Abstract
Autism spectrum disorders (ASD) form a heterogeneous, neurodevelopmental syndrome characterized by deficits in social interactions and repetitive behavior/restricted interests. Dysregulation of mTOR signaling has been implicated in the pathogenesis of certain types of ASD, and inhibition of mTOR by rapamycin has been demonstrated to be an effective therapeutics for impaired social interaction in Tsc1+/−, Tsc2+/−, Pten−/− mice and valproic acid-induced ASD animal models. However, it is still unknown if dysregulation of mTOR signaling is responsible for the ASD-related deficit caused by other genes mutations. Contactin associated protein-like 2 (CNTNAP2) is the first widely replicated autism-predisposition gene. Mice deficient in Cntnap2 (Cntnap2−/− mice) show core ASD-like phenotypes, and have been demonstrated as a validated model for ASD-relevant drug discovery. In this study, we found hyperactive Akt-mTOR signaling in the hippocampus of Cntnap2−/− mice with RNA sequencing followed with biochemical analysis. Treatment with Akt inhibitor LY294002 or mTOR inhibitor rapamycin rescued the social deficit, but had no effect on hyperactivity and repetitive behavior/restricted behavior in Cntnap2−/− mice. We further showed that the effect of LY294002 and rapamycin on social behaviors is reversible. Our results thus identified hyperactive Akt-mTOR signaling pathway as a therapeutic target for abnormal social behavior in patients with dysfunction of CNTNAP2.
Introduction
Autism spectrum disorders (ASD) are a complex set of heterogeneous neurodevelopmental disorders characterized by core deficits in social behavior and communication, accompanied by restricted interests and repetitive behaviors, affecting up to 1 in 68 children1,2. ASD brings a substantial economic burden, including high health-care and school costs and loss of income for caregivers3. However, current available pharmaceutics for ASD is limited to the treatment of co-occurring behaviors or diagnoses, instead of ASD per se4.
Accumulative evidences suggest the important roles of Akt-mTOR signaling in the pathogenesis of ASD4–7. First, abnormal mTOR signaling has been observed in several transgenic ASD animal models, such as Tsc1+/−, Tsc2+/−, Pten−/− and Fmr1−/− mice4,5. Second, environmental factors, such as valproic acid, that elicit ASD may also affect the mTOR signaling6. Finally, the inhibitor of mTOR signaling, rapamycin, has been demonstrated to be an effective therapeutics for impaired social interaction in Tsc1+/−, Tsc2+/−, Pten−/− mice and valproic acid-induced ASD animal model4,8,9. However, ASD are highly heritable, and genetic studies have revealed extraordinary heterogeneity with hundreds of rare risk genes, none accounting for more than 1% of ASD instances10–12. It is still unknown if dysregulation of mTOR signaling is responsible for the ASD-related deficit caused by other gene mutations.
Contactin associated protein-like 2 (CNTNAP2) is the first widely replicated autism-predisposition gene13–16. Knockdown of Cntnap2 produces a cell-autonomous decrease in dendritic arborization and spine development in pyramidal neurons, leading to a global decline in excitatory and inhibitory synapse numbers and a decrease in synaptic transmission17. Mature neurons from Cntnap2−/− mice show reduced spine density and decreased level of GluA1 subunits of AMPA receptors in spines18. Cntnap2−/− mice show core ASD-like phenotypes, including impaired social behaviors and repetitive behavior19.
Cntnap2−/− mice have been demonstrated as a validated model for ASD-relevant drug discovery. Risperidone, a FDA-approved drug for symptomatic treatment of ASD, reduces hyperactivity and perseveration in Cntnap2−/− mice, but has no effect on social deficit19. Neuropeptide oxytocin, involved in the modulation of various aspects of social behaviors, restores the impaired social behavior of Cntnap2−/− mice20. Furthermore, real-time modulation of balance between neuronal excitation and inhibition also rescues social behavior deficit of Cntnap2−/− mice21. Recently, Kim et al. demonstrated that the positive-allosteric-modulator for AMPA receptor is able to rescue the social deficit in Cntnap2−/− mice22.
In this study, we found hyperactive Akt-mTOR signaling in the hippocampus of Cntnap2−/− mice with RNA sequencing followed with biochemical analysis. Pharmacological inhibition of Akt-mTOR signaling reversibly rescued social deficit, but had no effect on hyperactivity and repetitive behaviors in Cntnap2−/− mice.
Materials and Methods
Animals
Cntnap2+/− mice were obtained from the Jackson Laboratory (#017482). Cntnap2−/− mice and wild-type (WT) mice were obtained from heterozygous crossing and were born with the expected Mendelian frequencies. The genotype was confirmed by PCR. Mice were group-housed with 4–6 mice per cage, in a room on a 12 h light/12 h dark cycle (lights on at 5:00 AM, off at 5:00 PM) maintained at 22 ± 2 °C. All procedures regarding the care and use of animals are in accordance with the Institutional Guidelines. PCR primers were listed as followed:
Forward primer: CTGCCAGCCCAGAACTGG;
WT reverse primer: CGCTTCCTCGTGCTTTACGGTAT;
Mutant reverse primer: ACACCAGGGGCAAGAATTG.
All animal experiments were approved by the ethics committee of Center for Medical Genetics, School of Life Sciences, Central South University of China. All methods were performed in accordance with approved guidelines.
Quantitative reverse transcription–PCR
Total RNA from the hippocampus of male WT and Cntnap2−/− mice was extracted using Trizol reagent (Life technologies, NY, USA) according to the manufacturer’s instruction. 2.0 μg of total RNA were reverse-transcribed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher, Waltham mass, USA). The mRNA levels were examined with qPCR using 1 × SYBR Green PCR master mix (Thermo Fisher, Waltham mass, USA) by a C1000 touch Thermal Cycler.
GAPDH forward primer: AGGTCGGTGTGAACGGATTTG
GAPDH reverse primer: TGTAGACCATGTAGTTGAGGTCA
Met forward primer: GTGAACATGAAGTATCAGCTCCC
Met reverse primer: TGTAGTTTGTGGCTCCGAGAT
EfnA5 forward primer: AGCCAGGGTTGATGAGTAGAG
EfnA5 reverse primer: GAACGTGGGTATCGGGGTG
Western Blot
Mice at the age of 4–8 weeks without any behavioral test were sacrificed by cervical dislocation. The hippocampus and cortex from male WT and Cntnap2−/− mice were homogenized by a tissue homogenizer in 2 × SDS gel-loading buffer (50 mM Tris–HCl at pH 6.8, 2% SDS and 10% glycerol) with 1 × NaF, 1 × NaVO4, and 1 × Protein inhibitor cocktail. The supernatant was obtained by centrifugation, and the protein concentration was determined using the PierceTM BCA protein Assay kit (Thermo Fisher, Waltham mass, USA). Proteins were resolved by SDS–PAGE, transferred onto a polyvinylidene fluoride membrane and blocked in 5% skim milk/Tris-buffered saline that contained 0.1% Tween 20 at room temperature for 1 h. The membranes were incubated with the primary antibodies at 4°C overnight, and then were incubated with second antibody at room temperature for 1 h. After washing, the bands were visualized with Enhanced chemiluminescence Western blotting detection reagents. The band density was quantified using ImageJ software. The antibodies were listed as following: Cntnap2 (ab33994, Abcam, USA), Phospho-Akt (Ser473) (4060, CST, USA), Akt (4691, CST, USA), Phospho-mTOR (Ser2448) (5536, CST, USA), mTOR (2983, CST, USA), Phospho-S6 (Ser235/236) (2211, CST, USA), S6 (2217, CST, USA), β-actin (A2228, Sigma, USA).
Drug administration
LY294002 (HY-10108) or rapamycin (HY-10219) were obtained from MedChem Express (MCE, New Jersey, USA). Male mice at the age of 4–8 weeks were received LY294002 (25 mg/kg body weight)23,24 and rapamycin (10 mg/kg body weight)25 or an equal volume of vehicle by intraperitoneal injection (i.p.) once/day for 2 consecutive days. The behavioral tests or tissue collection were performed at 60 min after the second administration. Each mouse only received injection of one drug (saline, LY294002 or rapamycin).
Social approach (three-chamber) test
The social approach test was performed as described26,27. The apparatus consisted of three Plexiglas chambers: the central chamber and two side chambers. Each chamber was accessible to the mouse from the center through the retractable doorways. The test consisted of two phases: habituation and sociability.
At phase 1, two empty plexiglas cages were placed in two side chambers, and a test mouse was placed in the central chamber and was given the choice to explore all three chambers for 10 min.
At phase 2, a stranger mouse (matched in age and sex, stranger 1), which was enclosed in a plexiglas cage to make sure that only the test mouse could initiate social interaction, was placed into cage 1 for replaced for object 1. The test mouse was placed in the central chamber and was allowed to explore the three chamber apparatus for 10 min to assess the sociability (interaction with stranger 1).
The behaviors were recorded and the sniffing time of the test mouse for each plexiglas cage were scored by Anilab Software (Anilab, Ningbo, China). The preference index was calculated as showed below:
Reciprocal social interaction
Mice were placed in a cage to which they had been previously habituated (for 10 min) with an unfamiliar mouse matched in age, genotype, and sex for 10 min. Both mice in the pair were treated either with the same drug or with vehicle. The time engaged in social interaction (nose-to-nose sniffing, nose-to-anus sniffing, and following or crawling on/under each other) for the pair (combining the behavior of both animals) was measured by two independent human observers5.
Open field test
Mice were individually placed in a Plexiglas box (62 cm × 62 cm). The distance travelled was recorded for 10 min and scored by Anilab software (Anilab, Ningbo, China).
Grooming test
Mice were individually placed in a Plexiglas column (20 cm diameter). After acclimation for 10 minutes, the behaviors were recorded for 10 minutes. The time spent for self-grooming was measured by a researcher blind to the genotypes.
Statistical analysis
A repeated-measure ANOVA followed by Bonferroni post hoc tests or unpaired two-tail Student’s t test was used as indicated. All statistical analyses were performed using the Prism 6.01 (Graph Pad Software, San Diego, CA).
Results
Cntnap2-deficiency led to hyperactivity in the Akt-mTOR signaling pathway
ASD may be associated with dysfunction in a variety of brain areas, such as the hippocampus28, the prefrontal cortex21, and striatum29. To identify potential therapeutic targets for Cntnap2−/− mice, we analyzed the global gene expression in the hippocampus from wild-type (WT) and Cntnap2−/− mice by RNA-sequencing (RNA-seq). We identified 90 significantly down-regulated genes (ratio <0.8), and 99 significantly up-regulated genes (ratio >1.2) in Cntnap2−/− mice (Fig. 1a, Supplementary Table 1a). All significantly changed genes were enriched in 6 different signaling pathways as analyzed with Kyoto Encyclopedia of Genes and Genomes (KEGG) (Fig. 1b). Notably, there were 9 genes enriched in the phosphatidylinositol 3-kinase (PI3K)-Akt signaling pathway (Supplementary Table 1a). The expression of Met proto-oncogene receptor (Met) and EphrinA5 (EfnA5) were further verified by quantitative reverse transcription PCR (qRT-PCR) (Fig. 1c).
The up-regulation of Met and EfnA5 suggested a hyperactive PI3K-Akt signaling in the Cntnap2−/− mice. We then examined the activation of the PI3K-Akt signaling pathway by immnoblotting analysis on the Akt phosphorylation level. As shown in Fig. 1d, the phosphorylation level of Akt (Ser473) was increased significantly in Cntnap2−/− mice. In contrast, the level of total Akt was not changed significantly. The mTOR signaling pathway is a typical downstream of Akt signaling. The phosphorylation levels of mTOR (Ser2448) and its downstream target molecule ribosomal protein S6 (S6) (Ser235/236) were also increased significantly in Cntnap2−/− mice, whereas the levels of total mTOR or S6 were not significantly changed (Fig. 1d).
The hyperactive Akt-mTOR signaling seems to be a common consequences of Cntnap2 deficiency as it was also detected in the cortex and dorsal root ganglion neurons from Cntnap2−/− mice (Supplementary Fig. 1d, and data not shown).
Inhibition of Akt-mTOR signaling rescued social deficit in Cntnap2−/− mice
To see whether hyperactive PI3K-Akt signaling was responsible for the social deficit in Cntnap2−/− mice, we sought to analyze the consequences of inhibition of PI3K-Akt signaling by Akt inhibitor LY294002 (Fig. 2a). We used the three-chamber test to assess the sociability. In the habituation phase, WT and Cntnap2−/− mice showed no difference in the sniffing time (Fig. 2c,d). Consistent with previous reports, Cntnap2−/− mice showed significantly reduced interaction for exploring a stranger mouse relative to an inanimate object (Fig. 2c,g)19.
Male mice at the age of 4–8 weeks received LY294002 (25 mg/kg body weight) or an equal volume of vehicle once/day for 2 consecutive days. The behavioral tests or tissue collection were performed at 60 min after the second administration (Fig. 2a). Treatment with LY294002 significantly suppressed the phosphorylation of Akt (Fig. 2b). LY294002 treatment did not alter interaction time in habituation phase (Fig. 2c,e), but significantly improved the social interaction of Cntnap2−/− mice. As shown in Fig. 2h, LY294002-treated Cntnap2−/− mice spent significantly more time with a stranger mouse than the object. The preference index of saline-treated Cntnap2−/− mice was significantly lower than that of saline-treated WT mice (Fig. 2j); however, the preference index of Cntnap2−/− mice was significantly increased by LY294002 treatment to the levels comparable with WT mice (Fig. 2j).
The FDA-approved drug, rapamycin, showed beneficial effect on the social behaviors in certain ASD animal models with over-activated mTOR signaling4,5. Recently, rapamycin was also revealed to improve the ASD-associated behaviors in patients with tuberous sclerosis30. As mTOR signaling was significantly increased in the Cntnap2−/− mice (Fig. 1d), we sought to determine the effect of rapamycin on the social behaviors. Consistent with previous study, administration of rapamycin significantly suppressed the phosphorylation of S6 (Fig. 2b). Rapamycin did not alter interaction time in habituation phase (Fig. 2c,f), but significantly improved the social interaction of Cntnap2−/− mice. Rapamycin-treated Cntnap2−/− mice spent significantly more time with a stranger mouse than the object (Fig. 2c,i). As a result, the preference index of rapamycin-treated Cntnap2−/− mice was significantly increased to the levels comparable with WT mice (Fig. 2j).
We also measured the therapeutic effect of LY294002 and rapamycin on social deficit of Cntnap2−/− mice using a reciprocal social interaction test. As shown in Fig. 2k, saline-treated Cntnap2−/− mice spent significantly less time on reciprocal social interaction than the saline-treated WT mice (Fig. 2k). However, LY294002 or rapamycin treatment increased the reciprocal social interaction time to the similar levels of WT mice (Fig. 2k).
The rescuing effect of Akt-mTOR inhibitors on the social behavior was reversible
To see if LY294002 and rapamycin treatment had long-lasting effect on the social behavior, we measured the sociability with the three-chamber test in drug-treated mice at 7 days post of injection. The drug-treated WT and Cntnap2−/− mice spent comparable time sniffing the two objects (Fig. 3a,b,e). However the drug-treated Cntnap2−/− mice could not distinguish the stranger mouse and the inanimate object (Fig. 3a,c,f). The preference index for drug-treated Cntnap2−/− mice was significantly lower than that of drug-treated WT mice at 7 days after last injection (Fig. 3d,g). Our results therefore indicated that Akt inhibitor LY294002 or mTOR inhibitor rapamycin only had a transient effect on the social deficit in Cntnap2−/− mice.
Inhibition of Akt-mTOR signaling had no effect on the hyperactivity and repetitive behaviors in Cntnap2−/− mice
Deficiency in Cntnap2 also led to other autism-related behaviors, including hyperactivity and repetitive behaviors19. As shown in Fig. 4a, Cntnap2−/− mice displayed significantly higher locomotor activity than the WT controls in the open field test. Inhibition of Akt/mTOR signaling by LY294002 or rapamycin had no effect on the hyperactivity. The distance travelled by Cntnap2−/− was still higher than WT controls after drugs treatment (Fig. 4b,c).
Repetitive behavior is frequently observed in children with ASD2. We used a grooming test to measure the repetitive behavior of WT and Cntnap2−/− mice. Consistent with previous reports, Cntnap2−/− mice spent significantly more time on grooming themselves than the WT controls (Fig. 4d)19. Inhibition of Akt/mTOR signaling by LY294002 or rapamycin had no effect on the repetitive behaviors in Cntnap2−/− mice (Fig. 4e,f).
Discussion
Dysregulation of mTOR signaling and synaptic pathology have been considered as two common denominators of ASD across different etiologies31,32. Many synaptic genes have been implicated in ASD, including Cntnap2, Neuroligins and Shanks4,5,33. Mice deficient in these synaptic genes display core autism-related deficits19,26,34,35. Over-activated mTOR signaling may elicit the ASD-like behaviors through increased synapse protein synthesis4,36. A rare single nucleotide polymorphism has been identified in autism that was associated with increased promoter activity in the eukaryotic translation initiation factor 4E (eIF4E) gene37. As a downstream molecule of mTOR signaling, eIF4E is also negatively regulated by 4E-binding proteins (4EBPs). Up-regulation of eIF4E in mice, either by eIF4E transgene or by 4EBP2-deletion, leads to ASD-like behaviors38,39. The eIF4E transgenic mice exaggerate translation and synaptic function, resulting in core ASD-like behaviors, and these ASD-like behaviors could be reversed by translation inhibitor 4EGI-139. Interestingly, the eIF4E-dependent synaptic protein translations, such as NLGN 1/2/3/4 are significantly increased in 4EBP2−/− mice. Both pharmacological infusion of 4EGI-1 and knockdown of NLGN1 could reverse the social deficits in 4EBP2−/− mice38.
Intriguingly, synaptic impairments also affect the status of mTOR signaling, probably forming a molecular loop underlying the pathogenesis of ASD. Shank protein family is a group of synaptic scaffolding proteins. Mutations in Shank2 and Shank3 have been identified in individuals with ASD, and mice deficient in Shank2 or Shank3 showed core ASD-related deficits26,34. A recent study shows that Shank3 deficiency leads to reduction in Akt-mTOR signaling, due to increased steady-state levels of Cdc2-like kinase 2 (CLK2). A CLK2 inhibitor successfully rescues the social deficit in Shank3−/− mice26. Puzzlingly, mTOR signaling is also significantly decreased in the transgenic mice overexpressing Shank340.
In this study, we showed that deficiency in synaptic protein Cntnap2 also led to altered mTOR signaling, reinforcing the reciprocal relation between mTOR and synaptic signaling. The increased expression of Met and/or EfnA5 may contribute partially to the hyperactive Akt-mTOR signaling. However, it is still unclear how Cntnap2 deficiency causes up-regulation of Met and EfnA5. Anderson et al. reported that knockdown of Cntnap2 leads to a global decline in synapse numbers and a decrease in synaptic transmission17, which may mediate the Cntnap2-deficiency and altered gene expression. Furthermore, the Met expression is also regulated epigenetically by methyl-CpG-binding protein 2 (MECP2)41. Deficiency in MECP2 resulted in Rett syndrome and ASD42. Interestingly, EfnA5 is up-regulated nearly 40% in MeCP2−/− mice43, implying MeCP2 as potential mediator for Cntnap2-deficiency to the expression of Met and EfnA5.
Our pharmacological experiments indicated that hyperactive Akt-mTOR signaling is responsible for the social deficit, as inhibition of Akt or mTOR signaling reversibly rescued the social deficit in Cntnap2−/− mice. Nevertheless, treatment with Akt or mTOR inhibitors failed to normalize the hyperactivity and repetitive behaviors in Cntnap2−/− mice. Our data further supports the notion that distinct pathways lead to the social and repetitive behavioral deficits in ASD. Indeed, risperidone reduces hyperactivity, motor stereotypies and perseveration, but has no effect on the social behaviors in Cntnap2−/− mice19. Oxytocin treatment restores social behavior, but has no effect for repetitive behavior and hyperactivity20. Nevertheless, we cannot completely exclude the possibility that the persistence of hyperactivity and repetitive behaviors in the presence of LY294002 and rapamycin may be the results of insufficient inhibition of Akt-mTOR pathways in the brain regions mediating these behaviors. Indeed, Selimbeyoglu et al. demonstrated that modulation of prefrontal cortex excitation/inhibition balance is able to rescues social behavior as well as hyperactivity in Cntnap2−/− mice21. In summary, our data showed that deficiency in Cntnap2 led to hyperactive Akt-mTOR signaling. Inhibition of Akt-mTOR signaling reversibly rescued the social deficit in Cntnap2−/− mice. Our study thus implied mTOR signaling as a common therapeutic target for ASD from different etiologies.
Supplementary information
Acknowledgements
This project is financially supported by the National High-tech R&D Program (2015AA020502), National Basic Research Program of China (2012CB517904), National Natural Science Foundation of China (31371187, 81770780, and 81728013, 81671101, 31471062), Education Department Foundation of Hunan Province (15B165, 15C0990), Hunan University of medicine (2014KY05), and the Key research and development programs from Hunan Province (2018DK2010, 2018DK2013, 2018DK2016).
Author Contributions
J.-D.L., K.X., Z.H. and F.J. conceived and designed the experiments; X.X., K.W. and J.Z. performed the experiments; B.C. and X.L. helped to analyze the data; X.X. and J.-D.L. wrote the paper.
Data Availability
The datasets generated and analyzed for the current study are available.
Competing Interests
The authors declare no competing interests.
Footnotes
Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Electronic supplementary material
Supplementary information accompanies this paper at 10.1038/s41598-019-39434-5.
References
- 1.Roehr B. American Psychiatric Association explains DSM-5. BMJ. 2013;346:f3591. doi: 10.1136/bmj.f3591. [DOI] [PubMed] [Google Scholar]
- 2.Lord C. For Better or for Worse? Later Diagnoses of Autism Spectrum Disorder in Some Younger Siblings of Already Diagnosed Children. J Am Acad Child Adolesc Psychiatry. 2018;57:822–823. doi: 10.1016/j.jaac.2018.08.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Lavelle TA, et al. Economic burden of childhood autism spectrum disorders. Pediatrics. 2014;133:e520–529. doi: 10.1542/peds.2013-0763. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Ehninger D, Silva AJ. Rapamycin for treating Tuberous sclerosis and Autism spectrum disorders. Trends Mol Med. 2011;17:78–87. doi: 10.1016/j.molmed.2010.10.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Silverman JL, Yang M, Lord C, Crawley JN. Behavioural phenotyping assays for mouse models of autism. Nat Rev Neurosci. 2010;11:490–502. doi: 10.1038/nrn2851. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Qin L, Dai X, Yin Y. Valproic acid exposure sequentially activates Wnt and mTOR pathways in rats. Mol Cell Neurosci. 2016;75:27–35. doi: 10.1016/j.mcn.2016.06.004. [DOI] [PubMed] [Google Scholar]
- 7.Bear MF, Huber KM, Warren ST. The mGluR theory of fragile X mental retardation. Trends Neurosci. 2004;27:370–377. doi: 10.1016/j.tins.2004.04.009. [DOI] [PubMed] [Google Scholar]
- 8.Zhang J, Liu LM, Ni JF. Rapamycin modulated brain-derived neurotrophic factor and B-cell lymphoma 2 to mitigate autism spectrum disorder in rats. Neuropsychiatr Dis Treat. 2017;13:835–842. doi: 10.2147/NDT.S125088. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Burket JA, Benson AD, Tang AH, Deutsch SI. Rapamycin improves sociability in the BTBR T(+)Itpr3(tf)/J mouse model of autism spectrum disorders. Brain Res Bull. 2014;100:70–75. doi: 10.1016/j.brainresbull.2013.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Iossifov I, et al. The contribution of de novo coding mutations to autism spectrum disorder. Nature. 2014;515:216–221. doi: 10.1038/nature13908. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.De Rubeis S, et al. Synaptic, transcriptional and chromatin genes disrupted in autism. Nature. 2014;515:209–215. doi: 10.1038/nature13772. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Berg JM, Geschwind DH. Autism genetics: searching for specificity and convergence. Genome Biol. 2012;13:247. doi: 10.1186/gb4034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Alarcon M, et al. Linkage, association, and gene-expression analyses identify CNTNAP2 as an autism-susceptibility gene. Am J Hum Genet. 2008;82:150–159. doi: 10.1016/j.ajhg.2007.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Arking DE, et al. A common genetic variant in the neurexin superfamily member CNTNAP2 increases familial risk of autism. Am J Hum Genet. 2008;82:160–164. doi: 10.1016/j.ajhg.2007.09.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Bakkaloglu B, et al. Molecular cytogenetic analysis and resequencing of contactin associated protein-like 2 in autism spectrum disorders. Am J Hum Genet. 2008;82:165–173. doi: 10.1016/j.ajhg.2007.09.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Li X, et al. Association analysis of CNTNAP2 polymorphisms with autism in the Chinese Han population. Psychiatr Genet. 2010;20:113–117. doi: 10.1097/YPG.0b013e32833a216f. [DOI] [PubMed] [Google Scholar]
- 17.Anderson GR, et al. Candidate autism gene screen identifies critical role for cell-adhesion molecule CASPR2 in dendritic arborization and spine development. Proc Natl Acad Sci USA. 2012;109:18120–18125. doi: 10.1073/pnas.1216398109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Varea O, et al. Synaptic abnormalities and cytoplasmic glutamate receptor aggregates in contactin associated protein-like 2/Caspr2 knockout neurons. Proc Natl Acad Sci USA. 2015;112:6176–6181. doi: 10.1073/pnas.1423205112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Penagarikano O, et al. Absence of CNTNAP2 leads to epilepsy, neuronal migration abnormalities, and core autism-related deficits. Cell. 2011;147:235–246. doi: 10.1016/j.cell.2011.08.040. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Penagarikano O, et al. Exogenous and evoked oxytocin restores social behavior in the Cntnap2 mouse model of autism. Sci Transl Med. 2015;7:271ra278. doi: 10.1126/scitranslmed.3010257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Selimbeyoglu, A. et al. Modulation of prefrontal cortex excitation/inhibition balance rescues social behavior in CNTNAP2-deficient mice. Sci Transl Med9, 10.1126/scitranslmed.aah6733 (2017). [DOI] [PMC free article] [PubMed]
- 22.Kim JW, et al. Pharmacological modulation of AMPA receptor rescues social impairments in animal models of autism. Neuropsychopharmacology. 2019;44:314–323. doi: 10.1038/s41386-018-0098-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Yang JC, et al. Inhibition of the phosphoinositide 3-kinase pathway decreases innate resistance to lipopolysaccharide toxicity in TLR4 deficient mice. J Biomed Sci. 2014;21:20. doi: 10.1186/1423-0127-21-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Lazo JS, et al. Pharmacologic profiling of phosphoinositide 3-kinase inhibitors as mitigators of ionizing radiation-induced cell death. J Pharmacol Exp Ther. 2013;347:669–680. doi: 10.1124/jpet.113.208421. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Sato A, et al. Rapamycin reverses impaired social interaction in mouse models of tuberous sclerosis complex. Nat Commun. 2012;3:1292. doi: 10.1038/ncomms2295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Bidinosti M, et al. CLK2 inhibition ameliorates autistic features associated with SHANK3 deficiency. Science. 2016;351:1199–1203. doi: 10.1126/science.aad5487. [DOI] [PubMed] [Google Scholar]
- 27.Chung W, et al. Social deficits in IRSp53 mutant mice improved by NMDAR and mGluR5 suppression. Nat Neurosci. 2015;18:435–443. doi: 10.1038/nn.3927. [DOI] [PubMed] [Google Scholar]
- 28.Zhang Y, et al. Loss of MeCP2 in cholinergic neurons causes part of RTT-like phenotypes via alpha7 receptor in hippocampus. Cell Res. 2016;26:728–742. doi: 10.1038/cr.2016.48. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Peca J, et al. Shank3 mutant mice display autistic-like behaviours and striatal dysfunction. Nature. 2011;472:437–442. doi: 10.1038/nature09965. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Hwang SK, et al. Everolimus improves neuropsychiatric symptoms in a patient with tuberous sclerosis carrying a novel TSC2 mutation. Mol Brain. 2016;9:56. doi: 10.1186/s13041-016-0222-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Zoghbi HY. Postnatal neurodevelopmental disorders: meeting at the synapse? Science. 2003;302:826–830. doi: 10.1126/science.1089071. [DOI] [PubMed] [Google Scholar]
- 32.Bourgeron T. A synaptic trek to autism. Curr Opin Neurobiol. 2009;19:231–234. doi: 10.1016/j.conb.2009.06.003. [DOI] [PubMed] [Google Scholar]
- 33.Banerjee S, Riordan M, Bhat MA. Genetic aspects of autism spectrum disorders: insights from animal models. Front Cell Neurosci. 2014;8:58. doi: 10.3389/fncel.2014.00058. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Schmeisser MJ, et al. Autistic-like behaviours and hyperactivity in mice lacking ProSAP1/Shank2. Nature. 2012;486:256–260. doi: 10.1038/nature11015. [DOI] [PubMed] [Google Scholar]
- 35.Radyushkin K, et al. Neuroligin-3-deficient mice: model of a monogenic heritable form of autism with an olfactory deficit. Genes Brain Behav. 2009;8:416–425. doi: 10.1111/j.1601-183X.2009.00487.x. [DOI] [PubMed] [Google Scholar]
- 36.Huber KM, Klann E, Costa-Mattioli M, Zukin RS. Dysregulation of Mammalian Target of Rapamycin Signaling in Mouse Models of Autism. J Neurosci. 2015;35:13836–13842. doi: 10.1523/JNEUROSCI.2656-15.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Neves-Pereira M, et al. Deregulation of EIF4E: a novel mechanism for autism. J Med Genet. 2009;46:759–765. doi: 10.1136/jmg.2009.066852. [DOI] [PubMed] [Google Scholar]
- 38.Gkogkas CG, et al. Autism-related deficits via dysregulated eIF4E-dependent translational control. Nature. 2013;493:371–377. doi: 10.1038/nature11628. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Santini E, et al. Exaggerated translation causes synaptic and behavioural aberrations associated with autism. Nature. 2013;493:411–415. doi: 10.1038/nature11782. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Lee Y, et al. Striatal Transcriptome and Interactome Analysis of Shank3-overexpressing Mice Reveals the Connectivity between Shank3 and mTORC1 Signaling. Front Mol Neurosci. 2017;10:201. doi: 10.3389/fnmol.2017.00201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Plummer JT, et al. Transcriptional regulation of the MET receptor tyrosine kinase gene by MeCP2 and sex-specific expression in autism and Rett syndrome. Transl Psychiatry. 2013;3:e316. doi: 10.1038/tp.2013.91. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Samaco RC, Nagarajan RP, Braunschweig D, LaSalle JM. Multiple pathways regulate MeCP2 expression in normal brain development and exhibit defects in autism-spectrum disorders. Hum Mol Genet. 2004;13:629–639. doi: 10.1093/hmg/ddh063. [DOI] [PubMed] [Google Scholar]
- 43.Pacheco NL, et al. RNA sequencing and proteomics approaches reveal novel deficits in the cortex of Mecp2-deficient mice, a model for Rett syndrome. Mol Autism. 2017;8:56. doi: 10.1186/s13229-017-0174-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets generated and analyzed for the current study are available.