Small IncQ1 and Col-Like Plasmids Harboring bla_KPC-2 and Non-Tn4401 Elements (NTE_KPC-IId) in High-Risk Lineages of Klebsiella pneumoniae CG258

LETTER

Aretrospective genomic study led to the identification of two carbapenem-resistant Klebsiella pneumoniae isolates (KPN535 and KPC45) carrying bla_KPC-2 genes on nonconjugative plasmids. These isolates were recovered in 2011 and 2015 from rectal swab cultures of inpatients from two hospitals in Brazil and belonged to the hospital-associated lineages ST340 and ST11 (CG258).

For both K. pneumoniae strains, total genomic DNA was extracted and sequenced using long-read (PromethION; Oxford Nanopore) and short-read (NextSeq; Illumina) sequencing technologies, with further hybrid de novo assembly using Unicycler (v0.4.0), which resolved complete circularized sequences of chromosome and plasmids (1, 2).

Interestingly, in KPN535 and KPC45, the bla_KPC-2 gene was found on small IncQ1 and Col-like (Col-KPC) plasmids named pKPN535a and pKPC45a, respectively (Fig. 1A and B). The pKPN535a plasmid is 14,873 bp in size, with a G+C content of 54.6%, containing the higA antitoxin-encoding gene, genes encoding ParE/RelE-superfamily toxins, and the aph(3′)-Vla aminoglycoside resistance gene. On the other hand, Col-KPC is 9,548 bp in size (with a G+C content of 52.3%), sharing >90% identity with the Col (MGD2) plasmid (NC_003789) (3), and carrying relaxase and mobC genes.

FIG 1.

Genetic structures of small IncQ1 pKPN535a (MH595533) (A) and Col-KPC pKPC45a (MH595534) (B) plasmids harboring the bla_KPC-2 gene and non-Tn4401 elements (NTE_KPC-IId) identified in K. pneumoniae strains belonging to ST11 and ST340 (CG258), respectively. Protein coding sequences are represented by the arrows and labeled with gene name or product. (C) Alignment of Tn4401 and NTE_KPC genetic elements harboring bla_KPC genes identified in Brazil. NTE_KPC genetic elements encompass NTE_KPC-Ic associated with bla_KPC-2 carried by IncX3 plasmids (4), and the two NTE_KPC-IId elements identified in this study. Based on the insertion of Δbla_TEM upstream of the bla_KPC gene, NTE_KPC elements have been classified as NTE_KPC-II, whereas NTE_KPC-II variants are based on the differences of the length of Δbla_TEM and deletions between Δbla_TEM and bla_KPC-2 (4). In both plasmids, NTE_KPC-IId elements were flanked by two identical 243-bp direct repeats (DR [open circles], GGGGTCGTCTCAGAATTCGGAAAATAAAGCACGCTAGCGGTTGATCTGTCAGGTTGAAGCCTGAGAGGCCGAGCGCAGATCGTCAGAAAAGGCGAAAAACGATCCTAATCTGACGCAACATAGGTGGGGTGCCTGACGCCCGGTTGAGGCGTACTTCAACTGGACACCATTCCAGAAAGACCAAGCATGGCATGGCCTGCCGCTGTCTTACCGTGCTTTATTTCCCGTTTTCTCTATCGACC). Protein coding sequences are represented by the arrows and labeled with gene name or product. Light blue shading denotes shared regions of homology (>95%).

Both plasmids contain a variant of non-Tn4401 elements (NTE_KPC), designated NTE_KPC-IId, with the gene array tnpR-Δbla_TEM-bla_KPC-2-ΔISKpn6/traN (Fig. 1C). Interestingly, in the two plasmids, NTE_KPC-IId elements were flanked by two identical 243-bp direct repeats, whereas pKPN535a carries a third 243-bp repeat downstream repC. The NTE_KPCs have been separated in three groups according to the absence or presence of bla_TEM, where the second group (NTE_KPC-II) includes variants that have a truncated bla_TEM gene (4, 5); in contrast, all NTE_KPC structures described to date (including NTE_KPC-IId) contain genetic remnants of Tn4401, which is consistent with their having evolved from Tn4401 by recombination and/or insertion of other smaller mobile genetic elements. By using NCBI blast against the NR database, we noted that similar NTE_KPC-IId structures (100% identity) have been recently identified in Klebsiella aerogenes from Brazil (GenBank accession numbers MG786907 and MH000708). Therefore, although no additional information is available, the possibility that Enterobacterales carrying bla_KPC-2 on NTE_KPC-IId elements have spread in Brazil and into other countries is deeply concerning. In fact, NTE_KPC elements have been described in China, Argentina, Brazil, and Russia (4–7). Therefore, the role of NTE_KPC elements in global dissemination of bla_KPC deserves additional investigation.

Plasmids have played a key role in the horizontal spread of antibiotic resistance genes, promoting the survival and selection of clonal lineages among clinically significant pathogens (8). IncQ plasmids are of particular interest since they are highly mobilizable, being stably maintained, and transferred among a wide range of Gram-negative bacteria (9, 10). On the other hand, Col-like plasmids are mobilizable vectors that have been increasingly reported as antibiotic resistance carriers, in members of the Enterobacteriaceae family, being postulated as versatile gene capture platforms (11). These novel groups of IncQ1 and Col-KPC plasmids, identified in this study, might have originated through independent recombination events between NTE_KPC-IId and a recipient IncQ1 or Col-type plasmid backbone, which is consistent with independent recombination events generating the variability among members of this group of plasmids (10, 12). Interestingly, large direct repeats could flank genomic rearrangements between NTE_KPC elements and small mobilizable plasmids. In fact, recent studies have reported the presence of these small plasmids in KPC-2-producing Pseudomonas aeruginosa and Escherichia coli and in BKC-positive Klebsiella pneumoniae isolates (12–15).

In summary, we report here the identification and complete sequence of two plasmids, pKPN535a (MH595533) and pKPC45a (MH595534), which represent new groups of small IncQ1 and Col-KPC vectors conferring carbapenem resistance in high-risk lineages of K. pneumoniae CG258, representing a novel mechanism for dissemination of carbapenem resistance that may carry lower fitness costs and could potentially result in increased persistence and wider dissemination.

Data availability.

The nucleotide sequences of the pKPN535a and pKPC45a plasmids were deposited at GenBank under accession numbers MH595533 and MH595534, respectively.