Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Feb 22.
Published in final edited form as: Eur J Immunol. 2017 Dec 27;48(4):605–611. doi: 10.1002/eji.201747338

Suppressive oligodeoxynucleotides containing TTAGGG motifs inhibit cGAS activation in human monocytes

Folkert Steinhagen 1, Thomas Zillinger 2, Konrad Peukert 1, Mario Fox 1, Marcus Thudium 1, Winfried Barchet 2,3, Christian Putensen 1, Dennis Klinman 4, Eicke Latz 5, Christian Bode 1
PMCID: PMC6386451  NIHMSID: NIHMS1005550  PMID: 29215161

Abstract

Type I interferon (IFN) is a critical mediator of autoimmune diseases such as systemic lupus erythematosus (SLE) and Aicardi–Goutières Syndrome (AGS). The recently discovered cyclic-GMP-AMP (cGAMP) synthase (cGAS) induces the production of type I IFN in response to cytosolic DNA and is potentially linked to SLE and AGS. Suppressive oligodeoxynucleotides (ODN) containing repetitive TTAGGG motifs present in mammalian telomeres have proven useful in the treatment of autoimmune diseases including SLE. In this study, we demonstrate that the suppressive ODN A151 effectively inhibits activation of cGAS in response to cytosolic DNA, thereby inhibiting type I IFN production by human monocytes. In addition, A151 abrogated cGAS activation in response to endogenous accumulation of DNA using TREX1-deficient monocytes. We demonstrate that A151 prevents cGAS activation in a manner that is competitive with DNA. This suppressive activity of A151 was dependent on both telomeric sequence and phosphorothioate backbone. To our knowledge this report presents the first cGAS inhibitor capable of blocking self-DNA. Collectively, these findings might lead to the development of new therapeutics against IFN-driven pathologies due to cGAS activation.

Keywords: Autoimmunity, Cytosolic sensor, Double-stranded DNA, Interferons, TREX1

Introduction

The recognition of microbial DNA is a major mechanism by which the immune system detects pathogens. Cyclic GMP-AMP (cGAMP) synthase (cGAS) is a cytosolic DNA sensor that activates innate immune responses through production of the second messenger cGAMP, which activates the adaptor protein STING [1, 2]. STING subsequently recruits tank binding kinase 1 (TBK1) to phosphorylate interferon regulatory factor 3 (IRF3) [3]. IRF3 can then enter the nucleus to trigger transcription of type I IFN. The cGAS–STING pathway elicits a protective immune defense against infection by various DNA viruses and intracellular bacteria [4]. Yet, aberrant activation of the cGAS receptor by self-DNA can lead to autoimmune diseases. In this context, recent work suggests that the development of Aicardi–Goutières Syndrome (AGS) and systemic lupus erythematosus (SLE) are linked to loss of function mutations of the exonuclease TREX1 resulting in the recognition of self-DNA by cGAS [5, 6]. These studies suggest that cGAS activation can trigger severe autoimmunity. Whereas inhibition of cGAS might therefore be of value in the treatment in patients with SLE or AGS, no therapeutic agent has been described that blocks activation of cGAS by self-DNA.

Importantly, certain DNA sequences such as the TTAGGG repeat commonly found in mammalian telomeres possess immunosuppressive properties. Synthetic oligonucleotides (ODN) containing repetitive TTAGGG motifs (ODN A151) mimic the ability of telomeric DNA and inhibit the development of autoimmune diseases including SLE, inflammatory arthritis and uveitis [7]. A151 was first recognized for its ability to prevent TLR9 activation by binding to unmethylated CpG DNA [8]. However, additional data demonstrate that the therapeutic activity of A151 is often independent of blocking TLR9 signaling.

In this study, we show that A151 blocks cGAS-mediated type I IFN response induced by cytosolic DNA. Our data indicate that A151 functions as a competitive inhibitor by binding to cGAS. Furthermore, A151 inhibits the type I IFN production stimulated by self-DNA in TREX1 deficient monocytes. Together, these findings identify A151 as a novel inhibitor of cGAS activity and provide insights to support the development of specific and potent cGAS inhibitors to treat DNA-driven autoimmune disease.

Results and discussion

A151 blocks cGAS-mediated type I IFN response induced by cytosolic DNA

IFN-β mRNA levels were up-regulated in a dose-dependent manner when THP-1 human monocytes were transfected with double-stranded (ds) mammalian DNA, mitochondrial (mt) DNA or cGAMP (Fig. 1A and [3]). To determine whether this response was dependent on the cGAS receptor, wild-type (WT) and cGAS kockout (KO) THP-1 cells were transfected with all three ligands. While IFN-β mRNA induction in response to dsDNA and mtDNA was significantly decreased in cGAS KO cells, transfection with the STING ligand cGAMP did not reduce IFN-β mRNA levels in the cGAS KO cells (Fig. 1B). These findings indicated that dsDNA and mtDNA but not cGAMP induce a type I IFN response via cGAS. Controversy exists regarding the target receptor of mtDNA. Mitochondria are evolutionary endosymbionts derived from bacteria and contain DNA similar to bacterial DNA [9]. It has been reported that mtDNA is released into the circulation following cellular injury/trauma and functions as an endogenous damage-associated molecular pattern (DAMP) that activates the innate immune system via TLR9 [10–12]. Several groups report that plasma mtDNA levels are an independent predictor of mortality in critically ill patients and may contribute to the inflammatory response seen in sepsis via an interaction with TLR9 [13–15]. In contrast and consistent with our data, recent reports demonstrate that cytosolic mtDNA induces type I IFN expression independent of TLR9 signaling via the cGAS-STING pathway [16, 17]. Thus, future studies need to address the role of TLR9- vs cGAS-signaling in mtDNA driven pathologies considering the expression patterns of both receptors in human models. To explore the inhibitory effect of A151 on cGAS, THP-1 cells were pretreated with A151 or control ODN (C151) and then transfected with dsDNA, mtDNA and cGAMP. Pretreatment with A151 significantly reduced IFN-β mRNA levels following dsDNA and mtDNA but not cGAMP treatment, suggesting A151 blocks cGAS signaling upstream of STING (Fig. 1C). Consistent with this hypothesis, A151 prevented phosphorylation of IRF3 following transfection with dsDNA and mtDNA but not cGAMP (Fig. 1D).

Figure 1.

Figure 1.

Open in a new tab

A151 inhibits cytosolic DNA-mediated type I IFN response in human monocytes. (A) Human THP1 cells were transfected with increasing concentrations (0.5, 1, 2 and 4 μg/ml) of dsDNA, mtDNA or cGAMP for 6 h. Additionally, cells were treated with all three ligands (4 μg/ml) in the absence of Lipofectamin (nL). (B) Wild-type (WT) and cGAS kockout (KO) THP-1 cells were transfected with dsDNA, mtDNA or cGAMP for 6 h. (C) THP-1 cells were transfected with dsDNA, mtDNA or cGAMP (2 μg/ml) for 6h and pretreated with A151 or C151 (0.3 μM). IFN-β mRNA levels were determined by qPCR using 18s RNA as an endogenous control. The relative rise in IFN-β levels compared to untreated controls is shown. Results show (A) one of three independent experiments and (B) the mean + SEM from three or (C) four independent experiments performed in triplicates.(D) THP-1 cells were transfected with 2 μg/ml dsDNA, mtDNA or cGAMP for 6 h and pretreated (+) with A151 (0.3 μM) or left untreated (−). Lysates were studied for IRF-3 phosphorylation (pIRF3) by immunoblot. Results show one representative experiment of three independent experiments.(E) THP-1 cells were transfected with dsDNA (2 μg/ml) and pretreated with increasing concentrations of A151. IP-10 protein levels were measured by ELISA in supernatants collected after 24h of stimulation. Results show the mean +SEM from four independent experiments performed in duplicates. Statistical analysis: unpaired Student’s test, *p < 0.05; **p < 0.01; ***p < 0.001.

To test whether the inhibitory effect of A151 also affects the cGAS pathway further downstream, THP-1 cells and freshly isolated human monocytes and macrophages were pretreated with increasing concentrations of A151 followed by cytosolic transfection with dsDNA. Again, minimal doses of A151 significantly diminished secretion of the type I IFN dependent protein IP-10 (Fig. 1E and Supporting Information Fig. 1).

A151 inhibits cGAS-STING signaling via both sequence and backbone specific binding to cGAS

Besides the pivotal role of cGAS in activating STING, other receptors such as DAI, DDX41 or IFI16 have been described as STING-associated receptors [18]. To exclude the possibility that the inhibitory effect of A151 upstream of STING can be explained by the interaction of A151 with an alternative DNA receptor, we studied the effect of A151 on the activation of STING exclusively via endogenous cGAMP(2’−5’). Previous studies demonstrated that cGAS-synthesized cGAMP is transferred from producing cells to neighboring cells through gap junctions, where it promotes STING activation that triggers its oligomerization into a supramolecular complex [19]. A clone of HEK cells stably transduced with a mCherry-tagged STING construct (HEK-STING) in which cGAS was not expressed was used as bystanders to evaluate this process. Co-incubating this cell clone with cells expressing high levels of cGAS (HEK cGAShigh) induced spontaneous activation of STING detected by the up-regulation of mCherry (Fig. 2A). In contrast, a cell line with low cGAS expression (HEK cGASlow) required dsDNA stimulation to elicit STING activation in bystander cells. As expected, the addition of A151 to this co-culture significantly reduced STING activation when stimulating HEK cGASlow with dsDNA. Yet, A151 did not influence constitutive STING activation by HEK cGAShigh. This set of findings indicated that A151 inhibits the dsDNA-induced synthesis of cGAMP via cGAS.

Figure 2.

Figure 2.

Open in a new tab

A151 inhibits cGAS-STING signaling via both sequence and backbone specific binding to cGAS. (A) HEK cGASlow or HEK cGAShigh cells were co-cultured with HEK STING cells for 24 h. Cultures were transfected with dsDNA (4 μg/ml) and/or treated with A151 (1 μM) where indicated. STING aggregate formation (mCherry clustering) in HEK STING cells was examined by fluorescence microscopy in three independent visual fields per well (containing >100 cells/field) from four independent experiments. (B) To examine both sequence and backbone composition of A151-mediated cGAS inhibition, cells were pretreated with increasing amounts of A151, A151 (PD) or C151 and then stimulated with dsDNA or cGAMP (2 μg/ml). IFN-β mRNA levels were measured 6h later by qPCR using 18s RNA as an endogenous control. Results are shown as the percent inhibition of dsDNA stimulated cells from one representative of two independent experiments performed in triplicates (C) Lysates from immortalized THP-1 cells were subjected to pulldown analysis using dsDNA without (lane 1) or with (lane 2–7) 3’-biotinylation. Increasing amounts of A151 (0.1, 0.3, 1, 3 and 10 μg) were included in lanes 3–7. 3’-biotinylated A151 was run in lane 8 and whole lysate in lane 9. Immunoblots were probed for the presence of cGAS. Results show one representative experiment of two independent experiments. Statistical analysis: unpaired Student’s test, ***p < 0.001. Scale bar: 30 μm.

Previous studies have shown that the poly-G residues found within A151’s TTAGGG motif play a role in suppression of CpG-induced TLR9 signaling [8]. In addition, a recent study demonstrated that inhibition of AIM2 by A151 was dependent on its phophorothioate (PO) backbone [20]. To determine whether A151’s inhibitory effect on cGAS was sequence and/or backbone dependent, IFN-β mRNA expression was monitored after stimulation with C151 (in which the guanosine triplet of A151 was replaced with adenosine) and A151 (PD) (in which the PO backbone of A151 was replaced with a phosphodiester (PD) backbone). C151 had no significant inhibitory effect on dsDNA-induced cGAS activation at doses where A151 was strongly suppressive. At higher concentrations C151 did attenuate dsDNA-induced IFN-β mRNA expression albeit with an EC50 of 10-times lower than A151 (Fig. 2B). When transfecting cells with cGAMP, which directly activates STING, both A151 and C151 showed similar inhibitory effects with an EC50 of approximately 0.5 μM (Fig. 2B). Importantly, conversion to a PD backbone nearly abolished A151-mediated inhibition of both cGAS and STING activation. These data imply that the inhibitory effect of A151 on cGAS is both sequence and backbone specific. In contrast, the effects of A151 and C151 on STING signaling, which require ~10-times higher doses, were dependent on the non-sequence-specific inhibitory properties of the PO backbone. Similar effects of A151 on the DNA receptor AIM2 have recently been published by Kaminiski et al. who demonstrated that inhibition of AIM2 by A151 was dependent on the PO backbone and the poly-G motif [20]. Gursel et al. demonstrated that suppressive activity of A151 on TLR9 correlates with the ability of telomeric TTAGGG repeats to form G-tetrads [8]. G-tetrads were known to have broad immunomodulatory effects for decades. Ashman et al. [21] recently reported that sequence-specific differences in sup ODN activity cannot be accounted for by their relative affinity to TLR9 leading Kaminski et al. to hypothesize that A151’s interaction with AIM2 may underlie the effects of sup ODN that are independent of any interaction with TLRs [20]. Our data support and expand the theory by Kaminski et al. by showing that cGAS, in addition to TLR9 and AIM2, is another target receptor of A151.

A151 exerts its inhibitory effects on TLR9 via direct interaction with CpG DNA while it’s inhibition of AIM2 is through competition with dsDNA [8, 20]. To determine whether A151 can interact with endogenous cGAS, THP-1 monocytes were lysed, incubated with biotinylated A151 and exposed to streptavidin beads (Fig. 2C). These experiments revealed that A151 interacts with cGAS even in the absence of an activating stimulus. As expected, biotinylated dsDNA also pulled down cGAS in the same experiments. Increasing the amount of A151 added to the combination of biotinylated dsDNA plus cGAS led to decreased cGAS recovery, suggesting that A151 competes with dsDNA for cGAS binding (Fig. 2C). cGAS contains a nucleotidyltransferase domain and two major DNA binding domains that can be activated by dsDNA in a sequence independent manner [3]. Single-stranded (ss) DNA can form internal duplex structures that can activate cGAS as can unpaired guanosines flanking short stretches of dsDNA [2, 22]. By comparison, A151 is a short (24-mer) ssDNA molecule that can form G-tetrads due to its repetitive TTAGGG sequence [8]. This work shows that replacing the guanosine triplet of A151 with an adeno-sine triplet diminishes the inhibition of cGAS (Fig. 2B). Taken together, these results suggest that (i) A151 prevents dsDNA from binding to cGAS by interacting with the DNA binding domain and (ii) guanosine triplets of A151 influence the affinity of this interaction. These conclusions are supported by the finding that increasing amounts of dsDNA could not disrupt A151-cGAS complexes in pulldown studies using biotinylated A151 (data not shown). Ongoing studies are directed toward determining the binding sites of A151 and various poly-G sequences within the DNA binding domain of cGAS.

A151 inhibits autonomous type I IFN response in TREX1 deficient cells

TREX1 is an exonuclease that degrades DNA in the cytoplasm [23]. TREX1 deficiency in humans has been linked to several autoimmune and inflammatory diseases, including AGS and SLE [24]. AGS is characterized by an inherited encephalopathy accompanied by elevated levels of type I IFN that resembles the sequelae of congenital virus infection [25]. In mice, genetic deletion of TREX1 leads to IFN-driven autoimmune diseases, which are triggered by self-DNA activated cGAS [5, 6]. A recent report found an inhibitory effect of chloroquine on cGAS stimulated with dsDNA [26]. However, evidence exists that simultaneous incubation of chloroquine and dsDNA as performed in this study affects the transfection process [27]. Unfortunately, the effect of chloroquine on endogenous DNA species was not examined. Consequently, we studied the inhibitory effect of A151 on endogenous DNA using TREX1-deficient THP-1 monocytes generated by the CRISPR/Cas9 system. As previously reported, antiviral gene expression in the absence of TREX1 is a cell-autonomous phenomenon that does not require additional stimulation [28, 29]. Consistent with this, TREX1 KO cells cultured in vitro produced high levels of type I IFN and IP-10 when compared to THP-1 WT cells (Fig. 3A). Adding increasing amounts of A151 abrogated this type I IFN and IP-10 secretion (Fig. 3A). Similarly, A151 inhibited the upregulation of IFN-stimulated genes (IFIT1 and ISG15) in a dose-dependent manner (Fig. 3B). These results provide the proof-of-concept that inhibition of cGAS by A151 may be a promising therapy for DNA-driven autoimmune diseases such as AGS and SLE. Ongoing studies are directed towards the possibility that G-rich telomeric DNA might be a general inhibitor of any kind of DNA signaling in the body.

Figure 3.

Figure 3.

Open in a new tab

A151 inhibits spontaneous induction of type I IFN response in TREX1 deficient cells. Wild-type (WT) and TREX1 knockout (KO) THP-1 cells were cultured with or without increasing concentrations of A151 for 7 days without further treatment. (A) Type I IFN in the supernatant was measured using HEK-blue type I IFN-sensing cells and IP-10 protein levels were determined by ELISA. (B) IFIT1 and ISG15 mRNA levels were determined by qPCR using HPRT RNA as an endogenous control. The fold induction of IFIT1 and ISG15 induction relative to untreated controls is shown. Data represent mean of (A) two and (B) three technical replicates representative of two independent experiments.

Concluding remarks

Evidence is accumulating implicating cGAS in the development of certain autoimmune diseases and suggesting that cGAS inhibitors might be useful in treatment of DNA-driven autoimmune diseases such as AGS [5, 6]. Unfortunately, agents capable of blocking cGAS signaling by endogenous DNA have not been described. This work demonstrates that immunosuppressive ODN A151 containing TTAGGG motifs competitively blocks cytosolic dsDNA from binding to cGAS and reduced subsequent type I IFN response. Previous studies showed that A151 prevented or reduced the severity of autoimmune diseases including SLE, arthritis and uveitis in murine models [7]. While additional research is needed to clarify the contribution of cGAS to various inflammatory conditions, this study may aid in the development of treating cGAS-triggered autoimmune/inflammatory diseases.

Materials and methods

Reagents

A151 (5’-TTAGGGTTAGGGTTAGGGTTAGGG-3’) and C151 (5’−TTCAAATTCAAATTCAAATTCAAA-3’) constructs were synthesized with a phosphorothioate backbone unless otherwise spec-ified at the Core Facility of the Center for Biologics Evaluation and Research facility, Food and Drug Administration (Bethesda, MD, USA). A 3’-biotin tag was added to A151 or dsDNA for pulldowns. dsDNA isolated from herring sperm was purchased from Sigma-Aldrich (St. Louis, MO, USA). cGAMP (cyclic [G(2’,5’)pA(3’,5’)p]) was purchased from Invivogen (San Diego, CA, USA). mtDNA was isolated from human hepatoma cells (HepG2) using the Mitochondrial Isolation Kit for mammalian cells (Thermo Fisher Scientific, Darmstadt, Germany) according to the manufacturer’s instruction.

Cell culture, stimulation and ELISA

The human monocytic cell line THP-1 was cultured in complete RPMI 1640 medium (Lonza, Walkersville, MD, USA) supplemented with 10% heat inactivated FCS (Biochrom, Berlin, Germany). HEK 293T cells (HEK STING and HEK cGAS) were maintained in DMEM supplemented with 10% FCS and 1% sodium pyruvat (Thermo Fisher Scientific). To generate targeted mutations THP-1 cells were coelectroporated with a gRNA- and a mCherry-Cas9-expression plasmid for cGAS KO and a Cas9–2AEGFP for TREX1 Ko as described earlier [30]. The gRNA target sequences used were GAACTTTCCCGCCTTAGGCAGGG for cGAS KO [31] and GAGAGCTTGTCTACCACACGCGG for TREX KO. dsDNA, mtDNA and cGAMP were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) as indicated in the figures. A151 or C151 was added to cell cultures 1 h before stimulation. DNA-stimulated co-cultures of HEK cGAS with HEK STING cells (containing an N-terminal mCherry-tag) were performed in a 96-well format using 15 × 10e3 cells per well of each cell type as previously described [19]. Images were collected using an Olympus IX81 microscope with × 20 magnification 24 h after stimulation. STING aggregates were visually counted in 3 independent visual fields per well containing at least 100 cells each. For spontaneous interferon production assay TREX1 KO cells were plated in 24-well plates at a density of 1 × 105 cells per ml with or without A151 and incubated for 7 days without further treatment. Supernatants from cell-culture experiments were assayed for IP-10 by ELISA as recommended by the manufacturer (BD Biosciences, Heidelberg, Germany). Human type I IFN was measured using HEK-blue type I IFN-sensing cells (Invivogen, Toulouse, France).

RT-PCR

RT-PCR was performed using total RNA as previously described [32]. Gene expression levels (normalized to 18s or HPRT) were calculated using the 2(-DeltaDeltaC(T)) method. All reagents and probes used in these studies were purchased from Applied Biosystems (Darmstadt, Germany).

Immunoblot

Cells were lysed in Laemmli buffer and denatured at 95°C for 5 min. Cell lysates were separated by 4–15% Mini-PROTEAN TGX gel (Bio-Rad Laboratories, Munich, Germany) and transferred onto nitrocellulose membranes. Blots were incubated with antiphospho-IRF3 (4D4G) or anti-IRF3 (D83B9), as primary and anti-rabbit-IgG-HRP as secondary antibody (all antibodies from Cell Signaling Technology, Cambridge, UK).

Pulldown assay

For pulldown of endogenous cGAS, 1 × 106 THP-1 cells were lysed in an ice-cold high-salt lysis buffer (1% NP-40, 150 mM NaCl, 50 mM Tris HCl [pH 7.9], 100 mM EDTA, 10% glycerol, 10 mM NaF, DTT, and protease inhibitor. Cell debris was removed by centrifugation, and total lysate was incubated with 3 μg 3’–biotinylate A151 or 3’-biotinylated dsDNA for 2 h at 4°C followed by pre-washed streptavidin-agarose beads (50% w/v) for 2 h at 4°C. For competition assays, an increasing amount of A151 was mixed with biotinylated dsDNA before addition to the lysate. Bead pellets were washed, boiled in Laemmli buffer, and run on a 10% SDS-polyacrylamide gel. Blots were probed with anti-cGAS (D1D3G, Cell Signaling Technology).

Supplementary Material

supplement

Acknowledgements:

F.S., C.B., T.Z. and W.B. were supported by BONFOR (University of Bonn). T.Z. and W.B. received DZIF funding and German Research Foundation (DFG) grants EXC1023: ImmunoSensation, CRCs 670 and 704. We would like to thank Hildegard Schilling for excellent technical support, Soheila Riemann and Patrick Müller for help with human monocyte-derived macrophage differentiation and Prof. V. Hornung (Gene Center and Department of Biochemistry, Munich) for providing cGAS KO THP-1 cells and making helpful suggestions.

Abbreviations:

AGS:

Aicardi–Goutières Syndrome

AIM2:

absent in melanoma 2

cGAMP:

cyclic GMP-AMP

cGAS:

cyclic GMP-AMP synthase

dsDNA:

double-stranded DNA

IFIT1:

interferon-induced protein with tetratricopeptide repeats 1

IFN:

interferon

IRF3:

interferon regulatory factor 3

ISG15:

Interferon-stimulated gene 15

mtDNA:

mitochondrial DNA

ODN:

oligodeoxynucleotide

PD:

phosphodiester

PO:

phosphothioate

SLE:

systemic lupus erythematosus

STING:

stimulator of interferon genes

sup ODN:

suppressive oligodeoxynucleotide

TREX1:

three prime repair exonuclease 1

Footnotes

Conflict of interest: The authors declare no financial or commercial conflict of interest.

Additional supporting information may be found in the online version of this article at the publisher’s web-site

References

  • 1.Ablasser A, Goldeck M, Cavlar T, Deimling T, Witte G, R öhl I, Hopfner K-P et al. , cGAS produces a 2’−5’-linked cyclic dinucleotide second messenger that activates STING. Nature. 2013. 498: 380–384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Chen Q, Sun L and Chen ZJ, Regulation and function of the cGAS-STING pathway of cytosolic DNA sensing. Nat. Immunol 2016. 17: 1142–1149. [DOI] [PubMed] [Google Scholar]
  • 3.Sun L, Wu J, Du F, Chen X and Chen ZJ, Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 2013. 339: 786–791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Xia P, Wang S, Gao P, Gao G and Fan Z, DNA sensor cGAS-mediated immune recognition. Protein Cell. 2016. 7: 777–791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Gao D, Li T, Li X-D, Chen X, Li Q-Z, Wight-Carter M and Chen ZJ, Activation of cyclic GMP-AMP synthase by self-DNA causes autoimmune diseases. Proc. Natl. Acad. Sci. U. S. A 2015. 112: E5699–E5705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Gray EE, Treuting PM, Woodward JJ and Stetson DB, Cutting edge: cGAS is required for lethal autoimmune disease in the Trex1-deficient mouse model of Aicardi-Goutières syndrome. J. Immunol. Baltim. Md 1950 2015. 195: 1939–1943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bayik D, Gursel I and Klinman DM, Structure, mechanism and therapeutic utility of immunosuppressive oligonucleotides. Pharmacol. Res 2016. 105: 216–225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Gursel I, Gursel M, Yamada H, Ishii KJ, Takeshita F and Klinman DM, Repetitive elements in mammalian telomeres suppress bacterial DNA-induced immune activation. J. Immunol. Baltim. Md 1950 2003. 171: 1393–1400. [DOI] [PubMed] [Google Scholar]
  • 9.Gray MW, Burger G and Lang BF, Mitochondrial evolution. Science. 1999. 283: 1476–1481. [DOI] [PubMed] [Google Scholar]
  • 10.Zhang Q, Raoof M, Chen Y, Sumi Y, Sursal T, Junger W, Brohi K et al. , Circulating mitochondrial DAMPs cause inflammatory responses to injury. Nature. 2010. 464: 104–107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Oka T, Hikoso S, Yamaguchi O, Taneike M, Takeda T, Tamai T, Oyabu J et al. , Mitochondrial DNA that escapes from autophagy causes inflammation and heart failure. Nature. 2012. 485: 251–255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Boyapati RK, Tamborska A, Dorward DA and Ho G-T, Advances in the understanding of mitochondrial DNA as a pathogenic factor in inflammatory diseases. F1000Research. 2017. 6: 169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Schäfer ST, Franken L, Adamzik M, Schumak B, Scherag A, Engler A, Schönborn N et al. , Mitochondrial DNA: an endogenous trigger for immune paralysis. Anesthesiology. 2016. 124: 923–933. [DOI] [PubMed] [Google Scholar]
  • 14.Krychtiuk KA, Ruhittel S, Hohensinner PJ, Koller L, Kaun C, Lenz M, Bauer B et al. , Mitochondrial DNA and Toll-like receptor-9 are associated with mortality in critically Ill patients. Crit. Care Med. 2015. 43: 2633–2641. [DOI] [PubMed] [Google Scholar]
  • 15.Harrington JS, Choi AMK and Nakahira K, Mitochondrial DNA in sepsis. Curr. Opin. Crit. Care 2017. 23: 284–290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.West AP, Khoury-Hanold W, Staron M, Tal MC, Pineda CM, Lang SM, Bestwick M et al. , Mitochondrial DNA stress primes the antiviral innate immune response. Nature. 2015. 520: 553–557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Rongvaux A, Jackson R, Harman CCD, Li T, West AP, de Zoete MR, Wu Y et al. , Apoptotic caspases prevent the induction of type I interferons by mitochondrial DNA. Cell. 2014. 159: 1563–1577. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Unterholzner L, The interferon response to intracellular DNA: why so many receptors? Immunobiology. 2013. 218: 1312–1321. [DOI] [PubMed] [Google Scholar]
  • 19.Ablasser A, Schmid-Burgk JL, Hemmerling I, Horvath GL, Schmidt T, Latz E and Hornung V, Cell intrinsic immunity spreads to bystander cells via the intercellular transfer of cGAMP. Nature. 2013. 503: 530–534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kaminski JJ, Schattgen SA, Tzeng T-C, Bode C, Klinman DM and Fitzgerald KA, Synthetic oligodeoxynucleotides containing suppressive TTAGGG motifs inhibit AIM2 inflammasome activation. J. Immunol. Baltim. Md 1950 2013. 191: 3876–3883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ashman RF, Goeken JA, Latz E and Lenert P, Optimal oligonucleotide sequences for TLR9 inhibitory activity in human cells: lack of correlation with TLR9 binding. Int. Immunol 2011. 23: 203–214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Herzner A-M, Hagmann CA, Goldeck M, Wolter S, K übler K, Wittmann S, Gramberg T et al. , Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA. Nat. Immunol 2015. 16: 1025–1033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Grieves JL, Fye JM, Harvey S, Grayson JM, Hollis T and Perrino FW, Exonuclease TREX1 degrades double-stranded DNA to prevent spontaneous lupus-like inflammatory disease. Proc. Natl. Acad. Sci. U. S. A 2015. 112: 5117–5122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Rice GI, Rodero MP and Crow YJ, Human disease phenotypes associated with mutations in TREX1. J. Clin. Immunol 2015. 35: 235–243. [DOI] [PubMed] [Google Scholar]
  • 25.Crowl JT, Gray EE, Pestal K, Volkman HE and Stetson DB, Intracellular nucleic acid detection in autoimmunity. Annu. Rev. Immunol 2017. 35: 313–336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.An J, Woodward JJ, Sasaki T, Minie M and Elkon KB, Cutting edge: antimalarial drugs inhibit IFN-β production through blockade of cyclic GMP-AMP synthase-DNA interaction. J. Immunol. Baltim. Md 1950 2015. 194: 4089–4093. [DOI] [PubMed] [Google Scholar]
  • 27.Kwakye-Berko F and Meshnick SR, Binding of chloroquine to DNA. Mol. Biochem. Parasitol 1989. 35: 51–55. [DOI] [PubMed] [Google Scholar]
  • 28.Hasan M, Koch J, Rakheja D, Pattnaik AK, Brugarolas J, Dozmorov I, Levine B et al. , Trex1 regulates lysosomal biogenesis and interferon-independent activation of antiviral genes. Nat. Immunol 2013. 14: 61–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ablasser A, Hemmerling I, Schmid-Burgk JL, Behrendt R, Roers A and Hornung V, TREX1 deficiency triggers cell-autonomous immunity in a cGAS-dependent manner. J. Immunol. Baltim. Md 1950 2014. 192: 5993–5997. [DOI] [PubMed] [Google Scholar]
  • 30.Schmidt T, Schmid-Burgk JL, Ebert TS, Gaidt MM and Hornung V, Designer nuclease-mediated generation of knockout THP1 cells. Methods Mol. Biol. Clifton NJ 2016. 1338: 261–272. [DOI] [PubMed] [Google Scholar]
  • 31.Wassermann R, Gulen MF, Sala C, Perin SG, Lou Y, Rybniker J, Schmid-Burgk JL et al. , Mycobacterium tuberculosis differentially activates cGAS- and inflammasome-dependent intracellular immune responses through ESX-1. Cell Host Microbe. 2015. 17: 799–810. [DOI] [PubMed] [Google Scholar]
  • 32.Bode C, Fox M, Tewary P, Steinhagen A, Ellerkmann RK, Klinman D, Baumgarten G et al. , Human plasmacytoid dentritic cells elicit a Type I Interferon response by sensing DNA via the cGAS-STING signaling pathway. Eur. J. Immunol 2016. 46: 1615–1621. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supplement
NIHMS1005550-supplement-supplement.pptx (73.7KB, pptx)

RESOURCES