Skip to main content
Eurosurveillance logoLink to Eurosurveillance
. 2019 Jan 31;24(5):1800093. doi: 10.2807/1560-7917.ES.2019.24.5.1800093

Laboratory management of Crimean-Congo haemorrhagic fever virus infections: perspectives from two European networks

Barbara Bartolini 1, Cesare EM Gruber 1, Marion Koopmans 2, Tatjana Avšič 3, Sylvia Bino 4, Iva Christova 5, Roland Grunow 6, Roger Hewson 7, Gulay Korukluoglu 8, Cinthia Menel Lemos 9, Ali Mirazimi 10,11,12, Anna Papa 13, Maria Paz Sanchez-Seco 14, Aisha V Sauer 15, Hervè Zeller 16, Carla Nisii 1, Maria Rosaria Capobianchi 1, Giuseppe Ippolito 1, Chantal B Reusken 2, 17,18, Antonino Di Caro 1,18
PMCID: PMC6386216  PMID: 30722811

Abstract

Background

Crimean-Congo haemorrhagic fever virus (CCHFV) is considered an emerging infectious disease threat in the European Union. Since 2000, the incidence and geographic range of confirmed CCHF cases have markedly increased, following changes in the distribution of its main vector, Hyalomma ticks.

Aims

To review scientific literature and collect experts’ opinion to analyse relevant aspects of the laboratory management of human CCHF cases and any exposed contacts, as well as identify areas for advancement of international collaborative preparedness and laboratory response plans.

Methods

We conducted a literature review on CCHF molecular diagnostics through an online search. Further, we obtained expert opinions on the key laboratory aspects of CCHF diagnosis. Consulted experts were members of two European projects, EMERGE (Efficient response to highly dangerous and emerging pathogens at EU level) and EVD-LabNet (Emerging Viral Diseases-Expert Laboratory Network).

Results

Consensus was reached on relevant and controversial aspects of CCHF disease with implications for laboratory management of human CCHF cases, including biosafety, diagnostic algorithm and advice to improve lab capabilities. Knowledge on the diffusion of CCHF can be obtained by promoting syndromic approach to infectious diseases diagnosis and by including CCHFV infection in the diagnostic algorithm of severe fevers of unknown origin.

Conclusion

No effective vaccine and/or therapeutics are available at present so outbreak response relies on rapid identification and appropriate infection control measures. Frontline hospitals and reference laboratories have a crucial role in the response to a CCHF outbreak, which should integrate laboratory, clinical and public health responses.

Keywords: CCHF, Crimean-Congo haemorrhagic fever virus, CCHFV, laboratory preparedness, laboratory response, emerging diseases, European network

Introduction

Crimean-Congo haemorrhagic fever virus (CCHFV) is a tick-borne pathogen that causes a frequently lethal disease in humans and is considered to be a major emerging infectious disease threat spreading to and within Europe [1-3].

The severity of the disease, the presence of domestic and wild animal reservoirs and/or vectors, a large population of susceptible humans, limited diagnostic capacities and resources for epidemiological/ecological investigation, as well as the absence of effective prophylaxis and treatment render CCHFV a pathogen with outbreak potential [4].

Since 2000, the incidence and geographic range of CCHF cases have markedly increased [5,6] following an expanding distribution of its main vector, ticks of the genus Hyalomma, specifically the Hyalomma marginatum species [1,7,8]. In Turkey, nearly 900 new CCHF cases occur annually, with a total of 9,787 cases reported from 2002–15 [9]. CCHF is endemic in the Balkan region, in Kosovo, 228 cases were reported from 1995–2013 [10], In Bulgaria, over 1,500 cases have been reported from 1952 [11]. In the European region, cases of human infection have also been reported from Albania, Russian Federation, Georgia, Greece, and Ukraine [12]. Imported cases have been reported in France [13], United Kingdom [14], Greece [15] and Germany [16]. A detailed review of other outbreaks has been recently published by Papa et al. [11].

Public health systems (including diagnostic laboratories) should be prepared to respond to the increased circulation of the virus in endemic EU countries, the potential for importation of human CCHF cases or the emergence of virus circulation in new areas e.g. Spain [17].

The objectives of this study were to amalgamate the expertise of two EU expert networks (i) EMERGE (Efficient response to highly dangerous and emerging pathogens at EU level) [18] and (ii) EVD-LabNet (Emerging Viral Diseases Laboratory Network) [19], in order to select and analyse the relevant and some of controversial aspects of CCHF disease diagnostics with implications for laboratory management of human CCHF cases and any exposed contacts.

Methods

We carried out an on line research of published paper related to CCHFV molecular detection methods. References were obtained by an online search in PubMed using an intentionally wide search-query to ensure that a large number of papers was retrieved also for a rare disease such as CCHF.

The query produced a large number of papers, 20% of them were discarded after a narrative review, as they did not contain a detailed description of the detection methods employed including the nucleotide sequences of primers and/or probes. The search was done by one author and the results discussed among the authors. Papers related on non-previously retrieved molecular detection methods or to others relevant aspects discussed in this report have been directly provided by experts. For phylogenetic analysis all available CCHF virus genomes by 5 December 2017 were retrieved from GenBank (https://www.ncbi.nlm.nih.gov/nucleotide), using ‘txid1980519(Organism)’ as term of query. All analyses have been focused only on CCHFV S-segment, because it resulted as the most conserved gene across CCHFVs [8,20] and also because mostly all retrieved molecular methods has S segment as target. CCHF virus strains with complete S segment were selected and clustered at 100% with CD-HIT v4.6. A total of 163 sequences available at 5 December 2017 were obtained and aligned with MAFFT v7.123b in local pair mode. Phylogenetic analysis were performed with RAxML v8.2.10 using GTRGAMMA model and 1000 bootstrap inferences.

A preliminary text was drafted and discussed among the experts by email and during EMERGE and EVD-LabNet networks’ 2017 and 2018 annual meetings. Most of the relevant and some of controversial aspects of CCHF disease with implications for laboratory management have been selected and analysed in the following sections. In the present paper, all the expressed opinions take into account both published data and personal experience of the experts.

Results

Crimean-Congo haemorrhagic fever virus clades distribution

CCHFV (family Nairoviridae, genus Orthonairovirus) is tick-borne and is maintained in a tick-vertebrate-tick cycle with Hyalomma marginatum, the main vector species in Europe. Given the wide distribution of its vector, CCHFV has been detected over a wide geographic range: Africa, Europe, Asia and the Middle East [5,21].

CCHFV is an enveloped, tri-partite, negative-sense, RNA virus. The large genome segment (L) encodes the RNA-dependent RNA polymerase (L protein), the medium segment (M) encodes the glycoproteins GN and GC, while the small segment (S) encodes the nucleocapsid protein (N).

Phylogenetic tree (Figure 1) was built, including only 65 of 163 representative strains with reported location of provenance either in GenBank records or in the associated papers. Taking into account similarity and geographic locations of the different viral lineages, seven genetic clades were identified: three prevalently diffused in Africa (clades I-III), three in Europe (clades V, VI and VII) and one in the south of Asia (clade IV).

Figure 1.

Maximum likelihood phylogenetic analysis for complete S segment of Crimean-Congo haemorrhagic fever virus (n = 65)

Crimean-Congo haemorrhagic fever virus strains with complete S segment available as at 5 December 2017, were collected from GenBank database and clustered at 100% with CD-HIT v4.6. Sequences were aligned with MAFFT v7.123b. Phylogenetic analysis were performed using RAxML v8.2.10 with GTRGAMMA model and 1,000 bootstrap inferences. For graphical exemplification, only representative sequences in each clade for each country were selected and reported in the phylogenetic tree.

Branches owing to different clades are presented in the following colours: Africa: clade I (red), clade II (light green) and clade III (brown); Asia: clade IV (dark green); Europe: clade V (purple), clade VI (light blue) and clade VII (blue). For each strain we reported GenBank ID, isolate ID, host, country and collection date, if present. Bootstrap values are shown for each clade.

Figure 1

Most of the isolates causing outbreaks in eastern Europe belong to clade V, whereas clade VI and VII include largely divergent strains isolated from ticks in Greece (including the prototype strain AP92) [21,22] and Russia (GenBank accession number KR814833 and KR814835).

Moreover, isolates belonging to the African clade III were collected from infected ticks in 2010 and 2014, and recently [23] a virus aligning to this clade was the cause of an outbreak in Spain [17].

For all strains analysed, the collection country was recorded and represented on the world map in Figure 2.

Figure 2.

World map of Crimean-Congo haemorrhagic fever virus distribution (n = 163)

Based on all available complete S segment CCHFV genomes (163 sequences as at 5 December 2017) retrieved from GenBank.

For all strains analysed, the collection countries are presented in the following colours: Africa: clade I (red), clade II (light green) and clade III (brown); Asia: clade IV (dark green); Europe: clade V (purple), clade VI (light blue) and clade VII (blue).

Figure 2

Transmission mode

Human infections are usually observed as single, sporadic cases when people in rural areas are bitten by ticks that have become infected by feeding on viraemic wild and domestic animals like hares, hedgehogs, horses, livestock and possibly birds [21]. The infection in animals is generally asymptomatic; at most, a mild fever may be noted.

In addition to tick exposure, CCHF infection can result from direct contact, especially through mucous membranes or skin wounds, with crushed infected ticks or the blood of infected animals (principally among shepherds, farmers, abattoir workers and veterinarians). Person-to-person transmission can also occur through contact with virus-containing bodily fluids of patients during the first 7–10 days of illness [21]. Unprotected contact with other bodily fluids like saliva or urine, may also represent a risk for humans [24]. Nosocomial transmission to healthcare workers, transmission among patients sharing the same room [25] and possible sexual transmission [26,27] have also been reported.

Relevance of viraemia

The typical duration of viraemia ranges from 1– 9 days [28,29], and there is so far no evidence of detectable viraemia during the incubation period [30]. However, the positivity of CCHFV RNA in serum has been exceptionally reported up to 36 days from the onset of symptoms [31]. Studies investigating the presence and persistence of CCHFV in other body fluids are limited. Viral RNA was detectable up to 10 days and as late as 25 days after onset of symptoms in saliva [24] and urine [31] respectively, but no data on virus viability are available.

Viral load is the most important prognostic factor: a value of viraemia higher than 108 copies/mL is associated with fatal outcomes [32]. Viraemia decreases significantly over time in surviving patients, but remains persistently high in non-survivors [32,33].

Antibody kinetics

All CCHFV genotypes belong to one serogroup [21]. Cross-reactivity between CCHFV and other nairoviruses infecting humans ( Erve virus [34]), has not been described, although monoclonal and polyclonal antibodies to the N protein of CCHFV were found to cross-react weakly with Dugbe virus N protein [35].

Nucleocapside-directed IgM antibodies have been identified as the initial serological marker during infection, becoming detectable in a median of 2–3 days after disease onset, followed by glycoprotein precursor (GPC) directed IgM (4–6 days) and IgG antibodies (5–6 days) [28]. In another report, CCHFV IgM was detectable from 4 days after the onset of disease for up to 4 months. The maximum level of antibody titres was usually reached in the second to third week of illness [1]. IgM titre typically declines to undetectable levels 4 months after the onset of symptoms [29].

IgG seroconversion occurs 1–2 days after the IgM response [28] and IgG antibody remains detectable for at least 5 years [29,36].

Antibody production against CCHFV is an important prognostic indicator for survival [37]. Patients with fatal outcome rarely develop measurable antibody responses (reviewed in [37]) and Saksida et al. observed a reverse correlation between viral load and antibody levels in fatal CCHF cases [33], indicating that an impaired immune response leads to uncontrolled replication of the virus. High levels of interleukin-10 (IL-10), an anti-inflammatory cytokine, were detected in patients with fatal outcomes and were lowest in patients with a moderate disease course [33]. It was hypothesised that CCHF could be the result of a delayed and downregulated immune response caused by IL-10, which leads to an increased replication and spread of CCHFV throughout the body [33].

Biosafety

CCHFV is classified as a risk group 4 pathogen. The virus is stable under wet conditions for 7 hours at 37 °C, 11 days at 20 °C and 15 days at 4 °C [20]. Under dry conditions, it is stable for at least 90 min, but less than 24 hours.

However, there is an ongoing debate about the absolute requirement of biosafety levels 4 (BSL4) for handling the virus [38]. Many endemic countries need to work with the virus despite the absence of BSL4 infrastructure. Biosafety and biosecurity procedures are essential for the safe and appropriate management of specimens from suspected/confirmed CCHF patients. All laboratories should refer to national guidelines on the documents ‘CWA 15793:2011 Laboratory bio-risk management’ and ‘CWA 16393:2012 Laboratory bio-risk management - Guidelines for the implementation of CWA 15793:2008’ for a complete guide [39]. The European Check List for Laboratory Biorisk Management developed in the framework of the Joint Actions Quality Assurance Exercises and Networking on the Detection of Highly Infectious Pathogens (QUANDHIP) project can be helpful for the implementation and evaluation of biorisk management approaches [40].

Inactivation

Like all lipid-enveloped viruses, CCHFV can be readily inactivated by common fixatives such as 2% glutaraldehyde [41], formalin and paraformaldehyde; chlorine-based disinfectants, such as 1% sodium hypochlorite [41,42]; and other disinfectants, such as hydrogen peroxide and peracetic acid [43,44]. Physical inactivation is also effective, like high temperature (56 °C for 30 min or 60 °C for 15 min) [41], Ultraviolet (1,200 to 3,000 μW/cm2) or low pH (less than 6) [43,45]. The virus does not survive in matured meat (due to low pH) and is also inactivated in 40% ethanol within 2 min [20].

There is a general agreement among the consulted experts that a critical aspect for laboratory biosafety and operation is the proper and reliable inactivation of specimens before they can be removed from the high-level biocontainment environment for further diagnostic testing. Some of these inactivation methods include (i) chemical treatment (i.e. Buffer AVL or Buffer RLT, Qiagen, Hilden, Germany)  + 100% ethanol, SDS, 0.5% Tween-20 (Thermofisher, Waltham, Massachusetts, USA) [46,47] or (ii) heat treatment plus riboflavin (vitamin B2) [48].

It is opinion of the experts that further evaluation of inactivation procedures are needed, especially for their impact on other laboratory tests necessary for clinical evaluation and increased survival rates of patients. Although there is no direct evidence of its effects on CCHFV, it has been shown that Triton X-100 (Sigma-Aldrich, Saint Louis, Missouri, USA can decrease the biohazard risk of performing laboratory tests on samples from patients infected with other haemorrhagic fever viruses (i.e. Ebola), without affecting the results of biochemical tests [49-52].

Transport of diagnostic samples

General guidelines for suspected viral haemorrhagic fever infections apply for the transport of diagnostic samples from CCHF-suspected cases; these are listed under guidelines as Category A, Infectious Substances Affecting Humans UN 2814 and must be transported in packaging that meets the United Nations class 6.2 specifications and complies with Packing Instruction P620 [53].

Additionally, as for other biological resources, the exchange of CCHF samples or virus strains needs to comply with the Nagoya protocol on access to genetic resources and the fair and equitable sharing of benefits arising from their utilisation, which regulates transnational exchange between countries [54].

Diagnosis

The choice of which CCHF detection assays should be used for diagnostics with maximum sensitivity and specificity depends on the stage of disease and the specimens available.

Laboratory diagnosis of a patient with a clinical history compatible with CCHF is generally performed during the acute phase of the disease by viral RNA (RT-PCR) detection in blood [21]. In addition to blood (serum, plasma or whole blood), other possible specimens for molecular detection are saliva, urine [24,32] or post mortem biopsy of the liver and bodily fluids (including semen, for infection control purposes) [26,27].

The available data, limited to very few patients, do not allow detailed comparisons of the sensitivity of RT-PCR detection methods performed on different sample types and, in particular, of urine and saliva vs serum samples. In two of six infected patients reported in a review of CCHF cases in Kosovo* [31], viraemia was detectable up to 30 days after the onset of symptoms. In the same investigation, one patient’s urine was PCR-positive before the serum, and in another patient viruria continued longer than viraemia; however, more detailed studies on viruria are required. Further, both viruria and viraemia are detectable several days after the appearance of IgG response [31]. No chronological data are provided about detection of CCHFV RNA in saliva [24].

During the small outbreak in Spain involving two patients in 2016, positive RT-PCR results were obtained via saliva and vaginal swab, but they became negative when viraemia was still detectable [17]. Virus isolation was attempted from these samples, but was not successful (Maria Paz Sanchez-Seco, personal communication, EVD-LabNet 2nd annual meeting, Rotterdam October 2017).

Molecular detection

There is high genetic diversity within the different CCHFV strains (Figure 1), which consequently hampers the performance of molecular tests. As a result, a range of different methods employing varied primer/probe combinations have been developed and a truly universal assay has been difficult to devise. Table 1 lists published molecular assays retrieved by our PubMed search: two single round PCR, six nested PCR, 10 real-time PCR, one loop-mediated isothermal amplification (LAMP) and one recombinase polymerase amplification (RPA). Indication on reference testing materials and sensitivity/specificity of the tests are also reported, when declared.

Table 1. Published molecular assays for Crimean-Congo haemorrhagic fever virus detection as at 31 November 2017.

Assay Reference Reference testing material Declared sensitivity/specificity Position
in CCHFV
strain
IbAr10200
Primers and probes
Type Name Sequence
Single round PCR Drosten 2002
[70]
Human clinical samples 95% detection limit of 2,779 copies per mL of serum 351–579 Forward primer CCS ATGCAGGAACCATTAARTCTTGGGA
Reverse primer CCAS1 CTAATCATATCTGACAACATTTC
Additional reverse primer CCAS2 CTAATCATGTCTGACAGCATCTC
Deyde 2006
[71]
Human and animal laboratory
isolates
ND 1–1,672 Forward primer SF TCTCAAAGAAACACGTGCCGC
Reverse primer SR TCTCAAAGATATCGTTGCCGC
Nested PCR Schwarz 1996
[72]
Human serum samples ND 135–670 Forward out F2 TGGACACCTTCACAAACTC
Reverse out R2 GACATCACAATTTCACCAGG
Forward inn F3 GAATGTGCATGGGTTAGCTC
Reverse inn R3 GACAAATTCCCTGCACCA
Midili 2007
[73]
Human serum samples ND 119–762 Forward out CCF-115F AARGGAAATGGACTTRTGGA
Forward inn CCF-131F TGGAYACYTTCACAAACTCC
Reverse out/inn CCF-759R GCAAGGCCTGTWGCRACAAGTGC
Midili 2009 a
[74]
Human serum samples ND 170–751 Forward out Gre-F1 AATGTGCCGAACTTGGACAG
Reverse out Gre-R1 TGCGACAAGTGCAATCCCG
Forward inn Gre-F2 ATCAGATGGCCAGTGCAACC
Reverse inn Gre-R2 ACTCCCTGCACCACTCAATG
Midili 2009 b
[74]
Human serum samples ND 192–501 Forward out Eecf-F1 TTGTGTTCCAGATGGCCAGC
Reverse out Eecf-R1 CTTAAGGCTGCCGTGTTTGC
Forward inn Eecf-F2 GAAGCAACCAARTTCTGTGC
Reverse inn Eecf-R2 AAACCTATGTCCTTCCTCC
Elata 2011
[75]
Human serum samples ND 249–700 Forward out CCHF1 CTGCTCTGGTGGAGGCAACAA
Reverse out CCHF2_5 TGGGTTGAAGGCCATGATGTAT
Forward inn CCHFn15 AGGTTTCCGTGTCAATGCAAA
Reverse inn CCHFn25 TTGACAAACTCCCTGCACCAGT
Negredo 2017
[17]
Human serum samples ND 123–764 Forward out CrCon1 + RWAAYGGRCTTRTGGAYACYTTCAC
Reverse out CrCon1- TRGCAAGRCCKGTWGCRACWAGWGC
Forward inn CriCon2 + ARTGGAGRAARGAYATWGGYTTYCG
Reverse inn CriCon2- CYTTGAYRAAYTCYCTRCACCABTC
Real-time PCR
Yapar 2005
[76]
Human serum samples Linear detection 107–102 copies/mL 1,140–1,242 Forward primer CCRealP1 TCTTYGCHGATGAYTCHTTYC
Reverse primer CCRealP2 GGGATKGTYCCRAAGCA
Probe ND ACASRATCTAYATGCAYCCTGC
Duh 2006
[77]
Human serum samples Viral RNA was detected until 30 PFU/mL 296–484 Forward primer CCHFL1 GCTTGGGTCAGCTCTACTGG
Reverse primer CCHFD1 TGCATTGACACGGAAACCTA
Probe CCHFS1 AGAAGGGGCTTGAGTGGTT
Wolfel 2007
[40]
Human serum samples Analytical sensitivity in concentrations ranging from 100,000 –10 copies per mL 1,068–1,248 Forward primer RWCF CAAGGGGTACCAAGAAAATGAAGAAGGC
Reverse primer RWCR GCCACAGGGATTGTTCCAAAGCAGAC
Probe SE01 ATCTACATGCACCCTGCTGTGTTGACA
Additional probe SE03 ATTTACATGCACCCTGCCGTGCTTACA
Additional probe SE0A AGCTTCTTCCCCCACTTCATTGGAGT
Garrison 2007
[78]
Laboratory isolates Limit of detection 10 copies/mL; from 1.18 x 106 – 11.8 gene copies were linear 649–705 Forward primer CCHF GGAGTGGTGCAGGGAATTTG
Reverse primer CCHF CAGGGCGGGTTGAAAGC
Probe CCHF CAAAGGCAAGTACATCAT
Wolfel 2009
[79]
Laboratory
isolates and human serum samples
95% detection limit of 540 copies/mL of serum, corresponding to 6.3 genome copies/reaction 210–489 Forward primer CC1a_for GTGCCACTGATGATGCACAAAAGGATTCCATCT
Reverse primer CC1a_rev GTGTTTGCATTGACACGGAAACCTATGTC
Probe ND ACASRATCTAYATGCAYCCTGC
Additional forward primer CC1b_for GTGCCACTGATGATGCACAAAAGGATTCTATCT
CC1c_for GTGCCACTGATGATGCACAAAAGGACTCCATCT
Additional reverse primer CC1b_rev GTGTTTGCATTGACACGGAAGCCTATGTC
CC1c_rev GTGTTTGCATTGACACGGAAACCTATATC
Atkinson 2012
[80]
Laboratory isolates Ranging from 5x105, down to 0.5 copies of S segment RNA per reaction 1–122 Forward primer CCHFS1 TCTCAAAGAAACACGTGCC
Reverse primer CCHFS122 CCTTTTTGAACTCTTCAAACC
Probe ND ACTCAAGGKAACACTGTGGGCGTAAG
Jaaskelainen 2014
[81]
Laboratory
isolates and human serum samples
Sensitivity 100%;specificity 97% 460–584 Forward primer FOR GGACATAGGTTTCCGTGTCA
Reverse primer REV-1 TCCTTCTAATCATGTCTGACAGC
Additional reverse primer REV-2 TCTGACAGCATCTCTTTGACAGAC
Probe probe1 TGGCGAAATTGTGATGTCTG
Additional probe probe2 CTTGCAGAGTACAAGGTT
Additional probe probe3 TRAGCAACAAAGTCCT
Kamboj 2014
[82]
Animal Sensitivity from 7.6 x 109 –7.6 copies:specificity 100% 32–137 Forward primer ND AGTGTTCTCTTGAGTGCTA
Reverse primer ND CCACAAGTCCATTTCCTT
Probe ND ATCTCATCTTTGTTGTTCACCTC
Pang 2014
[83]
Laboratory
isolates
Limit of detection from 133 RNA copies/PCR 726–889 Forward primer ND GCCGTTCAGGAATAGCACTTGT
Reverse primer ND TGTTATCATGCTGTCGGCRCT
Probe ND CAACAGGCCTTGCYAAGCTYGCAGAGAC
Sybrgreen Real Time Schneeberger 2017 [84] Laboratory
isolates
ND 86–244 Forward primer ND GATGAGATGAACAAGTGGTTTGAAGA
Reverse primer ND GTAGATGGAATCCTTTTGTGCATCAT
LAMP Osman 2013
[85]
Human serum samples Sensitivity in detecting ≥ 0.1 fg of viral RNA 100% 1,063–1,266 Forward outer primer F3 ACAGCCAAGAGGTACCAAGA
Reverse outer primer B3 GCAGCATCATCAGGGTTGG
Inner primers F1c TCTGCTGAGCACCCCAAT
F2 TGCTGGAAAGAATCGTCGGCAA
B2 TCCCAAAGCAGACTCCCAT
B1c ATCTACATGCACCCTGCCGTG
Loop primers LF TCATAAAGTTTCTTCCCCCACTTC
LB CTTACAGCAGGCAGAATCAGTG
RPA Bonney 2017
[86]
Laboratory
isolates
Limit of detection from 5x106 template copies
– 50 copies
8–158 Forward primer ND GAAACACGTGCCGCTTACGCCCACAGTGTT
Reverse primer ND TAGGAGTTTGTGAAAGTGTCCATAAGTCCATT
Probe ND CCGCTTACGCCCACAGTGTTCTCTTGAGTGTNTGCAAAATGGAAAACAAGATCG

CCHFV: Crimean Congo haemorrhagic fever virus; LAMP: loop-mediated isothermal amplification; ND: not declared; PFU: Plaque Forming Units; RPA: recombinase polymerase amplification; RT: reverse transcription.

For each assay, the position of amplicon is reported to respect IbAr10200 (NCBI reference sequence NC_005302). Names of each primer and probe correspond to those reported in the reference.

Therefore there is an agreement of experts that is advisable to perform more than one test to avoid exclusive reliance on a single assay and a single target, taking into account the travel history and the geographic distribution of the different strains.

Serological assays

In published investigations, the methods employed for the detection of antibodies are indirect immunofluorescence assays (IFAs) and enzyme-linked immunosorbent assays (ELISAs) [55-57]. Several commercial kits are available (Table 2), but only the performance of Vector-Best CCHF ELISA and Euroimmun CCHF IFA have been tested in a collaborative study conducted by reference centres for CCHF laboratory diagnosis and surveillance in their respective countries [58]. The IgM sensitivity for ELISA and IFA assays were 87.8% (95% CI: 78.6–96.9).and 93.9% (95% CI: 85.8–100.0), respectively. For IgG assays, reported sensitivities were 80.4% (95% CI: 69.5–91.3) for ELISA and 86.1% (95% CI: 74.8–97.4) for IFA. The overall specificity was estimated at 100% for all the tests.

Table 2. Commercial serological assays for Crimean-Congo haemorrhagic fever virus detection as at 5 December 2017.

          Assay Detection mode Diagnostic kit producers Comments/Target antigen
IgG ELISA Vector-Best, Novosibirsk, Russia Unknown
IgM ELISA Qualitative
IgG IFA test
Ag detection
IgG ELISA Qualitative Euroimmun, Luebeck, Germany CCHFV GPC and CCHFV N
IgM ELISA
IgG IFA
IgG ELISA Crimean-Congo ELISA Kits, Diagen Biyoteknolojik Sistemleri A.Ş., Ankara, Turkey Unknown
IgM ELISA Quantitative
Ag ELISA
IgG ELISA Qualitative Abbexa Ltd, Cambridge, United Kingdom For research use only, not for diagnostic use.
IgM ELISA
Elisa
IgG ELISA Quantitative Alpha Diagnostic Intl. Inc., San Antonio, Texas, United States(US) For research use only, not for diagnostic or therapeutic use.
CCHFV NP
IgM ELISA Quantitative
IgA, IgG, IgM ELISA Qualitative
IgG ELISA Qualitative ELISA Kit, Antibody-Sunlong Biotech Co.,Ltd, Hangzhou, Zhejiang, China Unknown
ELISA
IgG ELISA Qualitative Creative Diagnostics, Shirley, New York, USA CCHFV NP
IgM ELISA Quantitative, qualitative

CCHFV: Crimean-Congo haemorrhagic fever virus; ELISA: enzyme-linked immunosorbent assay; IFA: immunofluorescent assay; USA: United States of America.

A CCHFV seroneutralisation test is not normally performed for diagnostic purposes; it requires work with an infectious virus, necessitating a BSL4 laboratory, and is difficult to perform. However, reverse genetic approaches employing non-infectious reporter viruses have been described recently [59], enabling neutralisation to be performed at low containment.

Virus isolation

Viral isolation, i.e. from blood or organ for further characterisation or infectivity studies, is performed under BSL4 conditions on either LLC-MK2, Vero, BHK-21 or SW-13.4 cell lines and can be achieved in 2–10 days [60]. CCHFV generally produces no or little cytopathogenic effect and viral growth can be detected by IFA with specific monoclonal antibodies [41] or by molecular tests. When viral isolation on cell cultures fails, it can be attempted in new-born or immunodeficient mice.

It is preferable that viral isolation is performed on samples collected during the first 5 days of infection, when the viraemia levels are high [58,61].

Laboratory diagnosis of CCHFV infection

There is no official, agreed-upon case definition for CCHF in the EU, though several case definitions adopted by EU countries were reviewed by the European Centre for Disease Prevention and Control (ECDC) [62,63]. According to a report published by ECDC in 2014 [60], most countries used, at least for surveillance purposes, the EU case definition established for Viral Haemorrhagic Fever [64].

Box. Criteria proposed for laboratory confirmation of a clinically suspected Crimean Congo haemorrhagic fever case.

For laboratory confirmation of a clinical CCHF diagnosis, the expert group opinion is that a CCHFV infection is laboratory confirmed when at least one criteria in the Box is fulfilled.

• Detection by molecular tests of CCHFV RNA, in blood (whole blood, serum or plasma) or in other bodily fluids or tissues;

• Detection of CCHFV IgM or relevant (fourfold) increase in CCHFV IgG titres between two serologic samples (acute and convalescence phases);

• CCHFV isolation and/or detection of CCHF viral antigens in blood (whole blood, serum or plasma).

CCHFV: Crimean Congo haemorrhagic fever virus.

Taking into account that laboratory screening is usually performed using molecular methods, we propose as expert opinion the following molecular diagnostic algorithm for patients with suspected CCHF infection (Figure 3). However, it is advisable, especially when the molecular tests are negative, to perform also serological tests on all suspected patients.

Figure 3.

Algorithm for molecular diagnosis of Crimean-Congo haemorrhagic fever acute infection based on expert opinion

CCHFV: Crimean-Congo haemorrhagic fever virus.

a The preferred biological specimen is blood (serum, plasma or whole blood). Other possible biological specimens are saliva, urine [24,31] and post-mortem biopsy or bodily fluids (including semen, for infection control purposes [26,27]).

b It is preferable that at least two different targets are tested: The first molecular test should target the S segment, while the second assay should be performed in a different genome region to confirm the absence or presence of CCHF infection, in case of negative result.

c Sequencing is indicated for viral characterisation and cluster identification, as well as for the confirmation of first cases detected or of discordant results of molecular tests.

d The molecular test to be performed should take into account epidemiological data.

Figure 3

Other relevant aspects related to management of CCHF patients as clinical manifestation and discharging criteria are reported in the Supplementary material.

Discussion

CCHF is an important global health threat, as underlined by its inclusion in the list of priority diseases in the WHO document ‘An R & D blueprint for action to prevent epidemics’ [65].

In Europe, two autochthonous cases in Spain in 2016 [17] and the observed risk of importation of travel-associated cases [66] reinforce the notion that public health systems must be ready to respond to a potential emergence of CCHF.

Prompt and accurate laboratory diagnosis during the first days of the disease is critical to improve patient management, guide infection control measures and reduce case fatality. Early detection of viral RNA in blood is considered the gold standard diagnostic approach in the acute phase of the disease [21]. While the CCHFV RNA RT-PCR diagnostic test is most commonly performed in specialised laboratories, where non-commercial diagnostic assays and related reference biological material are available, this capability is more limited in rural areas and small cities where the majority of reported cases have occurred [9]. The availability of simple to use, commercial diagnostic tests will increase the number of laboratories performing RT-PCR or a similar NA detection strategy. However, laboratory capacity does not automatically mean capability, and laboratories implementing such tests would benefit from external quality assessments (EQA) of their capability to detect CCHFV in clinical samples, including monitoring of the effects of any corrective actions taken. The difficulty of clinical laboratories in establishing the diagnosis a CCHFV infection underlines the need to perform confirmatory tests in reference laboratories for both positive and negative samples collected from patients suspected of CCHF infection.

In addition, appropriate biosafety measures must be in place when performing molecular testing.

Proposed measures to improve CCHFV laboratory preparedness and response

Measures to improve CCHFV laboratory preparedness and response should include: improving molecular tests to overcome the lack of sensitivity due to the high variability of the CCHFV genome; providing a positive control panel for molecular diagnostics, including the different CCHFV genotypes (including for serology testing) in order to support the improvement of diagnostic capability of clinical laboratories; enrolling diagnostic laboratories appointed for CCHFV diagnostics regularly in EQA programmes; improvement of diagnostic algorithms building on clinical experiences; validation of procedures to inactivate infectivity of clinical samples; and establishing of an international biorepository for the collection and storing of clinical samples, with the aim of validating new diagnostic tests and supporting pathogenicity studies. Some of these activities, including the evaluation of laboratory capability [67] and EQA [68] in particular, have been performed within the framework of EMERGE and EVD-LabNet and earlier as part of EU-funded projects such as EuronetP4 (Grant No. 2003214), EnP4Lab (Grant No. 2006208), QUANDHIP (Grant No. 20102102) and ENIVD (Framework Service Contract ref. no. ECDC/2008/011. Similar support of other collaborating EU projects, such as the European Virus Archive (EVAg), could meet these needs in the future.

Conclusions

There are knowledge gaps concerning the putative persistence of the CCHFV in various body compartments of survivors and the related consequences for infection transmission. Basic knowledge is needed to provide evidence to better inform hospital discharge guidelines and these issues need further research. Furthermore, a One Health approach is required for adequate public health preparedness for CCHF, and relevant measures should include vector and animal surveillance, focusing particularly on migratory birds [5,9,69]. Greater awareness of the circulation of CCHFV in vectors/animals in specific geographic areas is fundamental in order to alert public health systems. Information on the circulation of CCHFV can be obtained by a syndromic approach and by including CCHFV testing in the diagnostic algorithm of severe febrile infectious diseases of unknown origin.

Until an effective vaccine and/or therapeutics have been developed, the CCHFV outbreak response will continue to rely on rapid identification and appropriate infection-control measures. Front-line hospitals, as well as reference laboratories, have a crucial role in the outbreak response, which should integrate laboratory, clinical and public health responses.

Acknowledgements

This work was supported by the Health programme 2014–2020, from the European Commission; EMERGE Joint Action grant number: 677066. INMI received ‘Ricerca Corrente, Linea 1, Patogeni ad alto impatto sociale, emergenti, tropicali, MDR, negletti’ grants from the Italian Ministry of Health. This work was supported by the European Centre for Disease Prevention and Control (ECDC) under the EVD-LabNet Framework contract ECDC/2016/002. This work was supported by the CCHVaccine project 2 ‘the European Union’s Horizon 2020 research and innovation program’, grant agreement no. 732732.

Supplementary Data

Supplementary Material

Note

*This designation is without prejudice to positions on status, and is in line with United Nations Security Council Resolution 1244/99 and the International Court of Justice Opinion on the Kosovo Declaration of Independence.

Conflict of interest: None declared.

Authors’ contributions: BB data analysis, coordinating the activities and writing manuscript; GCEM data analysis and writing manuscript; CBR and ADC study coordinator, data analysis and writing manuscript. BB, CEMG, MK, TA, SB, IC, RG, RH, GK, CML, AM, AP, MPSS, AVS, HZ, CN, MRC, GI, CBR, and ADC contributed to the conception and design of the work, the interpretation of data, the revision of the manuscript and the approval of the final version.

References

  • 1. Mertens M, Schmidt K, Ozkul A, Groschup MH. The impact of Crimean-Congo hemorrhagic fever virus on public health. Antiviral Res. 2013;98(2):248-60. 10.1016/j.antiviral.2013.02.007 [DOI] [PubMed] [Google Scholar]
  • 2. Dreshaj S, Ahmeti S, Ramadani N, Dreshaj G, Humolli I, Dedushaj I. Current situation of Crimean-Congo hemorrhagic fever in Southeastern Europe and neighboring countries: a public health risk for the European Union? Travel Med Infect Dis. 2016;14(2):81-91. 10.1016/j.tmaid.2016.03.012 [DOI] [PubMed] [Google Scholar]
  • 3. Yon L, Duff JP, Ågren EO, Erdélyi K, Ferroglio E, Godfroid J, et al. Recent changes in infectious diseases in European wildlife. J Wildl Dis. 2018; (Forthcoming). [DOI] [PubMed] [Google Scholar]
  • 4. Nisii C, Grunow R, Brave A, Ippolito G, Jacob D, Jureen P, et al. EMERGE Viral Pathogens Working Group Prioritization of High Consequence Viruses to Improve European Laboratory Preparedness for Cross-Border Health Threats. Adv Exp Med Biol. 2017;972:123-9. 10.1007/5584_2016_152 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Al-Abri SS, Abaidani IA, Fazlalipour M, Mostafavi E, Leblebicioglu H, Pshenichnaya N, et al. Current status of Crimean-Congo haemorrhagic fever in the World Health Organization Eastern Mediterranean Region: issues, challenges, and future directions. Int J Infect Dis. 2017;58:82-9. 10.1016/j.ijid.2017.02.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Papa A, Weber F, Hewson R, Weidmann M, Koksal I, Korukluoglu G, et al. Meeting report: First International Conference on Crimean-Congo hemorrhagic fever. Antiviral Res. 2015;120:57-65. 10.1016/j.antiviral.2015.05.005 [DOI] [PubMed] [Google Scholar]
  • 7. Gargili A, Estrada-Peña A, Spengler JR, Lukashev A, Nuttall PA, Bente DA. The role of ticks in the maintenance and transmission of Crimean-Congo hemorrhagic fever virus: A review of published field and laboratory studies. Antiviral Res. 2017;144:93-119. 10.1016/j.antiviral.2017.05.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Papa A, Tsergouli K, Tsioka K, Mirazimi A. Crimean-Congo Hemorrhagic Fever: Tick-Host-Virus Interactions. Front Cell Infect Microbiol. 2017;7:213. 10.3389/fcimb.2017.00213 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Leblebicioglu H, Ozaras R, Irmak H, Sencan I. Crimean-Congo hemorrhagic fever in Turkey: Current status and future challenges. Antiviral Res. 2016;126:21-34. 10.1016/j.antiviral.2015.12.003 [DOI] [PubMed] [Google Scholar]
  • 10. Fajs L, Jakupi X, Ahmeti S, Humolli I, Dedushaj I, Avšič-Županc T. Molecular epidemiology of Crimean-Congo hemorrhagic fever virus in Kosovo. PLoS Negl Trop Dis. 2014;8(1):e2647. 10.1371/journal.pntd.0002647 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Spengler JR, Bente DA, Bray M, Burt F, Hewson R, Korukluoglu G, et al. Second International Conference on Crimean-Congo Hemorrhagic Fever. Antiviral Res. 2018;150:137-47. 10.1016/j.antiviral.2017.11.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.European Centre for Disease Prevention and Control (ECDC). Annual Epidemiological Report 2016 - Crimean-Congo haemorrhagic fever. Stockholm: ECDC. 2016. Available from: https://ecdc.europa.eu/sites/portal/files/documents/CrimeanCongo%20haemorrhagic%20fever%20AER.pdf
  • 13. Jauréguiberry S, Tattevin P, Tarantola A, Legay F, Tall A, Nabeth P, et al. Imported Crimean-Congo hemorrhagic Fever. J Clin Microbiol. 2005;43(9):4905-7. 10.1128/JCM.43.9.4905-4907.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Lumley S, Atkinson B, Dowall S, Pitman J, Staplehurst S, Busuttil J, et al. Non-fatal case of Crimean-Congo haemorrhagic fever imported into the United Kingdom (ex Bulgaria), June 2014. Euro Surveill. 2014;19(30):20864. 10.2807/1560-7917.ES2014.19.30.20864 [DOI] [PubMed] [Google Scholar]
  • 15. Papa A, Markatou F, Maltezou HC, Papadopoulou E, Terzi E, Ventouri S, et al. Crimean-Congo haemorrhagic fever in a Greek worker returning from Bulgaria, June 2018. Euro Surveill. 2018;23(35):1800432. 10.2807/1560-7917.ES.2018.23.35.1800432 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Conger NG, Paolino KM, Osborn EC, Rusnak JM, Günther S, Pool J, et al. Health care response to CCHF in US soldier and nosocomial transmission to health care providers, Germany, 2009. Emerg Infect Dis. 2015;21(1):23-31. 10.3201/eid2101.141413 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Negredo A, de la Calle-Prieto F, Palencia-Herrejón E, Mora-Rillo M, Astray-Mochales J, Sánchez-Seco MP, et al. Crimean Congo Hemorrhagic Fever@Madrid Working Group Autochthonous Crimean-Congo Hemorrhagic Fever in Spain. N Engl J Med. 2017;377(2):154-61. 10.1056/NEJMoa1615162 [DOI] [PubMed] [Google Scholar]
  • 18.Efficient response to highly dangerous and emerging pathogens at EU level (Emerge). Berlin: Emerge; 2018. Available from: http://www.emerge.rki.eu/Emerge/EN/Home/Homepage_node.html
  • 19.EVD-LabNet. Rotterdam: EVD-Labnet. [Accessed 21 Jun 2018]. Available from: https://www.evd-labnet.eu
  • 20. Hardestam J, Simon M, Hedlund KO, Vaheri A, Klingström J, Lundkvist A. Ex vivo stability of the rodent-borne Hantaan virus in comparison to that of arthropod-borne members of the Bunyaviridae family. Appl Environ Microbiol. 2007;73(8):2547-51. 10.1128/AEM.02869-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Bente DA, Forrester NL, Watts DM, McAuley AJ, Whitehouse CA, Bray M. Crimean-Congo hemorrhagic fever: history, epidemiology, pathogenesis, clinical syndrome and genetic diversity. Antiviral Res. 2013;100(1):159-89. 10.1016/j.antiviral.2013.07.006 [DOI] [PubMed] [Google Scholar]
  • 22. Papa A, Chaligiannis I, Kontana N, Sourba T, Tsioka K, Tsatsaris A, et al. A novel AP92-like Crimean-Congo hemorrhagic fever virus strain, Greece. Ticks Tick Borne Dis. 2014;5(5):590-3. 10.1016/j.ttbdis.2014.04.008 [DOI] [PubMed] [Google Scholar]
  • 23. Cajimat MNB, Rodriguez SE, Schuster IUE, Swetnam DM, Ksiazek TG, Habela MA, et al. Genomic Characterization of Crimean-Congo Hemorrhagic Fever Virus in Hyalomma Tick from Spain, 2014. Vector Borne Zoonotic Dis. 2017;17(10):714-9. 10.1089/vbz.2017.2190 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Bodur H, Akinci E, Ongürü P, Carhan A, Uyar Y, Tanrici A, et al. Detection of Crimean-Congo hemorrhagic fever virus genome in saliva and urine. Int J Infect Dis. 2010;14(3):e247-9. 10.1016/j.ijid.2009.04.018 [DOI] [PubMed] [Google Scholar]
  • 25. Gürbüz Y, Sencan I, Oztürk B, Tütüncü E. A case of nosocomial transmission of Crimean-Congo hemorrhagic fever from patient to patient. Int J Infect Dis. 2009;13(3):e105-7. 10.1016/j.ijid.2008.08.002 [DOI] [PubMed] [Google Scholar]
  • 26. Pshenichnaya NY, Sydenko IS, Klinovaya EP, Romanova EB, Zhuravlev AS. Possible sexual transmission of Crimean-Congo hemorrhagic fever. Int J Infect Dis. 2016;45:109-11. 10.1016/j.ijid.2016.02.1008 [DOI] [PubMed] [Google Scholar]
  • 27. Ergonul O, Battal I. Potential sexual transmission of Crimean-Congo hemorrhagic fever infection. Jpn J Infect Dis. 2014;67(2):137-8. 10.7883/yoken.67.137 [DOI] [PubMed] [Google Scholar]
  • 28. Ergunay K, Kocak Tufan Z, Bulut C, Kinikli S, Demiroz AP, Ozkul A. Antibody responses and viral load in patients with Crimean-Congo hemorrhagic fever: a comprehensive analysis during the early stages of the infection. Diagn Microbiol Infect Dis. 2014;79(1):31-6. 10.1016/j.diagmicrobio.2013.12.015 [DOI] [PubMed] [Google Scholar]
  • 29.Ergönül O. Crimean-Congo haemorrhagic fever. Lancet Infect Dis. 2006;6(4):203-14. [DOI] [PMC free article] [PubMed]
  • 30. Tishkova FH, Belobrova EA, Valikhodzhaeva M, Atkinson B, Hewson R, Mullojonova M. Crimean-Congo hemorrhagic fever in Tajikistan. Vector Borne Zoonotic Dis. 2012;12(9):722-6. 10.1089/vbz.2011.0769 [DOI] [PubMed] [Google Scholar]
  • 31. Thomas S, Thomson G, Dowall S, Bruce C, Cook N, Easterbrook L, et al. Review of Crimean Congo hemorrhagic fever infection in Kosova in 2008 and 2009: prolonged viremias and virus detected in urine by PCR. Vector Borne Zoonotic Dis. 2012;12(9):800-4. 10.1089/vbz.2011.0776 [DOI] [PubMed] [Google Scholar]
  • 32. Hasanoglu I, Guner R, Carhan A, Kocak Tufan Z, Yagci-Caglayik D, Guven T, et al. Crucial parameter of the outcome in Crimean Congo hemorrhagic fever: Viral load. J Clin Virol. 2016;75:42-6. 10.1016/j.jcv.2015.12.006 [DOI] [PubMed] [Google Scholar]
  • 33. Saksida A, Duh D, Wraber B, Dedushaj I, Ahmeti S, Avsic-Zupanc T. Interacting roles of immune mechanisms and viral load in the pathogenesis of crimean-congo hemorrhagic fever. Clin Vaccine Immunol. 2010;17(7):1086-93. 10.1128/CVI.00530-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Dilcher M, Koch A, Hasib L, Dobler G, Hufert FT, Weidmann M. Genetic characterization of Erve virus, a European Nairovirus distantly related to Crimean-Congo hemorrhagic fever virus. Virus Genes. 2012;45(3):426-32. 10.1007/s11262-012-0796-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Ward VK, Marriott AC, Polyzoni T, el-Ghorr AA, Antoniadis A, Nuttall PA. Expression of the nucleocapsid protein of Dugbe virus and antigenic cross-reactions with other nairoviruses. Virus Res. 1992;24(2):223-9. 10.1016/0168-1702(92)90009-X [DOI] [PubMed] [Google Scholar]
  • 36.Zeller H. Laboratory diagnosis of crimean congo hemorrhagic fever. In: O. Ergonul, C.A. Whitehouse, editors. Crimean Congo Hemorrhagic Fever: A Global Perspective. Dordrecht, NL: Springer; 2007. p. 233-243. [Google Scholar]
  • 37. Akıncı E, Bodur H, Leblebicioglu H. Pathogenesis of Crimean-Congo hemorrhagic fever. Vector Borne Zoonotic Dis. 2013;13(7):429-37. 10.1089/vbz.2012.1061 [DOI] [PubMed] [Google Scholar]
  • 38. Weidmann M, Avsic-Zupanc T, Bino S, Bouloy M, Burt F, Chinikar S, et al. Biosafety standards for working with Crimean-Congo hemorrhagic fever virus. J Gen Virol. 2016;97(11):2799-808. 10.1099/jgv.0.000610 [DOI] [PubMed] [Google Scholar]
  • 39.European Committee for Standardisation (CEN). CWA 15793:2011 D/E/F. CEN Workshop Agreement. Brussels: CEN; 2011. Available from: http://www.cen.eu/CEN/sectors/technicalcommitteesworkshops/workshops/Pages/ws31.aspx
  • 40.Efficient response to highly dangerous and emerging pathogens at EU level (Emerge). Integrated European Checklist for Laboratory Biorisk Management in Handling of High Consequence Risk Group 3 and 4 Agents (ECL-Biorisk). Berlin: Emerge; 2016. Available from: https://www.emerge.rki.eu/Emerge/EN/Content/Topics/Rules/ECL_Biorisk.html
  • 41. Appannanavar SB, Mishra B. An update on crimean congo hemorrhagic Fever. J Glob Infect Dis. 2011;3(3):285-92. 10.4103/0974-777X.83537 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Smither S, Phelps A, Eastaugh L, Ngugi S, O’Brien L, Dutch A, et al. Effectiveness of Four Disinfectants against Ebola Virus on Different Materials. Viruses. 2016;8(7):E185. 10.3390/v8070185 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Krauss H, Weber A, Appel M, Enders B, Isenberg HD, Schiefer HG, et al. Viral zoonoses. Zoonoses. Infectious Diseases Transmissible from Animals to Humans. 3rd ed. Washington, D.C: ASM Press; 2013. p. 172. [Google Scholar]
  • 44. Stadtlander CTKH. Control of Communicable Diseases Manual. David L. Heymann. Washington DC, USA: American Public Health Association, 18th (edn). Int J Epidemiol. 2004;34(6):35-7. [Google Scholar]
  • 45. Hoogstraal H. The epidemiology of tick-borne Crimean-Congo hemorrhagic fever in Asia, Europe, and Africa. J Med Entomol. 1979;15(4):307-417. 10.1093/jmedent/15.4.307 [DOI] [PubMed] [Google Scholar]
  • 46. Haddock E, Feldmann F, Feldmann H. Effective Chemical Inactivation of Ebola Virus. Emerg Infect Dis. 2016;22(7):1292-4. 10.3201/eid2207.160233 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Cutts T, Grolla A, Jones S, Cook BW, Qiu X, Theriault SS. Inactivation of Zaire ebolavirus Variant Makona in Human Serum Samples Analyzed by Enzyme-Linked Immunosorbent Assay. J Infect Dis. 2016;214(suppl 3):S218-21. 10.1093/infdis/jiw289 [DOI] [PubMed] [Google Scholar]
  • 48. Cap AP, Pidcoke HF, Keil SD, Staples HM, Anantpadma M, Carrion R, Jr, et al. Treatment of blood with a pathogen reduction technology using ultraviolet light and riboflavin inactivates Ebola virus in vitro. Transfusion. 2016;56(Suppl 1):S6-15. 10.1111/trf.13393 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Lau R, Wang A, Chong-Kit A, Ralevski F, Boggild AK. Evaluation of Ebola virus inactivation procedures for Plasmodium falciparum malaria diagnostics. J Clin Microbiol. 2015;53(4):1387-90. 10.1128/JCM.00165-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Mifsud A, Peelen D, Brincat P, Abela S, Debattista N, Laspina S, et al. A feasibility study on the effects of Triton X-100 for the in vitro inactivation of Ebola virus on haematological assays. J Clin Pathol. 2016;69(7):637-42. 10.1136/jclinpath-2015-203331 [DOI] [PubMed] [Google Scholar]
  • 51. Tempestilli M, Pucci L, Notari S, Di Caro A, Castilletti C, Rivelli MR, et al. Diagnostic performances of clinical laboratory tests using Triton X-100 to reduce the biohazard associated with routine testing of Ebola virus-infected patients. Clin Chem Lab Med. 2015;53(12):1967-73. 10.1515/cclm-2015-0119 [DOI] [PubMed] [Google Scholar]
  • 52. van Kampen JJA, Tintu A, Russcher H, Fraaij PLA, Reusken CBEM, Rijken M, et al. Ebola Virus Inactivation by Detergents Is Annulled in Serum. J Infect Dis. 2017;216(7):859-66. 10.1093/infdis/jix401 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.World Health Organisation (WHO). Guidance on regulations for the transport of infectious substances 2013–2014. WHO/HSE/GCR/2012.12. Geneva: WHO; 2012. Available from: http://apps.who.int/iris/bitstream/handle/10665/78075/WHO_HSE_GCR_2012.12_eng.pdf;jsessionid=FEEA1509AA9DBFD27F8B1F1EBBA622E1?sequence=1
  • 54.United Nations (UN). Secretariat of the Convention on Biological Diversity, United Nations Environmental Programme. Nagoya Protocol on Access to genetic resources and the fair and equitable sharing of benefits arising from their utilization to the convention on biological diversity. Quebec: UN; 2011. Available from: https://www.cbd.int/abs/doc/protocol/nagoya-protocol-en.pdf
  • 55. Schuster I, Mertens M, Köllner B, Korytář T, Keller M, Hammerschmidt B, et al. A competitive ELISA for species-independent detection of Crimean-Congo hemorrhagic fever virus specific antibodies. Antiviral Res. 2016;134:161-6. 10.1016/j.antiviral.2016.09.004 [DOI] [PubMed] [Google Scholar]
  • 56. Dowall SD, Richards KS, Graham VA, Chamberlain J, Hewson R. Development of an indirect ELISA method for the parallel measurement of IgG and IgM antibodies against Crimean-Congo haemorrhagic fever (CCHF) virus using recombinant nucleoprotein as antigen. J Virol Methods. 2012;179(2):335-41. 10.1016/j.jviromet.2011.11.020 [DOI] [PubMed] [Google Scholar]
  • 57. Emmerich P, Avsic-Zupanc T, Chinikar S, Saksida A, Thomé-Bolduan C, Parczany-Hartmann A, et al. Early serodiagnosis of acute human Crimean-Congo hemorrhagic fever virus infections by novel capture assays. J Clin Virol. 2010;48(4):294-5. 10.1016/j.jcv.2010.05.002 [DOI] [PubMed] [Google Scholar]
  • 58. Vanhomwegen J, Alves MJ, Zupanc TA, Bino S, Chinikar S, Karlberg H, et al. Diagnostic assays for Crimean-Congo hemorrhagic fever. Emerg Infect Dis. 2012;18(12):1958-65. 10.3201/eid1812.120710 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Zivcec M. Structure-Function Assays for Crimean-Congo Hemorrhagic Fever Virus Polymerase. Methods Mol Biol. 2018;1604:229-35. 10.1007/978-1-4939-6981-4_17 [DOI] [PubMed] [Google Scholar]
  • 60.European Centre for Disease Prevention and Control (ECDC). Crimean-Congo haemorrhagic fever - Annual Epidemiological Report for 2014. Stockholm: ECDC; 2016. Available from: https://ecdc.europa.eu/en/publications-data/crimean-congo-haemorrhagic-fever-annual-epidemiological-report-2016-2014-data
  • 61. Ergonul O. Crimean-Congo hemorrhagic fever virus: new outbreaks, new discoveries. Curr Opin Virol. 2012;2(2):215-20. 10.1016/j.coviro.2012.03.001 [DOI] [PubMed] [Google Scholar]
  • 62.European Centre for Disease Prevention and Control (ECDC). Meeting Report. Consultation on Crimean-Congo haemorragic fever prevention and control. Stockholm: ECDC; 2009. Available from: https://ecdc.europa.eu/sites/portal/files/media/en/publications/Publications/0809_MER_Crimean_Congo_Haemorragic_Fever_Prevention_and_Control.pdf
  • 63.European Commission. The list of diseases and their case definitions are based on the Commission Implementing Decision on the communicable diseases and related special health issues to be covered by epidemiological surveillance – Annex 1 (replacing Commission Decision No 2000/96/EC).Available from. https://ecdc.europa.eu/en/surveillance-and-disease-data/eu-case-definitions Available from. http://ec.europa.eu/health/ph_threats/com/docs/1589_2008_en.pdf
  • 64.European Commission. Decisions Commission Implementing Decision of 8 August 2012 amending Decision 2002/253/EC laying down case definitions for reporting communicable diseases to the Community network under Decision No 2119/98/EC of the European Parliament and of the Council (notified under document C(2012) 5538) (Text with EEA relevance) (2012/506/EU). Available from: http://eur-lex.europa.eu/legal-content/EN/TXT/PDF/?uri=CELEX:32012D0506&qid=1428573336660&from=EN#page=38
  • 65.World Health Organization (WHO). An R&D blueprint for action to prevent epidemics. Geneva: WHO; 2016. Available from: http://www.who.int/entity/blueprint/about/r_d_blueprint_plan_of_action.pdf?ua=1
  • 66. Leblebicioglu H, Ozaras R, Fletcher TE, Beeching NJ, ESCMID Study Group for Infections in Travellers and Migrants (ESGITM) Crimean-Congo haemorrhagic fever in travellers: A systematic review. Travel Med Infect Dis. 2016;14(2):73-80. 10.1016/j.tmaid.2016.03.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Fernandez-García MD, Negredo A, Papa A, Donoso-Mantke O, Niedrig M, Zeller H, et al. European survey on laboratory preparedness, response and diagnostic capacity for Crimean-Congo haemorrhagic fever, 2012. Euro Surveill. 2014;19(26):20844. 10.2807/1560-7917.ES2014.19.26.20844 [DOI] [PubMed] [Google Scholar]
  • 68. Escadafal C, Olschläger S, Avšič-Županc T, Papa A, Vanhomwegen J, Wölfel R, et al. First international external quality assessment of molecular detection of Crimean-Congo hemorrhagic fever virus. PLoS Negl Trop Dis. 2012;6(6):e1706. 10.1371/journal.pntd.0001706 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Gale P, Stephenson B, Brouwer A, Martinez M, de la Torre A, Bosch J, et al. Impact of climate change on risk of incursion of Crimean-Congo haemorrhagic fever virus in livestock in Europe through migratory birds. J Appl Microbiol. 2012;112(2):246-57. 10.1111/j.1365-2672.2011.05203.x [DOI] [PubMed] [Google Scholar]
  • 70. Drosten C, Göttig S, Schilling S, Asper M, Panning M, Schmitz H, et al. Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, dengue virus, and yellow fever virus by real-time reverse transcription-PCR. J Clin Microbiol. 2002;40(7):2323-30. 10.1128/JCM.40.7.2323-2330.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71. Deyde VM, Khristova ML, Rollin PE, Ksiazek TG, Nichol ST. Crimean-Congo hemorrhagic fever virus genomics and global diversity. J Virol. 2006;80(17):8834-42. 10.1128/JVI.00752-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72. Schwarz TF, Nsanze H, Longson M, Nitschko H, Gilch S, Shurie H, et al. Polymerase chain reaction for diagnosis and identification of distinct variants of Crimean-Congo hemorrhagic fever virus in the United Arab Emirates. Am J Trop Med Hyg. 1996;55(2):190-6. 10.4269/ajtmh.1996.55.190 [DOI] [PubMed] [Google Scholar]
  • 73. Midilli K, Gargili A, Ergonul O, Sengöz G, Ozturk R, Bakar M, et al. Imported Crimean-Congo hemorrhagic fever cases in Istanbul. BMC Infect Dis. 2007;7(1):54. 10.1186/1471-2334-7-54 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74. Midilli K, Gargili A, Ergonul O, Elevli M, Ergin S, Turan N, et al. The first clinical case due to AP92 like strain of Crimean-Congo Hemorrhagic Fever virus and a field survey. BMC Infect Dis. 2009;9(1):90. 10.1186/1471-2334-9-90 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75. Elata AT, Karsany MS, Elageb RM, Hussain MA, Eltom KH, Elbashir MI, et al. A nosocomial transmission of crimean-congo hemorrhagic fever to an attending physician in North Kordufan, Sudan. Virol J. 2011;8(1):303. 10.1186/1743-422X-8-303 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76. Yapar M, Aydogan H, Pahsa A, Besirbellioglu BA, Bodur H, Basustaoglu AC, et al. Rapid and quantitative detection of Crimean-Congo hemorrhagic fever virus by one-step real-time reverse transcriptase-PCR. Jpn J Infect Dis. 2005;58(6):358-62. [PubMed] [Google Scholar]
  • 77. Duh D, Saksida A, Petrovec M, Dedushaj I, Avsic-Zupanc T. Novel one-step real-time RT-PCR assay for rapid and specific diagnosis of Crimean-Congo hemorrhagic fever encountered in the Balkans. J Virol Methods. 2006;133(2):175-9. 10.1016/j.jviromet.2005.11.006 [DOI] [PubMed] [Google Scholar]
  • 78. Garrison AR, Alakbarova S, Kulesh DA, Shezmukhamedova D, Khodjaev S, Endy TP, et al. Development of a TaqMan minor groove binding protein assay for the detection and quantification of Crimean-Congo hemorrhagic fever virus. Am J Trop Med Hyg. 2007;77(3):514-20. 10.4269/ajtmh.2007.77.514 [DOI] [PubMed] [Google Scholar]
  • 79. Wölfel R, Paweska JT, Petersen N, Grobbelaar AA, Leman PA, Hewson R, et al. Low-density macroarray for rapid detection and identification of Crimean-Congo hemorrhagic fever virus. J Clin Microbiol. 2009;47(4):1025-30. 10.1128/JCM.01920-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80. Atkinson B, Chamberlain J, Logue CH, Cook N, Bruce C, Dowall SD, et al. Development of a real-time RT-PCR assay for the detection of Crimean-Congo hemorrhagic fever virus. Vector Borne Zoonotic Dis. 2012;12(9):786-93. 10.1089/vbz.2011.0770 [DOI] [PubMed] [Google Scholar]
  • 81. Jääskeläinen AJ, Kallio-Kokko H, Ozkul A, Bodur H, Korukruoglu G, Mousavi M, et al. Development and evaluation of a real-time RT-qPCR for detection of Crimean-Congo hemorrhagic fever virus representing different genotypes. Vector Borne Zoonotic Dis. 2014;14(12):870-2. 10.1089/vbz.2014.1577 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82. Kamboj A, Pateriya AK, Mishra A, Ranaware P, Kulkarni DD, Raut AA. Novel molecular beacon probe-based real-time RT-PCR assay for diagnosis of Crimean-Congo hemorrhagic fever encountered in India. BioMed Res Int. 2014;2014(496219):4. 10.1155/2014/496219 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83. Pang Z, Li A, Li J, Qu J, He C, Zhang S, et al. Comprehensive multiplex one-step real-time TaqMan qRT-PCR assays for detection and quantification of hemorrhagic fever viruses. PLoS One. 2014;9(4):e95635. 10.1371/journal.pone.0095635 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84. Schneeberger PHH, Pothier JF, Bühlmann A, Duffy B, Beuret C, Utzinger J, et al. Development and evaluation of a bioinformatics approach for designing molecular assays for viral detection. PLoS One. 2017;12(5):e0178195. 10.1371/journal.pone.0178195 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85. Osman HA, Eltom KH, Musa NO, Bilal NM, Elbashir MI, Aradaib IE. Development and evaluation of loop-mediated isothermal amplification assay for detection of Crimean Congo hemorrhagic fever virus in Sudan. J Virol Methods. 2013;190(1-2):4-10. 10.1016/j.jviromet.2013.03.004 [DOI] [PubMed] [Google Scholar]
  • 86. Bonney LC, Watson RJ, Afrough B, Mullojonova M, Dzhuraeva V, Tishkova F, et al. A recombinase polymerase amplification assay for rapid detection of Crimean-Congo Haemorrhagic fever Virus infection. PLoS Negl Trop Dis. 2017;11(10):e0006013. 10.1371/journal.pntd.0006013 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material

Articles from Eurosurveillance are provided here courtesy of European Centre for Disease Prevention and Control

RESOURCES