Skip to main content
BMC Microbiology logoLink to BMC Microbiology
. 2019 Feb 21;19:48. doi: 10.1186/s12866-019-1420-z

The application of the loop-mediated isothermal amplification (LAMP) method for diagnosing Enterococcus hirae-associated endocarditis outbreaks in chickens

Beata Dolka 1,, Agata Anna Cisek 2, Piotr Szeleszczuk 1
PMCID: PMC6385395  PMID: 30791887

Abstract

Background

Enterococcus hirae is considered a part of the normal intestinal biota of several domestic animals, including poultry. However, this species is also associated with infective endocarditis in chickens, a disease that leads to unexpected deaths and serious economical losses. Enterococcus hirae is identified predominantly with the use of conventional bacteriological methods, biochemical tests and PCR. Rapid, sensitive and specific methods for detecting E. hirae in clinical samples are required in poultry production. The aim of this study was to use the Loop-Mediated Isothermal Amplification (LAMP) for the identification and quantification of E. hirae in heart samples from broiler chickens.

Results

The specificity of the LAMP method was confirmed for 7 enterococcal strains and 3 non-enterococcal strains. E. hirae was detected in all of the 22 analyzed clinical bacterial isolates and in all of the 9 heart samples. Three sets of primers supported the detection of E. hirae with high sensitivity and specificity within one hour. The highest detection rate of a LAMP product was approximately 7 min for an E. hirae strain and 12 min for a positive heart sample. The detection limit for the E. hirae ATCC 10541 standard was 1.3 × 102 CFU (43.4 fg) or 13.8 copies of the E. hirae genome equivalent per reaction. The reaction was 10-fold more sensitive than conventional species-specific PCR. The LAMP assay supported the determination of the E. hirae load in chicken hearts with endocarditis in field cases. The average number of E. hirae cells in hearts was 5.19 × 107 CFU/g of tissue, and the average number of E. hirae genome equivalents in hearts was 5.51× 106 copies/g of tissue. Bacterial counts were significantly higher in the LAMP assay than in the standard plate count.

Conclusions

The LAMP assay is a useful diagnostic tool and an effective alternative to conventional methods for the detection of this enterococcal species. The sodA-based LAMP assay supported direct identification of E. hirae from pure cultures and heart samples without previous bacterial cultivation. This is the first study to apply the LAMP method for the purpose of diagnosing E. hirae-associated endocarditis in poultry.

Keywords: Broiler chickens, Endocarditis, Enterococcus hirae, LAMP, qPCR, CFU

Background

Enterococcus hirae is one of the 58 known species of the genus Enterococcus. E hirae was first described as a new species in 1985 by Farrow and Collins in strains that had been previously referred to as Enterococcus faecium. These authors established the distinct taxonomic position of E. hirae as a species that is separate from E. casseliflavus, E. durans and E. faecium [1]. Enterococcus hirae is considered a part of normal intestinal biota and an opportunistic pathogen in birds and mammals [24]. In the group of enterococci that constitute normal poultry microbiota, E. hirae has been relatively rarely isolated from the intestines. Devriese et al. [5] demonstrated that E. hirae colonizes the small intestines of 3- to 4-week-old chickens, and – less frequently − 12-week-old chickens, but the bacterium was not isolated from the crop or the cecum. In chickens from tropical regions, E. hirae was detected in cecal and cloacal swabs only in birds older than 8 weeks [6].

According to the literature, E. hirae is the fourth (2.7%) most common Enterococcus species identified in poultry [7]. In a study where samples were composed of 97% hearts, E. hirae was detected in 4.6% of the samples (after E. faecalis – 74.7%, E. faecium – 10.1%, E. gallinarum – 5.5%). Enterococcus hirae was isolated mainly from laying hens (CL) (8.3%), turkeys (5.6%) and broilers (CB) (5.5%), but it was never detected in broiler breeder chickens (BB) [8]. According to other authors E. hirae was more prevalent in ducks (6.2%) than in CB (3.6%), BB (2.4%), CL (1.8%) and turkeys (0.7%) [7]. Enterococcus hirae was not detected in geese [7, 8]. The mean age of birds at the time of E. hirae isolation was approximately 3 days in ducks, 4 days in BB, 12–13 days in CB, 4 weeks in CL, and 6 weeks in turkeys [7]. Enterococcus hirae was not identified in chicks (1- to 5-day-old) in 9 diagnostically independent cases, but it was more frequently isolated from older chickens (5 days – 6 weeks) (48%) [9].

According to the original reports from 1985, E. hirae was associated with growth depression in young chickens [1]. Saikia et al. [6] observed that this species could be potentially pathogenic in chickens younger than 1 week. Devriese et al. [10] were the first to determine that E. hirae could cause septicemia and focal necrosis of the brain in 3- to 8-day-old chicks. Cases of E. hirae septicemia were also noted in 10 species of psittacine birds [11]. Enterococcus hirae can cause encephalomalacia in 1- to 2-week-old broilers and layers [10, 12]. The bacterium should be also included in differential diagnoses of diarrhea in chicks [13] and osteomyelitis in broiler chickens [14]. Since the 1990s, E. hirae has been recognized as an important etiological agent of bacterial endocarditis in chickens [1517]. The prevalence of E. hirae in the microbiome of chicken hearts with endocarditis is unknown. E. hirae infections are characterized by fibrinous thrombotic lesions in atrioventricular (AV) valves, less often in the lungs, the external ischiadic artery (arteria ischiadica externa), liver and brain vessels. Velkers et al. [17] detected Enterococci in 54% of the examined hearts. The percentage of affected hearts was highest in 2- to 3-week-old (47%) and 3- to 4-week-old broiler chickens (46%). In another study, E. hirae was isolated from 42% of birds (20-days-old) [16]. Outbreaks of E. hirae-associated endocarditis can cause economic losses in poultry production. Mortality peaks in the second week of broiler grow-out. E. hirae endocarditis is responsible for 36% of broiler deaths in the grow-out period. Lameness is occasionally observed [17].

In young birds, E. hirae infections may lead to only a minor increase in mortality without specific clinical signs. Outbreaks are not always clearly defined and may remain unnoticed or may be attributed to poor chick quality [16]. For this reason, the etiological agent and the prevalence of the infection are often not identified. An accurate diagnosis of the infection is crucial to avoid unnecessary antibiotic use and to select the most appropriate therapy. In most cases, diagnosis is considerably delayed, which could explain the presence of severe cardiac lesions during necropsy. The present study highlights the importance of proper diagnosis of enterococcal infections in poultry.

E. hirae is a zoonotic pathogen, but it rarely causes infections in humans [24]. Most human cases involved bacteremia accompanied by severe illness, such as acute pyelonephritis, pancreatitis, cholangitis, severe urinary tract infections or spondylodiscitis [4, 1820]. Three cases of human endocarditis caused by E. hirae have been reported to date [3, 21, 22].

Standard methods of enterococci identification rely on conventional culture-based approaches, including evaluations of colony morphology, Gram staining and analyses of biochemical properties [2]. Additional tests are required to identify E. hirae to species level. However, selected enterococci of avian origin are not always detected by commercially available automated identification systems. The problems associated with the phenotypic identification of E. hirae have prompted the development of more accurate molecular techniques. At present, E. hirae are identified with the use of PCR techniques based on the amplification of the sodA gene encoding superoxide dismutase (Mn) and gene sequencing [23]. The detection of E. hirae by conventional culture- and biochemical-based assays is time-consuming, laborious and requires several days. PCR assays are more rapid than conventional methods, but they require agarose gel electrophoresis; therefore, the identification of E. hirae can be completed in a few hours.

In 2002, a new nucleic acid amplification method, loop-mediated isothermal amplification (LAMP), was described by Notomi et al. [24]. LAMP is based on an autocycling strand-displacement reaction which uses specific DNA polymerase (such as Bst, Bsm or Gsp) and a set of 4 primers (F3, B3, FIP, BIP) complementary to the target gene. Additional two loop-creating primers may be used to improve amplification [25]. DNA is amplified under isothermal conditions with high specificity, sensitivity, efficiency and speed. The LAMP technique has revolutionized the detection of poultry pathogens, and it is a highly useful tool for the rapid detection of selected viruses, bacteria, fungi and protozoa [2633]. However, there are no published reports on the application of the LAMP method for the identification of E. hirae. In this study, the LAMP assay has been used to detect and quantify E. hirae responsible for endocarditis in broiler chickens. The LAMP technique was evaluated using a panel of bacterial DNA and heart samples from field outbreaks in broiler flocks. The results were compared with the outcomes of standard PCR and culture-based methods.

Methods

Bacterial strains and heart samples

A total of 22 field strains of E. hirae and 9 heart samples (tissue with lesions) from broiler chickens (CB) were analyzed. Each strain and heart represented a separate disease outbreak reported between 2011 and 2017 in Poland. All samples were obtained from the collection of the Division of Avian Diseases, Department of Pathology and Veterinary Diagnostics, Faculty of Veterinary Medicine of the Warsaw University of Life Sciences. Pursuant to the provisions of Polish and European Union law (Journal of Laws of 2015, item 266; Directive 2010/63/EU), the approval of the Animal Ethics Committee was not required for this study. Bacterial strains were isolated from heart samples suspected of enterococcal infection. Heart samples were collected during routine diagnostic necropsy of chickens from flocks suspected of E. hirae-associated endocarditis (Fig. 1). E. hirae was cultured from approximately 20–60% of hearts. Heart samples (valve fragments with heart blood) were plated onto Columbia agar supplemented with 5% sheep blood and onto Enterococcosel Agar plates containing esculin (Graso, Poland). They were incubated at 37 °C for 24 h in a CO2-enriched atmosphere. Bacterial isolates were initially characterized based on analyses of colony morphology (transparent grey to white colonies), Gram staining (Gram-positive) and catalase production (negative). The preliminary identification of E. hirae was carried out in the API Rapid ID 32 STREP system (bioMérieux France). Clinical strains were confirmed by sequencing (Genomed, Warsaw, Poland). The sequences of 6 randomly selected isolates were deposited in GenBank (MF356372 – MF356377).

Fig. 1.

Fig. 1

The chicken heart with severe lesions (arrows) on the right atrioventricular valve (asterisk) associated with E. hirae infection

DNA isolation from bacterial strains

The DNA from clinical bacterial strains was extracted by the boiling lysis method. Single colonies were selected from Columbia agar (with 5% sheep blood) and suspended in 0.5 ml of sterile water. The cell suspension was held in a boiling water-bath for 10 min to lyse the cells; it was chilled on ice for several seconds and centrifuged for 5 min at 10000 rpm. A supernatant (1 μl) was used for LAMP and conventional PCR reactions.

DNA isolation from heart samples

The DNA from the affected heart samples was extracted using the Sherlock AX kit (A&A Biotechnology, Gdańsk, Poland) with lysozyme-mutanolysin pretreatment. Briefly, 20 mg specimens of heart samples with visible lesions were transferred to 1.5 ml Eppendorf tubes, suspended in 300 μl of sterile water, 60 μl of lysozyme (10 mg/ml) and 5 μl of mutanolysin (10 U/μl). The solution was mixed in a vortex and incubated in the Thermomixer Compact (Eppendorf AG, Germany) at 37 °C for 15 min with shaking at 600 rpm. The solution was combined with 300 μl of lysis buffer L.1.4 and proteinase K (Sherlock AX, A&A Biotechnology, Gdańsk, Poland). It was vortexed (20 s) and incubated in the thermomixer at 50 °C with vigorous shaking at 1400 rpm for 60 min (until complete digestion). Samples were treated with 5 μl of RNAse (10 mg/ml) for 5 min at room temperature to remove residual bacterial RNA. Subsequently, the isolation was continued according to the first step of the Sherlock AX protocol. The final DNA pellet was dissolved in 20 μl of nuclease-free water (R0581, Thermo Fisher Scientific Inc., USA).

LAMP assay

The nucleotide sequences of the primers are shown in Table 1 (Novazym Polska s.c., Poznań, Poland). The primers were designed using LAMP Designer (OptiGene Ltd., UK) based on NCBI sequences of the sodA gene in E. hirae (GenBank number: EU02133). The location of the primers within a gene fragment is shown in Fig. 2. The total reaction mixture (12.5 μl) consisted of: 7.5 μl of the Isothermal MasterMix (ISO-001 OptiGene Ltd. UK), 3 μl of the primer mix, 1 μl of nuclease-free water and 1 μl of DNA. The primer mix consisted of: 0.5 μl of F3, 0.5 μl of B3, 2 μl of FIP, 2 μl of BIP, 1 μl of LoopF and 1 μl of LoopR, at 10 pmol/μl each. The LAMP assay was performed with the Stratagene Mx3005P QPCR instrument (Agilent Technologies Inc., Santa Clara, CA, USA) with a melting curve analysis step. The mixture was incubated for 80 cycles of 65 °C for 30 s. Fluorescence was measured after each cycle in the FAM channel. For melting (dissociation) curve analysis, the temperature was increased gradually from 65 °C to 95 °C at the default rate of 0.2 °C/s, and fluorescence data was collected continuously (all points) during the ramp. During the reaction, data were collected from two replicates, and the results were presented collectively.

Table 1.

Sequences of LAMP primers for detecting Enterococcus hirae (target sodA gene)

Primers name Sequence (5′-3′) Base pair length
F3 (forward outer primer) CCTACAGATATCAAGACTGCTG 22
B3 (backward outer primer) GCTGTTGAAGTGATCGCTA 19
FIP (F1c + F2; forward inner primer) ACCAGCATTTGGTGCCATGAGTAATAATGGTGGCGGACAT 40 (20 F1c, 20 F2)
BIP (B1c + B2; backward inner primer) CGAACCAACTGGTGCAATTAAAGAAAATTCTTCCTTAAATGTTGCAAAATC 51 (25 B1c, 26 B2)
LoopF (loop forward primer) TTCCAGAAGAAAGAATGGTTTGC 23
LoopB (loop reverse primer) GCGATTGATGAAACCTTTGGT 21

FIP consists of the F1c and F2 sequences; BIP consists of the B1c and B2 sequences. F1c and B1c were shown as underlined nucleotide sequences

Amplicon size amplified with the outer primers F3/B3 is 248 bp (Novazym Poland s.c., Poznań)

Fig. 2.

Fig. 2

Location and sequences of primers used in the LAMP assays. The positions of the LAMP primers are shown relative to the sodA gene fragment of Enterococcus hirae (accession no. CP003504.1). Right and left arrows indicate sense and complementary sequences. Green boxes: indicate the outer primers F3 and B3 (product size 248 bp); Blue boxes: indicate forward inner primer FIP (F1c + F2); Grey boxes: indicate backward inner primer BIP (B1c + B2); Yellow boxes: indicate Loop primers LF and LB. Red font indicates the location and sequence of LAMP product (139 bp). Blue font indicates the location of species-specific primers used in standard PCR (product size 187 bp)

Reaction time was assessed with and without loop primers to determine their influence on the speed of the LAMP assay. To confirm reaction accuracy, LAMP products were detected by separation in 2% agarose gel with ethidium bromide staining and were visualized under UV light (UVP, US). The presence of specific multiple ladder bands was considered a positive result. Finally, the LAMP product of E. hirae ATCC 10541 was confirmed by sequencing analysis. After gel electrophoresis, the shortest bands on agarose gel were cut out, purified with the GeneMATRIX Agarose-Out DNA Purification Kit (EURx, Gdańsk, Poland) and sequenced by Genomed (Warsaw, Poland). The obtained sequence fragments were analyzed using the NCBI BLAST Sequence Analysis Tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Specificity of the LAMP assay

The specificity of the LAMP assay was evaluated using the DNA of 7 Enterococcus reference ATCC strains: E. casseliflavus 700,327, E. cecorum 43,198, E. durans 6056, E. faecalis 29,212, E. faecium 700,221, E. gallinarum ATCC 700425 and E. raffinosus ATCC 49464), as well as 3 non-E. hirae strains (E. coli 25,922, Staphylococcus aureus 25,923, Rimerella anatipestifer). E. hirae ATCC 10541 was used as positive control. Nuclease-free water was used as negative control (NTC-Non Template Control).

Standard curve and sensitivity of the LAMP assay

Two calibration methods were used to generate the standard curve. In the first method, quantification was based on the number of cells present in the bacterial suspension (colony-forming units, CFU) before DNA extraction. In the second method, bacteria were quantified in silico with the use of a calculator for determining the number of copies of a template (URI Genomics and Sequencing Center) available online at http://cels.uri.edu/gsc/cndna.html [34]. The results were presented as genome equivalents (GE). The size of the E. hirae genome (~ 2.9 Mb) from the NCBI database was used in the calculations. According to the literature, sodA is probably a single copy gene [35]. The entire bacterial genomic DNA was extracted from 1.3 × 108 CFU/ml of E. hirae ATCC 10541 with the Genomic Mini AX Bacteria kit (A&A Biotechnology, Gdynia, Poland). The counts (CFU) of E. hirae ATCC 10541 were determined by plating on Enterococcosel Agar plates (Graso, Poland). DNA concentration was measured in the Nanodrop 2000 system (Thermo Scientific, USA). The concentration of bacterial genomic DNA was converted to genome equivalents in silico. Subsequently, a 10-fold dilution series of the DNA extracted from 1.3 × 108 CFU/ml to 1 CFU/ml was prepared. Each dilution with a volume of 1 μl was used in duplicate as a quantitative standard for Enterococcus. A standard curve was generated by plotting Cq values against the logarithmic values of bacterial counts (log10 CFU equivalent and GE). The sensitivity of the LAMP technique was assessed with 10-fold serial dilutions (100 to 10− 8) of E. hirae ATCC 10541 DNA with a concentration of 43.4 ng/μl up to 0.434 fg/μl, which corresponded to 0.138 to 1.38 × 107 genome copies per reaction.

The sensitivity of LAMP vs. PCR

The sensitivity of the LAMP technique and a standard PCR assay was compared with the use of the same DNA templates with identical concentrations and volumes. Two standard PCR assays were performed. The first assay involved outer primers F3/B3 (amplicon size 248 bp) from the LAMP test conducted in this study, and the second assay involved E. hirae-specific primers (amplicon size 187 bp) described by Jackson et al. [23]. Both PCR assays were performed in a volume of 25 μl containing 12.5 μl of the DreamTaq™ Green PCR Master Mix (2x) mix (K1081, Thermo Fisher Scientific Inc., USA)., 0.5 μl of each primer (10 pmol/μl), 1 μl of DNA and 10.5 μl of water. The amplification profile was as follows: initial denaturation at 95 °C for 4 min, followed by 30 cycles of 95 °C for 30 s, 55 °C for 60 s, 72 °C for 60 s, and final extension at 72 °C for 7 min [23]. The amplified DNA fragments were analyzed by electrophoresis in 1.2% (w/v) agarose gel. The PCR products obtained with LAMP primers (F3/B3) for E. hirae ATCC 10541 and randomly selected heart samples were verified by sequencing.

Detection of E. hirae in hearts by the standard plate count (SPC) method

The results of the LAMP assay and conventional agar plate enumeration were compared based on E. hirae loads in the affected hearts. Heart samples were suspended in sterile water (ratio 1:10), and serial 10-fold dilutions were prepared in sterile water. Each dilution in the amount of 100 μl was plated on Enterococcosel Agar (Graso, Poland). Three replicate plates for each dilution were inoculated, and the colony counts on each plate were averaged. The number of colony-forming units per gram (CFU/g) of heart tissue was calculated using standard laboratory methods.

Statistical methods

The Wilcoxon signed-rank test was used to determine statistically significant differences in E. hirae counts from LAMP and SPC assays. A two-tailed p-value of 0.05 was regarded as statistically significant. The agreement beyond chance between LAMP and PCR was assessed using Gwet’s AC1 coefficient rather than Cohen’s kappa to resolve the problem of unbalanced symmetrical marginal distribution of observations in the contingency table [36, 37]. Statistical analyses were performed in TIBCO Statistica 13.3 (TIBCO Statistics Inc.) and Microsoft Office Excel 2016.

Results

The direct detection of LAMP products was based on melting temperature profiles determined by melting curve analysis of the amplified products. A single peak in the melting curve at Tm 86–87 °C was regarded as indicative of a set of pure, specific amplicons. The first amplified products of the sodA gene fragment from the reference strain of E. hirae were detected within 8 min with loop primers (Cq 16.13; Tm 86.65 °C), and within 18 min (Cq 35.55; Tm 86.65 °C) without loop primers (Fig. 3). The nucleotide sequence of the LAMP product of the control strain was highly similar (99%) to E. hirae, and it was deposited in GenBank (MG581167).

Fig. 3.

Fig. 3

LAMP amplification graph and dissociation curves for E. hirae ATCC 10541 generated by running the assays with two and three sets of primers. Assay with the loop primers resulted in Cq value of 16.13, and melting peak at Tm 86.65 °C, whilst the one without the loop primers Cq value of 35.55, and melting peak at Tm 86.65 °C

Specificity of the LAMP assay

The LAMP assay demonstrated 100% specificity against different Enterococcus species and non-Enterococcus strains (Fig. 4a). Ladder-like DNA amplification products were detected only in E. hirae (positive LAMP reaction), and they were not identified in other strains (negative results) (Fig. 4b).

Fig. 4.

Fig. 4

Amplification graph (a) and agarose gel (1.5% w/v) electrophoresis of LAMP products (b) amplified from genomic DNA of E. hirae, other Enterococcus and non-Enterococcus strains. Lane 1: Neg-negative control, Lane 2: Pos-positive control, E. hirae (ladder-like band pattern), Lane 3: M-100-bp DNA ladder (Thermo Fisher Scientific Inc., USA), Lane 4–13: E. casseliflavus, E. cecorum, E. durans, E. faecalis, E. faecium, E. gallinarum, E. raffinosus, Escherichia coli, Staphylococcus aureus, Rimerella anatipestifer

The sensitivity of LAMP and conventional PCR assays

The sensitivity of the LAMP assay was tested using 10-fold serial dilutions of 1 μl of E. hirae ATCC 10541 DNA with a known number of colony counts and genome copies. Based on genome size and the concentration of genomic DNA, 43.4 ng of E. hirae ATCC 10541 DNA was equivalent to 1.38 × 107 genome copies. The detection limit of the LAMP assay was determined at 1.3 × 102 CFU (43.4 fg, 10− 6) or 13.8 copies of the E. hirae genome equivalent/reaction, and it was identical to that noted in the electrophoresis assay (Fig. 5a). The efficiency of the LAMP assay was 100%. The smallest detectable amount of E. hirae ATCC 10541 in the LAMP assay was obtained within 18 min, and the highest concentration was obtained within 8 min.

Fig. 5.

Fig. 5

Agarose gel electrophoresis after (A) LAMP, and (B) PCR assay with F3/B3 LAMP primers and (C) species-specific primers using 10-fold dilutions of DNA E. hirae ATCC 10541 as a sensitivity indicator. a) Neg-Negative control, M-100-bp DNA ladder, Lane 3–11: LAMP assay products using serial dilutions b) Neg-Negative control, M-50-bp DNA ladder (SM0373,Thermo Fisher Scientific Inc., USA), Lane 3–11: PCR results using serial dilutions and F3/B3 LAMP primers (product length 248 bp) c) Neg-Negative control, M-50-bp DNA ladder, Lane 3–11: PCR results using serial dilutions and species-specific primers (product length 187 bp)

The detection limit of conventional PCR with F3/B3 primers was similar to that of the LAMP assay, but the band for the 10− 6 dilution appeared to be weak-positive (Fig. 5b). Conventional PCR with a set of E. hirae-specific primers had a detection limit of 1.3 × 103 CFU (434 fg, 10− 5) or 138 genomic copies/reaction (Fig. 5c).

The applicability of LAMP for analyses of E. hirae strains and heart samples

LAMP products were detected in all of the tested 22 bacterial strains and all of the 9 heart tissue samples. The standard curve for LAMP-assisted quantification of bacterial DNA from hearts is presented in Fig. 6. Quantification results were also expressed in genome equivalents (GE) per gram of affected heart tissue (Table 2). In the LAMP assay, the average number of E. hirae equivalent genomes in hearts was determined at 5.51× 106 copies/g.

Fig. 6.

Fig. 6

Results of LAMP assay for E. hirae load in affected chicken heart samples (log of CFU/μl of DNA template). Results for hearts were visualized on standard curve, which was generated from a dilution series of genomic DNA E. hirae ATCC 10541 by plotting the quantification cycle values (Cq) against the log of the bacterial quantity (log10 CFU equivalent per μl of DNA template). Linear equation: y = − 3.319x + 41.23. R2 = 0,99. Amplification factor = 2.00

Table 2.

Detection of E. hirae in hearts of chickens representing different disease outbreaks

No. of affected heart LAMP – cells/g CFU counting LAMP – GE/g
H3 1.74 × 108 4.0 × 106 1.84 × 107
H7 1.13 × 108 5.0 × 106 1.2 × 107
H2 8.81 × 107 3.53 × 107 9.35 × 106
H4 6.91 × 107 2.0 × 106 7.34 × 106
H5 1.86 × 107 8.0 × 106 1.97 × 106
H1 4.84 × 106 3.3 × 106 5.14 × 105
H9 6.22 × 104 7.67 × 102 6.6 × 103
H6 9.36 × 103 2.33 × 105 9.94 × 102
H8 1.99 × 103 1.0 × 104 2.12 × 102
Mean 5.19 × 107 * 6.43 × 106 * 5.51 × 106
SD 6.27 × 107 1.11 × 107 4.61 × 106

LAMP – cells/g – bacterial cell number (log10 CFU equivalent) determined by LAMP

LAMP – GE/g – genome equivalents of E. hirae per g of heart sample calculated by LAMP

CFU – total viable E. hirae counts per g determined on selective agar after 24 h incubation

*statistical significance (p = 0.028) between bacterial cell number determined by LAMP and CFU (LAMP – cells/g vs. CFU counting)

The bacterial number of and genome equivalents were determined in 1 g of heart samples by LAMP and conventional plate-counting method

Melting peaks were determined in the range of 86.05–87.06 °C (Fig. 7a) for field strains and in the expected range of 86–87 °C for hearts (Fig. 7b). Non-specific peaks were not detected for the tested primer sets. In bacterial strains and heart samples, the results of the LAMP assay were confirmed by the presence of a characteristic ladder-like pattern in agarose gel electrophoresis (Fig. 7c, d) and by sequencing. Standard PCR assays were less sensitive than LAMP. Twenty-one of the 22 analyzed isolates (95.5%) produced positive results in the PCR assay with F3/B3 primers, and one isolate (4.5%) was negative (Fig. 8a). Nineteen isolates (86.4%) produced positive results in PCR with species-specific primers, 2 isolates produced weak bands, and 3 isolates (13.6%) were negative (Fig. 8b).

Fig. 7.

Fig. 7

Melting curves generated after LAMP assay using (a) DNA of bacterial strains isolated from heart tissue samples and (b) DNA isolated directly from affected heart tissue samples of broiler chickens. Agarose gel electrophoresis of the LAMP products amplified from DNA of (c) bacterial strains isolated from heart tissue and (d) heart tissue samples of broiler chickens. Pos – positive control (E. hirae ATCC 10541), NTC - Non Template Control, Neg-Negative control, M-100-bp DNA ladder (SM0323, Thermo Fisher Scientific Inc., USA), c) Lane 4–19: bacterial isolates 1–16. d) Lane 4–12: 9 heart samples

Fig. 8.

Fig. 8

Agarose gel electrophoresis showing the PCR products generated using DNA of bacterial isolates and (a) F3/B3 LAMP primers or (b) species-specific primers, and showing the PCR products generated using DNA isolated directly from the heart tissue samples and (c) F3/B3 LAMP primers or (d) species-specific primers. Neg-Negative control, Pos-Positive control, M-50-bp or 100 bp DNA ladder (Thermo Fisher Scientific Inc., USA), a), b) Lane 3–11: 22 bacterial isolates. c), d) Lane 4–12: 9 heart tissue samples

The results of the LAMP test were consistent with the PCR results for heart samples obtained with LAMP primers and E. hirae-specific primers (Fig. 8c, d). The agreement beyond chance between LAMP and PCR is presented in Table 3. The newly generated sequence fragments from PCR with F3/B3 LAMP primers confirmed the high homology of E. hirae sequences. The obtained sequences were deposited in GenBank under accession numbers MG581168 (control strain) and MG581169 (heart sample). The fastest detection time of a LAMP product was approximately 7 min for E. hirae strains and 12 min for heart samples. The PCR assay was completed in approx. 2 h, and agarose gel electrophoresis was required to detect the amplified products.

Table 3.

The agreement between LAMP assay and two standard PCRs (PCR with F3/B3 LAMP primers and PCR with species-specific primers)

Combination of tests AC1
LAMP vs. PCR with F3/B3 LAMP primersa 95.4% (86.1–100%)
LAMP vs. PCR with species-specific primersb 84.4% (68.0–100%)
PCR with F3/B3 LAMP primers vs. PCR with species-specific primers 89.1% (74.7–100%)

AC1: the first-order agreement coefficient

aLAMP primers from this study

bPrimers from Jackson et al. 2004

Enumeration of E. hirae in heart samples by the standard plate count (SPC) method

All LAMP-positive heart samples were examined for bacterial counts on plate agar. The results of E. hirae quantification in heart samples by LAMP and culture assays are presented in Table 2.

Discussion

Infections associated with enterococci often lead to growth depression and higher early mortality without specific clinical symptoms [1, 16]. Enterococcus hirae is not the only cause of endocarditis in chickens, and other pathogenic agents include Enterococcus faecalis, E. faecium, E. durans, Staphylococcus aureus, Staphylococcus simulans, Streptococcus gallinaceus, Streptococcus pluranimalium, Avibacterium endocarditidis, Gallibacterium anatis and Helcococcus ovis [3843]. For this reason, species-specific methods are needed for rapid and accurate identification of the causative agent. In this study, the LAMP method was used to diagnose Enterococcus hirae infections in poultry. Other authors relied on the LAMP technique to detect bacterial pathogens such as Salmonella spp., Streptococcus spp., Mycoplasma synoviae, Riemerella anatipestifer and Gallibacterium anatis in poultry [29, 30, 42, 44, 45]. A review of the literature revealed that the previously described LAMP assays for Enterococcus spp. had been developed primarily to target enterococci in water [46, 47]. Kato et al. [48] demonstrated that LAMP was a useful technique for the rapid detection of E. faecalis and for diagnosing persistent endodontic infections. In the LAMP assays for detecting bacteria responsible for endocarditis, bacteria from the samples had to be previously cultured and DNA had to be isolated from a pure culture [49, 50]. In other studies, bacteria (including the causative agents of endocarditis, but not E. hirae) were used directly in the LAMP test without prior culturing [48, 51, 52]. In this study, E. hirae were detected in clinical isolates and heart tissue samples for the first time with the use of the LAMP assay. The melting temperature of specific amplicons was determined at 86–87 °C. Positive reactions were further confirmed by agarose gel electrophoresis and sequencing. The specificity of the LAMP assay for E. hirae was confirmed in a reaction with DNA samples from other enterococcal and non-enterococcal species.

Loop primers were applied to shorten reaction time. Nagamine et al. [25] demonstrated that loop primers accelerated LAMP. In our study, the LAMP assay with loop primers supported product detection in the first 10 min of amplification. In LAMP assays without loop primers, the product was detected around 10 min later. Similarly to our studies, the highest available concentration of bacterial DNA in LAMP with loop primers was determined within approximately 10 min [42]. In the LAMP assay, the sodA gene was amplified within up to 60 min. The LAMP test was clearly faster than conventional PCR. Similar observations were made in a LAMP assay for the rapid detection of E. faecalis [48].

The detection limit of the LAMP assay was 1.3 × 102 CFU, which indicates that LAMP was an effective technique for the detection and quantification of E. hirae in samples. Based on a review of the literature, Martzy et al. [47] concluded that the LAMP method can reliably detect 130 copies of E. faecalis target DNA per reaction within 45 min. In our study, the detection limit (43.4 fg) was approximately twice lower than that reported by Kato et al. [48] for E. faecalis (100 fg/tube). Taking into account the concentration (ng/μl) and volume (1 μl/reaction) of the reference DNA in the LAMP assay in this study, the detection limit was lower than that noted for G. anatis strains in LAMP and qPCR tests [42].

According to the literature, the bacterial sensitivity of the LAMP assay can be 10- to 1000-fold higher relative to PCR, and the LAMP test can be equally or more sensitive than real-time PCR [46, 47, 5355]. In this study, the sensitivity parameters of LAMP and conventional PCR were compared in 10-fold serial dilutions of E. hirae ATCC 10541 template DNA. The sensitivity of the LAMP assay was comparable to that of conventional PCR with F3/B3 LAMP primers only, but agarose gel electrophoresis revealed that the minimum detectable dilution (10− 6) produced a barely visible band in the PCR assay. The sensitivity of the LAMP test for E. hirae was 10-fold higher relative to PCR with species-specific primers. E. hirae DNA was detected in heart samples with a generally small number of copies. PCR with F3/B3 primers and species-specific primers confirmed that LAMP amplified the correct target and was a highly specific technique for target amplification. These observations indicate that LAMP is a more effective method than PCR for detecting E. hirae in samples where lower bacterial counts are expected. Unlike standard PCR (with LAMP primers or species-specific primers), LAMP produced positive results for all E. hirae isolates and heart samples affected by E. hirae. The agreement beyond chance between LAMP and PCR was very high (> 80%), which indicates that these techniques can be used interchangeably. However, our results should be interpreted with caution due to the very small number of negative samples screened in each test. Further large-scale research is required to fully substantiate these results.

In an experimental challenge study, Chadfield et al. [56] induced endocarditis in intravenously inoculated 4-week-old chickens by administering approximately 108 CFU of a clinical strain of E. hirae. The inoculation with E. hirae via brachial and jugular veins produced culture-positive heart samples in 35 and 73% of the birds, respectively. Cardiac lesions included valvular endocarditis and were observed in 20 and 55% of the birds infected via brachial and jugular veins, respectively. However, bacterial counts in the affected tissues have not been investigated to date. In this study, the LAMP technique was used to estimate E. hirae loads in the hearts of commercial chickens which represented separate disease outbreaks. The variations in bacterial counts in hearts (103 – 108) could be attributed to different stages of infection in the examined flocks or differences in the pathogenic potential of E. hirae isolates. In this study, the bacterial load in the affected hearts determined by the LAMP method was compared with SPC results. The LAMP assay revealed significantly higher bacterial counts than SPC. The mean counts of viable E. hirae in hearts were approximately 8.1 times lower in SPC than in the LAMP test. Unlike SPC where only viable bacteria (replicating cells) are detected, the LAMP test and conventional qPCR amplify the DNA of both live and dead cells because DNA remains stable after bacterial death. The LAMP assay was essential for the accurate enumeration of E. hirae in tissue specimens. However, the main limitation of the LAMP test could be its inability to discriminate between live and dead cells. In this study, the lowest E. hirae counts determined in hearts by standard plating were 6 times higher than the detection limit of the LAMP test. Our results indicate that the LAMP assay could be helpful in overcoming certain limitations of conventional phenotypic procedures and plate-based enumeration for the detection of E. hirae.

Obviously, the applicability of the LAMP assay is limited to the detection, identification and quantification of E. hirae, and it cannot discriminate between clinical and commensal (normal) isolates. It is difficult to determine whether an isolate is the cause of an infection or whether it is non-pathogenic and is detected in samples due to contamination. Each isolation should be correlated with the health status and clinical signs in poultry. Predisposing factors could be involved in the establishment of infection. This is in contrast to other studies where predisposing factors were not evident in chickens prior to infection [56]. The properties responsible for the pathogenic potential of clinical E. hirae strains have not been elucidated to date. The differences between normal and pathogenic E. hirae have not been identified either. Further research is needed to characterize clinical E. hirae isolates, especially in relation to the presence of virulence factors.

Conclusions

To the best of our knowledge, this is the first report to describe the applicability of a sodA–based LAMP assay for the detection of Enterococcus hirae. It is also the first study to evaluate the applicability of the LAMP assay for the quantification of E. hirae in affected chicken heart samples. The LAMP method supported the identification and quantification of bacteria in DNA samples isolated directly from heart tissue without prior cultivation. The LAMP technique enabled fast, specific and sensitive quantification, and it can be applied as an alternative molecular diagnostic tool detecting E. hirae in veterinary samples. The LAMP assay may facilitate diagnosis of infective endocarditis in poultry, thus contributing to differential diagnosis and the selection of the appropriate treatment. In this study, the LAMP assay was successfully used to diagnose E. hirae-associated endocarditis in broiler chickens.

Acknowledgements

The authors would like to thank Michał Czopowicz, DVM PhD for statistical assistance. The authors are grateful to Anna Kolińska and Adam Burzyński of Novazym Poland s.c., Poznań for their help. The authors also wish to express gratitude to veterinary laboratories and veterinary practitioners for help in collecting samples for E. hirae analyses: Lab-Vet Sp. z o.o. Tarnowo Podgórne, Gabinet Weterynaryjny “Gallus” Sylwester Barabasz, “Spec-Drób” Mariusz Lorek, Mirosław Berezowski. Preliminary data were presented during the scientific conference entitled “Current problems in poultry pathology”, held on 29-30 June 2017 in Wroclaw, Poland.

Funding

This work was funded by internal grant in the Department of Pathology and Veterinary Diagnostics, Faculty of Veterinary Medicine of the Warsaw University of Life Sciences in Poland (decision No. 505–10-023700-N00176–99). The costs of manuscript publication were funded by KNOW (Leading National Research Centre) Scientific Consortium “Healthy Animal – Safe Food”, decision of Ministry of Science and Higher Education No. 05–1/KNOW2/2015. The funders had no role in the study design, data collection, analysis, and interpretation of data, and in writing the manuscript or decision to publish.

Availability of data and materials

The datasets supporting our findings are included in the article.

Abbreviations

CB

Chicken broiler flocks (commercial broilers)

CFU

Colony-forming unit

GE

Genome equivalents

LAMP

Loop-Mediated Isothermal Amplification

NTC

Non-Template Control

SPC

Standard plate count method

Tm

Melting temperature

Authors’ contributions

BD conceived the presented idea, coordinated the study, collected strains and samples, carried out LAMP and PCR assays, analyzed the results and interpreted the data, and wrote the manuscript. AAC provided helpful suggestions, initiated stimulating discussions and participated in the interpretation of results. PS co-initiator of the study, consulted the study project and results, input in study coordination. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Poultry samples were collected for laboratory diagnosis in line with good clinical practice standards, Polish ethical guidelines (Journal of Laws, 2015, item 266) and animal welfare regulations. This study did not require the approval of the Ethics Committee of the Warsaw University of Life Sciences.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Beata Dolka, Phone: +48 22 5936035, Email: beata_dolka@sggw.pl.

Agata Anna Cisek, Email: gutkac@op.pl.

Piotr Szeleszczuk, Email: piotr_szeleszczuk@sggw.pl.

References

  • 1.Farrow JAE, Collins MD. Enterococcus hirae, a new species that includes amino acid assay strain NCDO 1258 and strains causing growth depression in young chickens. Int J Food Microbiol. 1985;35:73–75. [Google Scholar]
  • 2.Devriese LA, Kerckhove AV, Kilpper-Bälz R, Schleifer KH. Characterization and identification of Enterococcus species isolated from the intestines of animals. Int J Syst Bacteriol. 1987;37:257–259. doi: 10.1099/00207713-37-3-257. [DOI] [Google Scholar]
  • 3.Poyart C, Lambert T, Morand P, Abassade P, Quesne G, Baudouy Y, Trieu-Cuot P. Native valve endocarditis due to Enterococcus hirae. J Clin Microbiol. 2002;40:2689–2690. doi: 10.1128/JCM.40.7.2689-2690.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Dicpinigaitis PV, De Aguirre M, Divito J. Enterococcus hirae bacteremia associated with acute pancreatitis and septic shock. Case Rep Infect Dis. 2015;2015:123852. doi: 10.12013/2015/123852. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Devriese LA, Hommez J, Wijfels R, Haesebrouck F. Composition of the enterococcal and streptococcal intestinal flora of poultry. J Appl Bacteriol. 1991;71:46–50. doi: 10.1111/j.1365-2672.1991.tb04480.x. [DOI] [PubMed] [Google Scholar]
  • 6.Saikia PK, Devriese LA, Kalita CC, Haesebrouck F, Dutta GN. Composition of the enterococcal intestinal flora of chickens in a tropical area. Lett Appl Microbiol. 1994;19:436–437. doi: 10.1111/j.1472-765X.1994.tb00975.x. [DOI] [Google Scholar]
  • 7.Dolka B, Gołębiewska-Kosakowska M, Krajewski K, Kwieciński P, Nowak T, Szubstarski J, Wilczyński J, Szeleszczuk P. Occurrence of Enterococcus spp. in poultry in Poland based on 2014-2015 data. Med Weter. 2017;3:193–256. [Google Scholar]
  • 8.Stępień-Pyśniak D, Marek A, Banach T, Adaszek Ł, Pyzik E, Wilczyński J, Winiarczyk S. Prevalence and antibiotic resistance of Enterococcus strains isolated from poultry. Acta Vet Hung. 2016;64:148–163. doi: 10.1556/004.2016.016. [DOI] [PubMed] [Google Scholar]
  • 9.Wilczyński J, Wystalska D. Lekowrażliwość bakterii izolowanych od chorych kurcząt brojlerów pochodzących z ferm zlokalizowanych w województwie wielkopolskim. Cz II Enterococcus spp Polskie Drobiarstwo. 2016;2:52–57. [Google Scholar]
  • 10.Devriese LA, Ducatelle R, Uyttebroek E, Haesebrouck F. Enterococcus hirae infection and focal necrosis of the brain of chicks. Vet Rec. 1991;129:316. doi: 10.1136/vr.129.14.316. [DOI] [PubMed] [Google Scholar]
  • 11.Devriese LA, Chiers K, De Herdt P, Vanrompay D, Desmidt M, Ducatelle R, Haesebrouck F. Enterococcus hirae infections in psittacine birds: epidemiological, pathological and bacteriological observations. Avian Pathol. 1995;24:523–531. doi: 10.1080/03079459508419091. [DOI] [PubMed] [Google Scholar]
  • 12.Randall CJ, Wood AM, MacKenzie G. Encephalomalacia in first-week chicks. Vet Rec. 1993;132:419. doi: 10.1136/vr.132.16.419-a. [DOI] [PubMed] [Google Scholar]
  • 13.Kondo H, Abe N, Tsukuda K, Wada Y. Adherence of Enterococcus hirae to the duodenal epithelium of chicks with diarrhoea. Avian Pathol. 1997;26:189–194. doi: 10.1080/03079459708419204. [DOI] [PubMed] [Google Scholar]
  • 14.Kolbjørnsen Ø, David B, Gilhuus M. Bacterial osteomyelitis in a 3-week-old broiler chicken associated with Enterococcus hirae. Vet Pathol. 2011;48:1134–1137. doi: 10.1177/0300985810396513. [DOI] [PubMed] [Google Scholar]
  • 15.McNamee PT, King DC. Endocarditis in broiler breeder rearers due to Enterococcus hirae. Vet Rec. 1996;138:240. doi: 10.1136/vr.138.17.419. [DOI] [PubMed] [Google Scholar]
  • 16.Chadfield MS, Christensen JP, Juhl-Hansen J, Christensen H, Bisgaard M. Characterization of Enterococcus hirae outbreaks in broiler flocks demonstrating increased mortality because of septicemia and endocarditis and/or altered production parameters. Avian Dis. 2005;49:16–23. doi: 10.1637/7205-050604. [DOI] [PubMed] [Google Scholar]
  • 17.Velkers FC, van de Graaf-Bloois L, Wagenaar JA, Westendorp ST, van Bergen MA, Dwars RM, Landman WJ. Enterococcus hirae-associated endocarditis outbreaks in broiler flocks: clinical and pathological characteristics and molecular epidemiology. Vet Q 2011;31:3–17. [DOI] [PubMed]
  • 18.Canalejo E, Ballesteros R, Cabezudo J, García-Arata MI, Moreno J. Bacteraemic spondylodiscitis caused by Enterococcus hirae. Eur J Clin Microbiol Infect Dis. 2008;27:613–615. doi: 10.1007/s10096-008-0476-8. [DOI] [PubMed] [Google Scholar]
  • 19.Chan TS, Wu MS, Suk FM, Chen CN, Chen YF, Hou YH, Lien GS. Enterococcus hirae-related acute pyelonephritis and cholangitis with bacteremia: an unusual infection in humans. Kaohsiung J Med Sci. 2012;28:111–114. doi: 10.1016/j.kjms.2011.06.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Pãosinho A, Azevedo T, Alves JV, Costa IA, Carvalho G, Peres SR, Baptista T, Borges F, Mansinho K. Acute pyelonephritis with bacteremia caused by Enterococcus hirae: a rare infection in humans. Case Rep Infect Dis. 2016;2016:4698462. doi: 10.12013/2016/4698462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Talarmin JP, Pineau S, Guillouzouic A, Boutoille D, Giraudeau C, Reynaud A, Lepelletier D, Corvec S. Relapse of Enterococcus hirae prosthetic valve endocarditis. J Clin Microbiol. 2011;49:1182–1184. doi: 10.1128/JCM.02049-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Anghinah R, Watanabe RG, Simabukuro MM, Guariglia C, Pinto LF, Gonçalves DC. Native valve endocarditis due to Enterococcus hirae presenting as a neurological deficit. Case Rep Neurol Med. 2013:636070. 10.12013/2013/636070.16. [DOI] [PMC free article] [PubMed]
  • 23.Jackson CR, Cray F–, PJ BJB. Use of a genus- and species-specific multiplex PCR for identication of enterococci. J Clin Microbiol. 2004;42:3558–3565. doi: 10.1128/JCM.42.8.3558-3565.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000;28:e63. doi: 10.1093/nar/28.12.e63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Nagamine K, Hase T, Notomi T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell Probes. 2002;16:223–229. doi: 10.1006/mcpr.2002.0415. [DOI] [PubMed] [Google Scholar]
  • 26.Deng X, Qi X, Gao Y, Wang Y, Qin L, Gao H, Gao L, Wang X. Development of a loop-mediated isothermal amplification method for rapid detection of reticuloendotheliosis virus. J Virol Methods. 2010;168:82–86. doi: 10.1016/j.jviromet.2010.04.021. [DOI] [PubMed] [Google Scholar]
  • 27.Huang CH, Lai GH, Lee MS, Lin WH, Lien YY, Hsueh SC, Kao JY, Chang WT, Lu TC, Lin WN, Chen HJ, Lee MS. Development and evaluation of a loop-mediated isothermal amplification assay for rapid detection of chicken anaemia virus. J Appl Microbiol. 2010;108:917–924. doi: 10.1111/j.1365-2672.2009.04481.. [DOI] [PubMed] [Google Scholar]
  • 28.Dinh DT, Le MT, Vuong CD, Hasebe F, Morita K. An updated loop-mediated isothermal amplification method for rapid diagnosis of H5N1 avian influenza viruses. Trop Med Health. 2011;39:3–7. doi: 10.2149/tmh.2010-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Han X, Ding C, He L, Hu Q, Yu S. Development of loop-mediated isothermal amplification (LAMP) targeting the GroEL gene for rapid detection of Riemerella anatipestifer. Avian Dis. 2011;55:379–383. doi: 10.1637/9602-112610-Reg.1. [DOI] [PubMed] [Google Scholar]
  • 30.Burzyński A, Jankowska M. Amplifikacja in vitro wybranych odcinków DNA i RNA metodą loop-mediated isothermal AMPlification (LAMP) Novazym. 2014;4:1–27. [Google Scholar]
  • 31.Woźniakowski G, Samorek-Salamonowicz E. Direct detection of Marek's disease virus in poultry dust by loop-mediated isothermal amplification. Arch Virol. 2014;159:3083–3087. doi: 10.1007/s00705-014-2157-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Xu J, Qu C, Tao J. Loop-mediated isothermal amplification assay for detection of Histomonas meleagridis infection in chickens targeting the 18S rRNA sequences. Avian Pathol. 2014;43:62–67. doi: 10.1080/03079457.2013.873112. [DOI] [PubMed] [Google Scholar]
  • 33.Barkway CP, Pocock RL, Vrba V, Blake DP. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. J Vis Exp. 2015;(96). 10.3791/52552. [DOI] [PMC free article] [PubMed]
  • 34.Staroscik A. Calculator for determining the number of copies of a template. URI Genomics and Sequencing Center. 2004; Available at http://cels.uri.edu/gsc/cndna.html.
  • 35.Wang Y, Wang H, Yang CH, Wang Q, Mei R. Two distinct manganese-containing superoxide dismutase genes in Bacillus cereus: their physiological characterizations and roles in surviving in wheat rhizosphere. FEMS Microbiol Lett. 2007;272:206–213. doi: 10.1111/j.1574-6968.2007.00759.x. [DOI] [PubMed] [Google Scholar]
  • 36.Gwet KL. Computing inter-rater reliability and its variance in the presence of high agreement. Br J Math Stat Psychol. 2008;61:29–48. doi: 10.1348/000711006X126600. [DOI] [PubMed] [Google Scholar]
  • 37.Czopowicz M, Szaluś-Jordanow O, Mickiewicz M, Moroz A, Witkowski L, Markowska-Daniel I, Bagnicka E, Kaba J. Influence of true within-herd prevalence of small ruminant lentivirus infection in goats on agreement between serological immunoenzymatic tests. Prev Vet Med. 2017;144:75–80. doi: 10.1016/j.prevetmed.2017.05.017. [DOI] [PubMed] [Google Scholar]
  • 38.Chadfield MS, Christensen JP, Christensen H, Bisgaard M. Characterization of streptococci and enterococci associated with septicaemia in broiler parents with a high prevalence of endocarditis. Avian Pathol. 2004;33:610–617. doi: 10.1080/03079450400013089. [DOI] [PubMed] [Google Scholar]
  • 39.Hedegaard L, Christensen H, Chadfield MS, Christensen JP, Bisgaard M. Association of Streptococcus pluranimalium with valvular endocarditis and septicaemia in adult broiler parents. Avian Pathol. 2009;38:2013–60. 10.1080/03079450902737763. [DOI] [PubMed]
  • 40.Bisgaard M, Bojesen AM, Christensen JP, Christensen H. Observations on the incidence and aetiology of valvular endocarditis in broiler breeders and detection of a newly described taxon of Pasteurellaceae, Avibacterium endocarditidis. Avian Pathol. 2010;39:177–181. doi: 10.1080/03079451003758096. [DOI] [PubMed] [Google Scholar]
  • 41.Stępień-Pyśniak D, Wilczyński J, Marek A, Śmiech A, Kosikowska U, Hauschild T. Staphylococcus simulans associated with endocarditis in broiler chickens. Avian Pathol. 2017;46:44–51. doi: 10.1080/03079457.2016.1203392. [DOI] [PubMed] [Google Scholar]
  • 42.Stepien-Pysniak D, Kosikowska U, Hauschild T, Burzynski A, Wilczynski J, Kolinska A, Nowaczek A, Marek a. A loop-mediated isothermal amplification procedure targeting the sodA gene for rapid and specific identification of Gallibacterium anatis. Poult Sci 2018; 0:1–7. Jan 25. doi: 10.3382/ps/pex420. [Epub ahead of print]. [DOI] [PubMed]
  • 43.Crispo M, Stoute S, Savaris T, Bickford A, Santoro T, Sentíes-Cué CG. Vegetative Valvular endocarditis and hepatitis associated with Helcococcus ovis in a 7-year-old white Leghorn rooster. Avian Dis. 2017;61:526–530. doi: 10.1637/11676-051917-Case.1. [DOI] [PubMed] [Google Scholar]
  • 44.Kursa O, Woźniakowski G, Tomczyk G, Sawicka A, Minta Z. Rapid detection of Mycoplasma synoviae by loop-mediated isothermal amplification. Arch Microbiol. 2015;197:319–325. doi: 10.1007/s00203-014-1063-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Gong J, Zhuang L, Zhu C, Shi S, Zhang D, Zhang L, Yu Y, Dou X, Xu B, Wang C. Loop-mediated isothermal amplification of the sefA gene for rapid detection of Salmonella Enteritidis and Salmonella Gallinarum in chickens. Foodborne Pathog Dis. 2016;13:177–181. doi: 10.1089/fpd.2015.2082. [DOI] [PubMed] [Google Scholar]
  • 46.Xu X, Zhang S, Wu Q, Zhang J, Li F, Cheng J. Development and application of a loop-mediated isothermal amplification (LAMP) method for rapid and sensitive detection of Enterococcus faecalis in drinking water. J Food Saf. 2014;34:103–110. doi: 10.1111/jfs.12101. [DOI] [Google Scholar]
  • 47.Martzy R, Kolm C, Brunner K, Mach RL, Krska R, Šinkovec H, Sommer R, Farnleitner AH, Reischer GH. A loop-mediated isothermal amplification (LAMP) assay for the rapid detection of Enterococcus spp. in water. Water Res. 2017;122:62–69. doi: 10.1016/j.watres.2017.05.023. [DOI] [PubMed] [Google Scholar]
  • 48.Kato H, Yoshida A, Ansai T, Watari H, Notomi T, Takehara T. Loop-mediated isothermal amplification method for the rapid detection of Enterococcus faecalis in infected root canals. Oral Microbiol Immunol. 2007;22:131–135. doi: 10.1111/j.1399-302X.2007.00328.x. [DOI] [PubMed] [Google Scholar]
  • 49.Su J, Liu X, Cui H, Li Y, Chen D, Li Y, Yu G. Rapid and simple detection of methicillin-resistance Staphylococcus aureus by orfX loop-mediated isothermal amplification assay. BMC Biotechnol. 2014;14:8. doi: 10.1186/1472-6750-14-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Yamazaki Y, Oba E, Kashiwagi N, Sugita K, Shiiba K, Baba Y, Shimoji Y, Yamazaki W. Development of a loop-mediated isothermal amplification assay for rapid and simple detection of Erysipelothrix rhusiopathiae. Lett Appl Microbiol. 2014;58:362–369. doi: 10.1111/lam.12198. [DOI] [PubMed] [Google Scholar]
  • 51.Misawa Y, Yoshida A, Saito R, Yoshida H, Okuzumi K, Ito N, Okada M, Moriya K, Koike K. Application of loop-mediated isothermal amplification technique to rapid and direct detection of methicillin-resistant Staphylococcus aureus (MRSA) in blood cultures. J Infect Chemother. 2007;13:134–140. doi: 10.1007/s10156-007-0508-9. [DOI] [PubMed] [Google Scholar]
  • 52.Otsuka N, Yoshino S, Kawano K, Toyoizumi-Ajisaka H, Shibayama K, Kamachi K. Simple and specific detection of Bordetella holmesii by using a loop-mediated isothermal amplification assay. Microbiol Immunol. 2012;56:486–489. doi: 10.1111/j.1348-0421.2012.00465.x. [DOI] [PubMed] [Google Scholar]
  • 53.Yamazaki W, Taguchi M, Ishibashi M, Nukina M, Misawa N, Inoue K. Development of a loop-mediated isothermal amplification assay for sensitive and rapid detection of Campylobacter fetus. Vet Microbiol. 2009;136:393–396. doi: 10.1016/j.vetmic.2008.11.018. [DOI] [PubMed] [Google Scholar]
  • 54.Yang Q, Chen S, Ge B. Detecting Salmonella serovars in shell eggs by loop-mediated isothermal amplification. J Food Prot. 2013;76:1790–1796. doi: 10.4315/0362-028X.JFP-13-140. [DOI] [PubMed] [Google Scholar]
  • 55.Wang X, Seo DJ, Lee MH, Choi C. Comparison of conventional PCR, multiplex PCR, and loop-mediated isothermal amplification assays for rapid detection of Arcobacter species. J Clin Microbiol. 2014;52:557–563. doi: 10.1128/JCM.02883-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Chadfield MS, Bojesen AM, Christensen JP, Juul-Hansen J, Nielsen SS, Bisgaard M. Reproduction of sepsis and endocarditis by experimental infection of chickens with Streptococcus gallinaceus and Enterococcus hirae. Avian Pathol. 2005;34:238–247. doi: 10.1080/03079450500112252. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets supporting our findings are included in the article.


Articles from BMC Microbiology are provided here courtesy of BMC

RESOURCES