no. SAMN08967869). Sequence information for the developed primers has been deposited to NCBI; GenBank accession numbers are provided in Table 1.

Literature Cited

  1. Andrews, S. 2010. FastQC: A quality control tool for high throughput sequence data. Website http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ [accessed 11 January 2019].
  2. Belkhir, K. , Borsa P., and Chikhi L.. 2001. 1996–2001. GENETIX 4.02, logiciel sous Windows pour la génétique des populations. Laboratoire Génome, Populations, Interactions, CNRS‐UPR, Université de Montpellier II, Montpellier, France
  3. Berkman, P. J. , and Edwards D.. 2012. Next‐generation sequencing applications for wheat crop improvement. American Journal of Botany 99: 365–371. [DOI] [PubMed] [Google Scholar]
  4. Delmas, C. E. L. , Lhuillier E., Pornon A., and Escaravage N.. 2011. Isolation and characterization of microsatellite loci in Rhododendron ferrugineum (Ericaceae) using pyrosequencing technology. American Journal of Botany 98(5): e120–e122. [DOI] [PubMed] [Google Scholar]
  5. Grabherr, M. G. , Haas B. J., Yassour M., Levin J. Z., Thompson D. A., Amit I., Adiconis X., et al. 2011. Full‐length transcriptome assembly from RNA‐Seq data without a reference genome. Nature Biotechnology 29(7): 644–652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. IUCN . 2018. The IUCN Red List of Threatened Species, Version 2018‐2. Website http://www.iucnredlist.org [accessed 11 January 2019].
  7. Liu, D. , Zhang Y., Wang S., Liao M., and Fan X.. 2017. Development and characterization of 23 microsatellite loci for Rhododendron ovatum (Ericaceae). Applications in Plant Sciences 5(1): 1600106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Moriguchi, Y. , Yamanaka H., Ohdan T., and Fuji S. I.. 2015. Development and characterization of polymorphic microsatellite markers for Neolitsea sericea using Illumina paired‐end draft sequencing data. Plant Species Biology 11: 42–46. [Google Scholar]
  9. van Oosterhout, C. V. , Hutchinson W. F., Wills D. P. M., and Shipley P.. 2004. MICRO‐CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535–538. [Google Scholar]
  10. Rousset, F. 2008. GENEPOP'007: A complete re‐implementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103–106. [DOI] [PubMed] [Google Scholar]
  11. Untergasser, A. , Cutcutache I., Koressaar T., Ye J., Faircloth B. C., Remm M., and Rozen S. G.. 2012. Primer3–New capabilities and interfaces. Nucleic Acids Research 40: e115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Wang, S. Z. , Pan L., Hu K., Chen C. Y., and Ding Y.. 2010. Development and characterization of polymorphic microsatellite markers in Momordica charantia (Cucurbitaceae). American Journal of Botany 97: e75–e78. [DOI] [PubMed] [Google Scholar]
  13. You, F. M. , Huo N., Gu Y. Q., Luo M.‐C., Ma Y., Hane D., Lazo G. R., et al. 2008. BatchPrimer3: A high throughput web application for PCR and sequencing primer design. BMC Bioinformatics 9: 253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Zhao, K. , Yang W. H., Chen W. L., and Shao J. W.. 2010. A revise of stamen number to an endangered plant: Rhododendron shanii Fang. Bulletin of Botanical Research 30: 664–667. [Google Scholar]
  15. Zhao, K. , Shao J. W., Wang G., and Wang G. X.. 2012. Analyses of geographical distribution and population status of Rhododendron shanii . Journal of Plant Resources and Environment 21: 93–97. [Google Scholar]
  16. Zhao, K. , Wang D. Y., Zhang W. J., and Shao J. W.. 2013. Genetic diversity of Rhododendron shanii based on ISSR analysis. Plant Diversity and Resources 35(5): 578–584. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Raw transcriptome data were deposited in the National Center for Biotechnology Information (NCBI) Short Read Archive (BioProject no. PRJNA451306, BioSample no. SAMN08967869). Sequence information for the developed primers has been deposited to NCBI; GenBank accession numbers are provided in Table 1.

Articles from Applications in Plant Sciences are provided here courtesy of Wiley

RESOURCES