Skip to main content
NCBI home page
American Journal of Physiology - Regulatory, Integrative and Comparative Physiology logoLink to American Journal of Physiology - Regulatory, Integrative and Comparative Physiology
. 2019 Jan 9;316(2):R165–R171. doi: 10.1152/ajpregu.00167.2018

Interleukin-4 supplementation improves the pathophysiology of hypertension in response to placental ischemia in RUPP rats

Jesse N Cottrell 1, Lorena M Amaral 2, Ashlyn Harmon 2, Denise C Cornelius 2,3, Mark W Cunningham Jr 2, Venkata Ramana Vaka 2, Tarek Ibrahim 2, Florian Herse 4, Gerd Wallukat 4, Ralf Dechend 4, Babbette LaMarca 2,✉
PMCID: PMC6397356  PMID: 30624978

Abstract

Preeclampsia (PE) is characterized by chronic inflammation and elevated agonistic autoantibodies to the angiotensin type 1 receptor (AT1-AA), endothelin-1, and uterine artery resistance index (UARI) during pregnancy. Previous studies report an imbalance among immune cells, with T-helper type 2 (Th2) cells being decreased during PE. We hypothesized that interleukin-4 (IL-4) would increase Th2 cells and improve the pathophysiology in response to placental ischemia during pregnancy. IL-4 (600 ng/day) was administered via osmotic minipump on gestational day 14 to normal pregnant (NP) and reduced uterine perfusion pressure (RUPP) rats. Carotid catheters were inserted, and Doppler ultrasound was performed on gestational day 18. Blood pressure (mean arterial pressure), TNF-α, IL-6, AT1-AA, natural killer cells, Th2 cells, and B cells were measured on gestational day 19. Mean arterial pressure was 97 ± 2 mmHg in NP (n = 9), 101 ± 3 mmHg in IL-4-treated NP (n = 14), and 137 ± 4 mmHg in RUPP (n = 8) rats and improved to 108 ± 3 mmHg in IL-4-treated RUPP rats (n = 17) (P < 0.05). UARI was 0.5 ± 0.03 in NP and 0.8 in RUPP rats and normalized to 0.5 in IL-4-treated RUPP rats (P < 0.05). Plasma nitrate-nitrite levels increased in IL-4-treated RUPP rats, while placental preproendothelin-1 expression, plasma TNF-α and IL-6, and AT1-AA decreased in IL-4-treated RUPP rats compared with untreated RUPP rats (P < 0.05). Circulating B cells and placental cytolytic natural killer cells decreased after IL-4 administration, while Th2 cells increased in IL-4-treated RUPP compared with untreated RUPP rats. This study illustrates that IL-4 decreased inflammation and improved Th2 numbers in RUPP rats and, ultimately, improved hypertension in response to placental ischemia during pregnancy.

Keywords: hypertension, inflammation, interleukin-4, preeclampsia, pregnancy

INTRODUCTION

Preeclampsia (PE) is a multisystem disorder that complicates ~10% of all pregnancies (6, 8). It is the leading cause of iatrogenic preterm birth and a significant contributor to maternal and perinatal morbidity and mortality (8, 37). The clinical complications of PE include fetal growth restriction, preterm birth, placental abruption, HELLP syndrome (hemolysis, elevated liver enzymes, and low platelet count), eclampsia, cardiovascular disease, and end-organ damage (6). While advances have been made in our understanding of the pathophysiology of the disease, the treatment of PE has not changed in 50 years: delivery remains the only known definitive cure (24).

The diagnosis of PE is made by new-onset hypertension with additional evidence of multisystem involvement (2a). The precipitating cause of PE has yet to be fully elucidated. It is postulated that maternal endothelial dysfunction most often incites or exacerbates the clinical signs used for diagnostic purposes, but on a cellular and molecular level, the disorder is marked by deficiency of trophoblast invasion, decreased vasodilators, increased vasoconstrictors and inflammatory cytokines, and chronic immune activation (5, 12, 21, 22, 24, 29, 31). Furthermore, it is known that placental ischemia causes the release of several factors that contribute to an increase in cytolytic natural killer (NK) cells and the agonistic angiotensin type 1 (AT1) receptor autoantibody (AT1-AA) (9, 16, 36). This maternal syndrome is associated with increased uterine artery resistance during pregnancy, which can be attributed to increasing vascular resistance caused, in part, by placental ischemia (18, 33).

A rapidly growing area of investigation into the pathophysiology of PE involves the immune mechanisms required for normal pregnancies and the alterations in those mechanisms complicated by the spectrum of hypertensive disorders. The normal cellular milieu of pregnancy involves pro- and anti-inflammatory components (11, 12, 18, 21, 22, 24, 28, 29, 35). During PE, there is evidence of an increase in inflammatory CD4+ T cells and inflammatory cytokines, such as tumor necrosis factor-α (TNF-α) and interleukin (IL)-6 (IL-6), while immunosuppressive cytokines, such as IL-4, which should regulate and control inflammation, are decreased, resulting in hypertension and other clinical complications associated with PE (2, 5, 12, 18, 21, 28, 34, 35).

In our laboratory we use the reduced uterine perfusion pressure (RUPP) model to examine factors stimulated in response to placental ischemia that may be involved in hypertension and endothelial dysfunction. Previously, we showed that the uterine artery resistance index (UARI) is elevated in response to placental ischemia in RUPP compared with normal pregnant (NP) rats (1, 33). Furthermore, similar to women with PE, RUPP rats exhibit hypertension, inflammation, and increased cytolytic NK cells, AT1-AA, and UARI. Importantly, we previously reported that NP rats treated with inflammatory cytokines (TNF-α or IL-6) or AT1-AA develop hypertension and other signs of PE, indicating their importance in the pathology of this disease (1, 19, 23).

Although this imbalance and improper function of immune cells are known to exist during PE, the exact role of these cells and cytokines during this disease remains unknown. PE is strongly associated with a T-helper (Th) type 1 (Th1)-Th2 cell imbalance (30). IL-4 induces proliferation of naïve T cells into Th2 cells, which would then secrete more IL-4 and bolster communication with Th1 and Th2 cells (9). RUPP in pregnant rats stimulates a similar Th1-Th2 imbalance (2a, 13). Therefore, this study was performed to test the hypothesis that IL-4 supplementation would stimulate Th2 cells in RUPP rats and, thereby, improve inflammatory cytokines and other mechanisms to lower blood pressure and improve the pathophysiology in response to placental ischemia during pregnancy. Knowledge gained from such basic science studies could lead to improvements in treatment strategies that target inflammatory mediators that play an important role in the pathophysiology of this pregnancy disorder and could contribute to better management of PE.

MATERIALS AND METHODS

Pregnant Sprague-Dawley rats (Harlan Sprague Dawley, Indianapolis, IN) were housed in a temperature-controlled (23°C) room with a 12:12-h light-dark cycle and free access to standard rat chow and water. All experimental procedures were carried out in accordance with the National Institutes of Health guidelines for use and care of animals. All protocols were approved by the Institutional Animal Care and Use Committee at the University of Mississippi Medical Center.

Reduction in uterine perfusion pressure.

Surgical procedures were carried out under appropriate anesthesia, and analgesics were given postoperatively as needed. Pregnant rats at gestational day 14 (~200–250 g body wt) were randomly assigned to RUPP or NP (control) groups. To achieve RUPP, rats were anesthetized, and a constrictive silver clip (0.203 mm) was placed on the aorta superior to the iliac bifurcation, while ovarian collateral circulation to the uterus was reduced with restrictive clips (0.100 mm) to the bilateral uterine arcades at the ovarian end, as previously reported (13, 20).

Administration of IL-4.

IL-4 (600 ng/day) was administered via osmotic minipump inserted intraperitoneally on gestational day 14 into NP and RUPP rats immediately following the RUPP procedure. Intraperitoneal administration allows for continuous and constant delivery of IL-4 throughout the study period. The dose was based on the lower end of ED50 (0.025 ng/ml) for cellular proliferation in vitro.

Measurement of UARI.

Power Doppler velocimetry measurements of the uterine artery were performed at an imaging station with a Vevo 770 imaging system (VisualSonics) using a 30-Hz transducer and an insonating angle of <30°. Peak systolic flow velocity (PSV) and end-diastolic flow velocity (EDV) were recorded using the uterine artery Doppler waveform, and UARI was calculated as follows: UARI = (PSV − EDV)/PSV (33).

Measurement of mean arterial pressure.

On gestational day 18, the animals were anesthetized with isoflurane, and carotid arterial catheters were inserted for blood pressure measurements, which were analyzed on gestational day 19 with a pressure transducer (Cobe III, CDX Sema) and recorded continuously for 45 min after a 30-min stabilization period (12, 16, 21, 22). Subsequently, blood and urine samples were collected, placentas were harvested, and pup weights were obtained.

Determination of cytokine production.

Plasma collected from pregnant rats in each group on gestational day 19 was assessed for TNF-α and IL-6 concentrations using commercial ELISA kits (Quantikine, R & D Systems). The minimal detectable level for TNF-α was <5 pg/ml, with inter- and intra-assay variability of 10% and 5.1%, respectively. The minimal detectable dose for the IL-6 ELISA was 0.7 pg/ml, with intra- and interassay precision of 3.1% and 2.7%, respectively.

Determination of circulating nitrate-nitrite.

Circulating nitrate-nitrite was measured in plasma from each of the experimental groups. Levels were determined using a nitrate/nitrite colorimetric assay kit (Cayman Chemical, Ann Arbor, MI) according to the manufacturer’s directions. Intra- and interassay precision was 2.7% and 3.4%, respectively.

Determination of placental preproendothelin-1 expression.

Real-time polymerase chain reaction [quantitative RT-PCR (qRT-PCR)] was used to determine placental preproendothelin-1 (PPET-1) levels. Placentas were quickly removed from storage at −80°C, and a ∼30-mg piece of tissue was cut from the whole placenta. The tissue was homogenized in the lysis buffer provided with the RNeasy Protect Mini Kit (Qiagen), and total RNA was extracted from the homogenized tissues according to the manufacturer’s instructions. A spectrophotometer (BioPhotometer, Eppendorf) was used to verify concentration and quality of the isolated RNA. The iScript cDNA synthesis kit (Bio-Rad) was used to synthesize cDNA from 1 μg of RNA. qRT-PCR was performed using iQ SYBR green supermix (Bio-Rad) and the CFX96 Touch real-time PCR detection system (Bio-Rad).The following primer sequences (Life Technologies) were used for PPET: CTAGGTCTAAGCGATCCTTG (forward 1) and TCTTTGTCTGCTTGGC (reverse 1). Levels of mRNA were calculated using the mathematical formula 2−ΔΔCt [2avg Ct(gene of interest) − avg Ct(β-actin), where CT is cycle threshold), recommended by Applied Biosystems (User Bulletin No. 2, 1997).

Determination of AT1-AA production.

Serum was analyzed for AT1-AA by cardiomyocyte assay. Antibodies were detected by the chronotropic responses to AT1 receptor-mediated stimulation of cultured neonatal rat cardiomyocytes coupled with receptor-specific antagonists, as previously described (19, 25). Chronotropic responses were measured and are expressed in beats per minute.

Determination of circulating B cells by flow cytometry.

Circulating B cells isolated on gestational day 19 from all groups were quantified by flow cytometry. Peripheral blood mononuclear cells (PBMCs) were isolated by centrifugation on a cushion of Ficoll-Hypaque (Lymphoprep, Accurate Chemical & Scientific, Westbury, NY) according to the manufacturer’s instructions. For flow cytometric analysis, 1 × 106 cells were incubated for 10 min at 4°C with antibodies against rat CD45R-fluorescein isothiocyanate (FITC) (BD PharMingen) and CD68-phycoerythrin (PE) and CD3-allophycocyanin (APC) (Miltenyi Biotec, San Diego, CA). The fluorescence-minus-one protocol was used to properly interpret flow cytometry data. Subsequently, cells were washed and fixed in fluorescein-activated cell-sorting (FACS) buffer. Flow cytometry was performed using a MACSQuant analyzer (Miltenyi Biotec).

Determination of placental NK cell populations by flow cytometry.

The placental populations of NK cells isolated on gestational day 19 from all groups were quantified by flow cytometry. At the time of harvest, placentas were collected and filtered through a 70-μm-mesh cell strainer. Placental lymphocytes were isolated by centrifugation on a cushion of Ficoll-Hypaque (Lymphoprep, Accurate Chemical & Scientific) according to the manufacturer’s instructions. For flow cytometric analysis, 1 × 106 cells were incubated for 10 min at 4°C with antibodies against rat NK cell activation structures (ANK61) or rat NK cell antibody (ANK44) (Abcam, Cambridge, MA) in different tubes. ANK61 binds to the killer cell activation structure that is expressed on all NK cells, while ANK44 is expressed only on stimulated, cytotoxic NK cells (10). After the cells were washed, they were labeled with secondary FITC (Abcam) antibody for 10 min at 4°C. As a negative control for each individual rat, cells were treated exactly as described above, except they were incubated with isotype control antibodies conjugated to FITC alone. Subsequently, cells were washed, fixed in FACS buffer, and analyzed for single staining by flow cytometry using MACSQuantify (Miltenyi Biotec).

Lymphocytes were gated in the forward- and side-scatter plot. Gates were set using fluorescence-minus-one isotype controls. ANK61+ cells were designated NK cells, and ANK44+ cells were designated cytotoxic NK cells. The percentage of positive-stained cells above the negative control was collected for individual rats, and the mean values for each experimental group were calculated (9).

Determination of circulating and placental Th2 cells by flow cytometry.

The circulating and placental populations of Th2 cells were quantified by flow cytometry from PBMCs and placenta isolated on gestational day 19 from all groups. PBMCs and placenta were isolated by centrifugation on a cushion of Ficoll-Hypaque (Lymphoprep, Accurate Chemical & Scientific) according to the manufacturer’s instructions. For flow cytometric analysis, 1 × 106 cells were incubated for 30 min at 4°C with antibodies against rat CD4 and rat CD25 (BD Biosciences, San Jose, CA). After they were washed, the cells were labeled with secondary FITC (Southern Biotech, Birmingham, AL) and PE with cyanin-5 (PE-Cy5; Santa Cruz Biotechnology, Santa Cruz, CA) antibody for 30 min at 4°C. Cells were washed, permeabilized, and stained with rabbit polyclonal GATA3 conjugated to APC (R & D Biosystems, Minneapolis, MN) for 30 min at 4°C. As a negative control for each individual rat, cells were treated exactly as described above, except they were incubated with anti-FITC, anti-PE-Cy4, and anti-APC secondary antibodies alone. Subsequently, cells were washed and suspended in 500 µl of Roswell Park Memorial Institute medium or GATA3-specific buffer and analyzed for single and double staining on a flow cytometer (MACSQuant). The percentage of positive-staining cells above the negative control was collected for each individual rat for Th2 cells, and mean values for each experimental group were calculated.

Statistical analysis.

Values are means ± SE. Comparisons of control with experimental groups were analyzed by one-way ANOVA, with Bonferroni’s multiple-comparisons test for post hoc analysis. P < 0.05 was considered statistically significant.

RESULTS

IL-4 supplementation blunted hypertension and improved UARI in RUPP rats.

Mean arterial blood pressure (MAP) in response to placental ischemia was higher in RUPP than NP rats. MAP was 97 ± 2 mmHg in NP (n = 9), 101 ± 3 mmHg in NP + IL-4 (n = 14), and 127 ± 4 mmHg in RUPP (n = 8) rats and improved to 108 ± 2 mmHg in RUPP + IL-4 rats (n = 17) (P < 0.05; Fig. 1A). Placenta and pup weights were decreased in RUPP rats and were unchanged with IL-4 supplementation (Fig. 1, B and C).

Fig. 1.

Fig. 1.

Open in a new tab

A: Interleukin-4 (IL-4) supplementation blunts hypertension in the reduced uterine perfusion pressure (RUPP) rat model. NP, normal pregnant. B and C: IL-4 supplementation does not affect placenta (B) and pup (C) weights. Values are means ± SE (n = 8–17/group). *P < 0.05 vs. NP. #P < 0.05 vs. RUPP.

UARI was increased in response to placental ischemia during pregnancy and improved with IL-4 supplementation. UARI was 0.5 ± 0.03 in NP (n = 5) and 0.8 in RUPP (n = 4) rats and normalized to 0.5 in RUPP + IL-4 rats (n = 5) (P < 0.05; Fig. 2). Because no changes were observed in MAP or fetal weight, UARI was not measured in NP + IL-4 rats.

Fig. 2.

Fig. 2.

Open in a new tab

Interleukin-4 (IL-4) supplementation improves uterine arterial resistance index (UARI) in rats with reduced uterine perfusion pressure (RUPP). NP, normal pregnant. Values are means ± SE (n = 4–5/group). *P < 0.05 vs. NP. #P < 0.05 vs. RUPP.

IL-4 supplementation decreased cytokine production in RUPP rats.

As we previously reported, circulating TNF-α and IL-6 levels were higher in RUPP than NP rats (18, 21). Plasma levels of TNF-α and IL-6 were 25 ± 6 and 29 ± 3 pg/ml, respectively, in NP rats (n = 5–8/group) and 116 ± 30 and 224 ± 62 pg/ml, respectively, in RUPP rats (n = 9–10/group), all of which decreased to 23 ± 5 and 45 ± 9 pg/ml, respectively, in RUPP + IL-4 rats (n = 5–7/group) (P < 0.05; Fig. 3). Because we observed no changes in MAP or fetal weight between NP and NP + IL-4 groups, cytokines were not measured in NP + IL-4 rats.

Fig. 3.

Fig. 3.

Open in a new tab

Interleukin-4 (IL-4) supplementation decreases cytokine [tumor necrosis factor-α (TNF-α) (A) and IL-6 (B)] production in rats with reduced uterine perfusion pressure (RUPP). NP, normal pregnant. Values are means ± SE (n = 6–8/group). *P < 0.05 vs. NP. #P < 0.05 vs. RUPP.

IL-4 supplementation increased plasma nitrate-nitrite levels.

Plasma nitrate-nitrite levels were 19 ± 3 μM in NP, 25 ± 3 μM in NP + IL-4, and 8 ± 1 μM in RUPP rats and significantly improved to 18 ± 4 μM in RUPP + IL-4 rats (n = 4) (P < 0.05; Fig. 4A).

Fig. 4.

Fig. 4.

Open in a new tab

Interleukin-4 (IL-4) supplementation increases plasma nitrate-nitrite levels (A) and reduces placental preproendothelin-1 (PPET-1) expression (B). NP, normal pregnant. Values are means ± SE (n = 3–4/group). *P < 0.05 vs. NP. #P < 0.05 vs. RUPP.

IL-4 supplementation reduced placental PPET-1 expression.

Placental PPET-1 expression (Fig. 4B) was significantly increased 2.4 ± 0.37 fold in RUPP (n = 4) compared with NP (n = 3) rats (P < 0.05). IL-4 administration significantly decreased PPET-1 expression in RUPP rats to levels measured in NP rats (RUPP + IL-4 = 1.0 ± 0.19, n = 3, P < 0.05 vs. RUPP).

IL-4 supplementation reduced circulating B cells and AT1-AA production.

Circulating B cells were 2.5 ± 0.3 in NP (n = 3), 7.5 ± 2 in RUPP (n = 4), and 1.4 ± 0.5 in RUPP + IL-4 (n = 3) rats (Fig. 5A). As we previously reported, circulating levels of AT1-AA were higher in RUPP rats (20). Circulating levels of AT1-AA were 1.0 ± 0.3 beats/min in NP (n = 8), 0.3 ± 0.2 beats/min in NP + IL-4 (n = 7), and 18 ± 0.3 beats/min in RUPP (n = 8) rats. IL-4 supplementation significantly blunted AT1-AA to 4 ± 1.0 beats/min in RUPP + IL-4 rats (n = 14, P < 0.05; Fig. 5B).

Fig. 5.

Fig. 5.

Open in a new tab

Interleukin-4 (IL-4) supplementation reduces circulating B cells (n = 3–5/group; A) and angiotensin type 1 receptor autoantibody (AT1-AA, beats/min, n = 5–14/group; B) in rats with reduced uterine perfusion pressure (RUPP). NP, normal pregnant. Values are means ± SE. *P < 0.05 vs. NP. #P < 0.05 vs. RUPP. ##P < 0.05 vs. NP + IL-4. *#P < 0.05 vs. RUPP + IL-4.

IL-4 supplementation increased circulating and placental Th2 cells and attenuated placental cytolytic NK cells.

Circulating Th2 cells were 17 ± 3% gated in NP (n = 3), 9.0 ± 2.0% gated in RUPP (n = 5), and 13 ± 3% gated in RUPP + IL-4 (n = 9) rats (Fig. 6A). Similarly, placental Th2 cells were elevated after IL-4 supplementation, but neither value was significantly different from RUPP rats (Fig. 6B). Total placental NK cells were 0.7 ± 0.1% gated in NP (n = 4) and 5.0 ± 2% gated in RUPP (n = 3) rats and significantly decreased to 1.6 ± 4% gated in RUPP ± IL-4 rats (n = 7) (P < 0.05; Fig. 6C). Placental cytolytic NK cells (ANK44) were 1.0 ± 0.5% gated in NP (n = 6) and 0.9 ± 0.3% gated in NP + IL-4 (n = 7) rats and increased to 6.0 ± 2.0% in RUPP rats (n = 3) but were significantly reduced to 2 ± 0.7% gated in RUPP + IL-4 rats (n = 5) (P < 0.05; Fig. 6D).

Fig. 6.

Fig. 6.

Open in a new tab

Interleukin-4 (IL-4) supplementation increases placental and circulating T helper type 2 (Th2) cells (A and B) and decreases total and placental cytolytic natural killer (NK) cells (C and D) in rats with reduced uterine perfusion pressure (RUPP). NP, normal pregnant. Values are means ± SE (n = 3–9/group). *P < 0.05 vs. NP. #P < 0.05 vs. RUPP.

DISCUSSION

PE is associated with a chronic inflammatory state, allowing long-term elevations in inflammatory cells and cytokines. The purpose of this study was to determine if treatment with IL-4 could shift the immune response in a preclinical rat model of PE by stimulating the Th2 population, thereby, more closely resembling the immune response during a normal pregnancy. The resulting increase in Th2 cells could improve factors, such as TNF-α, IL-6, AT1-AA, and endothelin-1 (ET-1), known to have pathophysiological consequences during PE, by decreasing proinflammatory cells such as Th1 and NK cells. IL-4 is a Th2 cytokine that has pleiotropic effects during an immune response; IL-4 promotes cell proliferation, survival, and acquisition of the Th2 phenotype from naïve CD4+ T cells. IL-4 is also known to support B cell survival and to cause a switch in immunoglobulin type from IgG to IgM. Various clinical studies indicate lower levels of IL-4 in women with PE than in NP women; thus IL-4 administration has been suggested as a viable treatment option for women with PE (3). Our study echoes these thoughts. In this study we demonstrate that IL-4 supplementation in RUPP rats decreases TNF-α, IL-6, AT1-AA, and ET-1 levels, total and placental cytolytic NK cells, and circulating B cells while improving blood pressure, bioavailable nitric oxide, and UARI and increasing, although not significantly, Th2 cells.

Recently, Chatterjee et al. demonstrated that treatment with IL-4 or IL-10 could prevent the development of PE in pregnant mice and that both could be even more beneficial to the maternal syndrome (4). In mice injected daily with IL-4, IL-10, or both during pregnancy, immune cell subsets were normalized and PE was prevented. IL-4, IL-10, and IL-4 + IL-10 treatments significantly decreased blood pressure and attenuated endothelial dysfunction in PE mice. However, only IL-4 + IL-10 prevented proteinuria and improved fetal demise in PE mice. Additionally, only IL-4 + IL-10 prevented the significant increase in CD3γδ T cells, dendritic cells, and monocytes while preventing placental necrosis in PE mice. Importantly, IL-4 + IL-10 had no detrimental effect.

Anti-inflammatory cytokines such as IL-4 play important roles in a normal, successful pregnancy by providing a balance to the immune system. IL-4 is present at the fetal-maternal interface and is considered an important regulator of fetal-maternal tolerance because of its actions to inhibit proinflammatory cytokines (3). Previous studies have shown low levels of IL-4 in association with elevated NK cells in women who have suffered multiple spontaneous abortions and PE (15, 26). Chatterjee et al. demonstrated altered splenic immune cell subsets, increased levels of proinflammatory cytokines, placental inflammation, hypertension, and endothelial dysfunction in IL-4-deficient mice. Importantly, even greater increases in proinflammatory cytokines, which were associated with endothelial dysfunction and hypertension, were exhibited by pregnant IL-4-deficient mice with induced PE than PE mice. Importantly, IL-4 supplementation improved the pregnancy outcomes while reducing inflammation in a mouse model of PE (4).

In agreement with these studies, our study indicates that IL-4 supplementation significantly improves the pathophysiology of PE in the RUPP rat. Moreover IL-4 also increased the number of circulating and placental Th2 cells while reducing the number of placental total and cytolytic NK cells and circulating B cells. AT1-AA levels are important mediators of hypertension during PE and have been associated with the severity of PE (32). Moreover, we previously demonstrated that infusion of AT1-AA stimulates hypertension, vasoconstriction, and inflammation during pregnancy (19). We previously showed that hypertension associated with placental ischemia results in production of AT1-AA and that B cell depletion or inhibition of AT1-AA binding to the AT1 receptor lowers blood pressure in RUPP rats (7, 19). Importantly, in this study we demonstrated that IL-4 supplementation reduced AT1-AA and circulating B lymphocytes. We surmise either that IL-4 had a direct effect to lower circulating B cells in this study or that greater Th2 population and communication with immune cells led to the reduction of B cells, which resulted in less AT1-AA. Another effect of IL-4 on B cells is to induce a switch from IgG- to IgM-type antibodies. AT1-AA is an IgG molecule. It could be that, in this study, the switch from IgG to IgM was induced, leading to less IgG; however, IgM was not determined. Nevertheless, IL-4 decreased B cells and AT1-AA, an important mechanism that contributed to lower blood pressures, which could be further examined in future studies from our laboratory.

Women who develop PE exhibit elevated circulating and placental levels of TNF-α and IL-6 (5, 17). Our previous studies showed that an increase in either of these cytokines causes an increase in blood pressure in NP rats (2, 23). Our findings support previous conclusions that the hypertension associated with placental ischemia during pregnancy results in production of inflammatory cytokines and that reduction of these cytokines can improve hypertension while improving UARI and endothelial function and blood flow to the fetus. Importantly, the increase in Th2 cells in this study was associated with reduced TNF-α and IL-6. This decrease in inflammatory cytokines could have been the source for lower endothelin and improved nitric oxide bioavailability, which could have led to the improved UARI and blood pressure in the RUPP rat. Moreover, we have shown that inhibition of AT1-AA serves as a mechanism for improved nitric oxide bioavailability and ET-1 expression. Together, all these factors could have acted in concert to improve vascular function and blood pressure in response to placental ischemia. Unfortunately, fetal weight was not improved. However, if this was in a clinical setting and the maternal phenotype was improved, the pregnancy would continue, and this would lead to fetal development and an increase in fetal weight over time.

Collectively, these findings advance clinical knowledge by demonstrating the important role of IL-4 signaling among various inflammatory pathways associated with PE. Our data and data from other investigators suggest that IL-4 supplementation blunts inflammatory responses, which leads to improvements in multiple vasoactive pathways acting to ameliorate many features of PE. We reiterate statements from other investigators supporting IL-4 as an important and novel therapeutic to add to the current management of this disease, which could improve pregnancy outcomes in patients with PE.

Perspectives and Significance

Recent studies have demonstrated the beneficial effects of IL-4 in reducing PE-like symptoms in a mouse model of PE. Injections of recombinant IL-4 in mice with PE-like symptoms reduced blood pressure, improved vascular function, and reduced circulating inflammatory cytokines. Collectively, our data suggest an important role for IL-4 supplementation to blunt inflammatory responses, which leads to improvements in many features of PE, and suggest that IL-4 could be a potential therapeutic for managing inflammation while improving uterine endothelial function and hypertension in response to placental ischemia during pregnancy.

GRANTS

This work was supported by the University of Mississippi Medical Center Office of Research and National Institutes of Health Grants R01 HD-067541-06, T32 HL-105324, HL-130456, and P20 GM-121334 (to B. LaMarca and L. M. Amaral).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

B.D.L. conceived and designed research; J.N.C., L.M.A., A.C.H., M.W.C., F.H., and G.W. performed experiments; J.N.C., L.M.A., A.C.H., D.C.C., T.I., F.H., G.W., and B.D.L. analyzed data; J.N.C., L.M.A., A.C.H., D.C.C., and B.D.L. interpreted results of experiments; J.N.C., L.M.A., A.C.H., and T.I. prepared figures; J.N.C., L.M.A., A.C.H., D.C.C., and B.D.L. drafted manuscript; J.N.C., L.M.A., A.C.H., D.C.C., M.W.C., T.I., F.H., G.W., R.D., and B.D.L. edited and revised manuscript; J.N.C., L.M.A., A.C.H., D.C.C., M.W.C., T.I., F.H., G.W., R.D., and B.D.L. approved final version of manuscript.

REFERENCES

  • 1.Amaral LM, Cornelius DC, Harmon A, Moseley J, Martin JN Jr, LaMarca B. 17-Hydroxyprogesterone caproate significantly improves clinical characteristics of preeclampsia in the reduced uterine perfusion pressure rat model. Hypertension 65: 225–231, 2015. doi: 10.1161/HYPERTENSIONAHA.114.04484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Amaral LM, Kiprono L, Cornelius DC, Shoemaker C, Wallace K, Moseley J, Wallukat G, Martin JN Jr, Dechend R, LaMarca B. Progesterone supplementation attenuates hypertension and the autoantibody to the angiotensin II type I receptor in response to elevated interleukin-6 during pregnancy. Am J Obstet Gynecol 211: 158.e1–158.e6, 2014. doi: 10.1016/j.ajog.2014.02.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2a.American College of Obstetricians and Gynecologists; Task Force on Hypertension in Pregnancy Hypertension in pregnancy: Report of the American College of Obstetricians and Gynecologists’ Task Force on Hypertension in Pregnancy. Obstet Gynecol 122: 1122–1131, 2013. doi: 10.1097/01.AOG.0000437382.03963.88. [DOI] [PubMed] [Google Scholar]
  • 3.Chatterjee P, Chiasson VL, Bounds KR, Mitchell BM. Regulation of the anti-inflammatory cytokines interleukin-4 and interleukin-10 during pregnancy. Front Immunol 5: 253, 2014. doi: 10.3389/fimmu.2014.00253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Chatterjee P, Chiasson VL, Seerangan G, Tobin RP, Kopriva SE, Newell-Rogers MK, Mitchell BM. Cotreatment with interleukin 4 and interleukin 10 modulates immune cells and prevents hypertension in pregnant mice. Am J Hypertens 28: 135–142, 2015. doi: 10.1093/ajh/hpu100. [DOI] [PubMed] [Google Scholar]
  • 5.Conrad KP, Benyo DF. Placental cytokines and the pathogenesis of preeclampsia. Am J Reprod Immunol 37: 240–249, 1997. doi: 10.1111/j.1600-0897.1997.tb00222.x. [DOI] [PubMed] [Google Scholar]
  • 6.Creasy RK, Resnik R, Greene MF, Iams JD, Lockwood CJ. Creasy and Resnik’s Maternal-Fetal Medicine: Principles and Practice (7th ed.). Philadelphia, PA: Elsevier, 2014. [Google Scholar]
  • 7.Cunningham MW Jr, Castillo J, Ibrahim T, Cornelius DC, Campbell N, Amaral L, Vaka VR, Usry N, Williams JM, LaMarca B. AT1-AA (angiotensin II type 1 receptor agonistic autoantibody) blockade prevents preeclamptic symptoms in placental ischemic rats. Hypertension 71: 886–893, 2018. doi: 10.1161/HYPERTENSIONAHA.117.10681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Duley L. Maternal mortality associated with hypertensive disorders of pregnancy in Africa, Asia, Latin America and the Caribbean. Br J Obstet Gynaecol 99: 547–553, 1992. doi: 10.1111/j.1471-0528.1992.tb13818.x. [DOI] [PubMed] [Google Scholar]
  • 9.Elfarra J, Amaral LM, McCalmon M, Scott JD, Cunningham MW Jr, Gnam A, Ibrahim T, LaMarca B, Cornelius DC. Natural killer cells mediate pathophysiology in response to reduced uterine perfusion pressure. Clin Sci (Lond) 131: 2753–2762, 2017. doi: 10.1042/CS20171118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Giezeman-Smits KM, Jonges LE, Chambers WH, Brisette-Storkus CS, Van Vlierberghe RL, Van Eendenburg JD, Eggermont AM, Fleuren GJ, Kuppen PJ. Novel monoclonal antibodies against membrane structures that are preferentially expressed on IL-2-activated rat NK cells. J Leukoc Biol 63: 209–215, 1998. doi: 10.1002/jlb.63.2.209. [DOI] [PubMed] [Google Scholar]
  • 11.Gilbert JS, Ryan MJ, LaMarca BB, Sedeek M, Murphy SR, Granger JP. Pathophysiology of hypertension during preeclampsia: linking placental ischemia with endothelial dysfunction. Am J Physiol Heart Circ Physiol 294: H541–H550, 2008. doi: 10.1152/ajpheart.01113.2007. [DOI] [PubMed] [Google Scholar]
  • 12.Granger JP. Inflammatory cytokines, vascular function, and hypertension. Am J Physiol Regul Integr Comp Physiol 286: R989–R990, 2004. doi: 10.1152/ajpregu.00157.2004. [DOI] [PubMed] [Google Scholar]
  • 13.Granger JP, LaMarca BB, Cockrell K, Sedeek M, Balzi C, Chandler D, Bennett W. Reduced uterine perfusion pressure (RUPP) model for studying cardiovascular-renal dysfunction in response to placental ischemia. Methods Mol Med 122: 383–392, 2006. [DOI] [PubMed] [Google Scholar]
  • 15.Hambartsoumian E. Endometrial leukemia inhibitory factor (LIF) as a possible cause of unexplained infertility and multiple failures of implantation. Am J Reprod Immunol 39: 137–143, 1998. doi: 10.1111/j.1600-0897.1998.tb00345.x. [DOI] [PubMed] [Google Scholar]
  • 16.Herse F, LaMarca B. Angiotensin II type 1 receptor autoantibody (AT1-AA)-mediated pregnancy hypertension. Am J Reprod Immunol 69: 413–418, 2013. doi: 10.1111/aji.12072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lam C, Lim KH, Karumanchi SA. Circulating angiogenic factors in the pathogenesis and prediction of preeclampsia. Hypertension 46: 1077–1085, 2005. doi: 10.1161/01.HYP.0000187899.34379.b0. [DOI] [PubMed] [Google Scholar]
  • 18.Lamarca B. The role of immune activation in contributing to vascular dysfunction and the pathophysiology of hypertension during preeclampsia. Minerva Ginecol 62: 105–120, 2010. [PMC free article] [PubMed] [Google Scholar]
  • 19.LaMarca B, Parrish M, Ray LF, Murphy SR, Roberts L, Glover P, Wallukat G, Wenzel K, Cockrell K, Martin JN Jr, Ryan MJ, Dechend R. Hypertension in response to autoantibodies to the angiotensin II type I receptor (AT1-AA) in pregnant rats: role of endothelin-1. Hypertension 54: 905–909, 2009. doi: 10.1161/HYPERTENSIONAHA.109.137935. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.LaMarca B, Wallace K, Herse F, Wallukat G, Martin JN Jr, Weimer A, Dechend R. Hypertension in response to placental ischemia during pregnancy: role of B lymphocytes. Hypertension 57: 865–871, 2011. doi: 10.1161/HYPERTENSIONAHA.110.167569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.LaMarca BD, Ryan MJ, Gilbert JS, Murphy SR, Granger JP. Inflammatory cytokines in the pathophysiology of hypertension during preeclampsia. Curr Hypertens Rep 9: 480–485, 2007. doi: 10.1007/s11906-007-0088-1. [DOI] [PubMed] [Google Scholar]
  • 22.Matsubara K, Matsubara Y, Hyodo S, Katayama T, Ito M. Role of nitric oxide and reactive oxygen species in the pathogenesis of preeclampsia. J Obstet Gynaecol Res 36: 239–247, 2010. doi: 10.1111/j.1447-0756.2009.01128.x. [DOI] [PubMed] [Google Scholar]
  • 23.Murphy SR, LaMarca BB, Parrish M, Cockrell K, Granger JP. Control of soluble fms-like tyrosine-1 (sFlt-1) production response to placental ischemia/hypoxia: role of tumor necrosis factor-α. Am J Physiol Regul Integr Comp Physiol 304: R130–R135, 2013. doi: 10.1152/ajpregu.00069.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Noris M, Perico N, Remuzzi G. Mechanisms of disease: pre-eclampsia. Nat Clin Pract Nephrol 1: 98–114, 2005. doi: 10.1038/ncpneph0035. [DOI] [PubMed] [Google Scholar]
  • 25.Parrish MR, Murphy SR, Rutland S, Wallace K, Wenzel K, Wallukat G, Keiser S, Ray LF, Dechend R, Martin JN, Granger JP, LaMarca B. The effect of immune factors, tumor necrosis factor-α, and agonistic autoantibodies to the angiotensin II type I receptor on soluble fms-like tyrosine-1 and soluble endoglin production in response to hypertension during pregnancy. Am J Hypertens 23: 911–916, 2010. doi: 10.1038/ajh.2010.70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Piccinni MP, Romagnani S. Regulation of fetal allograft survival by a hormone-controlled Th1- and Th2-type cytokines. Immunol Res 15: 141–150, 1996. doi: 10.1007/BF02918503. [DOI] [PubMed] [Google Scholar]
  • 28.Prins JR, Boelens HM, Heimweg J, Van der Heide S, Dubois AE, Van Oosterhout AJ, Erwich JJ. Preeclampsia is associated with lower percentages of regulatory T cells in maternal blood. Hypertens Pregnancy 28: 300–311, 2009. doi: 10.1080/10641950802601237. [DOI] [PubMed] [Google Scholar]
  • 29.Redman CW, Sargent IL. Latest advances in understanding preeclampsia. Science 308: 1592–1594, 2005. doi: 10.1126/science.1111726. [DOI] [PubMed] [Google Scholar]
  • 30.Saito S, Sakai M, Sasaki Y, Tanebe K, Tsuda H, Michimata T. Quantitative analysis of peripheral blood Th0, Th1, Th2 and the Th1:Th2 cell ratio during normal human pregnancy and preeclampsia. Clin Exp Immunol 117: 550–555, 1999. doi: 10.1046/j.1365-2249.1999.00997.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Schlembach D. Pre-eclampsia—still a disease of theories. Fukushima J Med Sci 49: 69–115, 2003. doi: 10.5387/fms.49.69. [DOI] [PubMed] [Google Scholar]
  • 32.Siddiqui AH, Irani RA, Blackwell SC, Ramin SM, Kellems RE, Xia Y. Angiotensin receptor agonistic autoantibody is highly prevalent in preeclampsia: correlation with disease severity. Hypertension 55: 386–393, 2010. doi: 10.1161/HYPERTENSIONAHA.109.140061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Tam Tam KB, George E, Cockrell K, Arany M, Speed J, Martin JN Jr, Lamarca B, Granger JP. Endothelin type A receptor antagonist attenuates placental ischemia-induced hypertension and uterine vascular resistance. Am J Obstet Gynecol 204: 330.e331–330.e334, 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Toldi G, Saito S, Shima T, Halmos A, Veresh Z, Vásárhelyi B, Rigó J Jr, Molvarec A. The frequency of peripheral blood CD4+CD25high FoxP3+ and CD4+CD25−FoxP3+ regulatory T cells in normal pregnancy and pre-eclampsia. Am J Reprod Immunol 68: 175–180, 2012. doi: 10.1111/j.1600-0897.2012.01145.x. [DOI] [PubMed] [Google Scholar]
  • 35.Toldi G, Svec P, Vásárhelyi B, Mészáros G, Rigó J, Tulassay T, Treszl A. Decreased number of FoxP3+ regulatory T cells in preeclampsia. Acta Obstet Gynecol Scand 87: 1229–1233, 2008. doi: 10.1080/00016340802389470. [DOI] [PubMed] [Google Scholar]
  • 36.Wallukat G, Homuth V, Fischer T, Lindschau C, Horstkamp B, Jüpner A, Baur E, Nissen E, Vetter K, Neichel D, Dudenhausen JW, Haller H, Luft FC. Patients with preeclampsia develop agonistic autoantibodies against the angiotensin AT1 receptor. J Clin Invest 103: 945–952, 1999. doi: 10.1172/JCI4106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.World Health Organization The World Health Report: Report of the Director-General. Geneva: World Health Organization, 1995. [Google Scholar]

Articles from American Journal of Physiology - Regulatory, Integrative and Comparative Physiology are provided here courtesy of American Physiological Society

RESOURCES