Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Mar 15.
Published in final edited form as: J Immunol. 2019 Feb 6;202(6):1669–1673. doi: 10.4049/jimmunol.1800852

Core Binding Factor β is Required for Group 2 Innate Lymphoid Cell Activation

Xiaofei Shen *,1, Mingwei Liang *,1, Xiangyu Chen *,1, Muhammad Asghar Pasha †, Shanti S D’Souza *, Kelsi Hidde *, Jennifer Howard *, Dil Afroz Sultana *, Ivan Ting Hin Fung *, Longyun Ye *, Jiexue Pan *, Gang Liu *, James R Drake *, Lisa A Drake *, Jinfang Zhu ‡, Avinash Bhandoola ||, Qi Yang *
PMCID: PMC6401280  NIHMSID: NIHMS1519716  PMID: 30728212

Abstract

Group-2 innate lymphoid cells (ILC2) are tissue-resident, long-lived innate effector cells implicated in allergy and asthma. Upon activation, mature ILC2 rapidly secret large amounts of type-2 cytokines and other effector molecules. The molecular pathways that drive ILC2 activation are not well understood. Here we report that the transcriptional controller Core-binding factor β (CBFβ) is required for ILC2 activation. Deletion or inhibition of CBFβ did not impair the maintenance of ILC2 at homeostasis, but abolished ILC2 activation during allergic airway inflammation. Treatment with CBFβ inhibitors prevented ILC2-mediated airway hyperresponsiveness in a mouse model of acute Alternaria allergen inhalation. CBFβ promoted expression of key ILC2 genes at both transcriptional and translational levels. CBF transcriptional complex directly bound to Il13 and Vegfa promoters and enhancers, and controlled gene transcription. CBFβ further promoted ribosome biogenesis and enhanced gene translation in activated ILC2. Together, these data establish an essential role for CBFβ in ILC2 activation.

Introduction

Group-2 innate lymphoid cells (ILC2) are long-lived innate effector cells residing at mucosal barriers such as lung and gut. Mature ILC2 functionally and transcriptionally mirror T helper type-2 cells (Th2), but ILC2 lack clonal antigen receptors and can rapidly respond to the epithelial alarmin IL-33 in the absence of antigen stimulus (1). Upon activation, mature ILC2 quickly secrete large amounts of type-2 cytokines IL-5 and IL-13, as well as other effector molecules such as VEGFA (1, 2). Activated ILC2 are potent inducers of airway hyperresponsiveness (AHR) and are implicated in allergic asthma and asthma exacerbation. The molecular pathways that drive ILC2 activation, however, are not well understood.

Core binding factor β (CBFβ) is a non-DNA binding subunit that binds with the RUNX proteins to form different CBF transcriptional complexes. CBFs are critical for early lymphocyte development. CBFβ is required for the generation of thymic T cell progenitors, bone marrow B cell precursors and early innate lymphoid progenitors (EILP) (3–7). CBFs are dispensable for the maintenance of mature T cells, but they control several aspects of T cell differentiation. CBFs are known to repress CD4+ Th2 differentiation (8–10). Deletion of CBFβ or RUNX proteins in T cells de-repressed GATA3 and IL-4 expression in CD4+ T cells, resulting in elevated IgE and airway eosinophil inflammation in mice (8–10). Whether CBFs play a similar role in repressing the function of innate type-2 cytokine producing cells, such as ILC2, remains unknown.

The current study was undertaken to examine the role of CBFβ in the activation and function of mature ILC2. To our surprise, contrary to its suppressive role in Th2 cell differentiation, our data indicate that CBFβ promotes ILC2 activation. Deletion or inhibition of CBFβ abrogated ILC2 activation during allergic airway inflammation, and prevented ILC2-mediated AHR. The requirement of CBFβ in ILC2 function was cell-intrinsic and involved both transcriptional and post-transcriptional gene regulatory mechanisms. These data establish a critical role for CBFβ in ILC2 activation and function. The positive regulation of ILC2 function by CBFβ is in contrast with the suppressive role of CBFβ in CD4+ Th2 cell differentiation (8, 9). Our data thus indicate that adaptive and innate type-2 immune responses are controlled by divergent molecular mechanisms. Such divergence in molecular control might help explain the extreme heterogeneity and complexity of human diseases, and necessitates consideration of personalized medicine based on the specific immune responses involved.

Materials and Methods

Mice

CBFβf/f (Cbfbtm2.1Ddg/J, Line 028550), Id2CreERt2(B6.129S(Cg)-Id2tm1.1(cre/ERT2)Blh/ZhuJ Line 016222), and Rosa26Ryfp (B6.129X1-Gt(ROSA)26Sortm1(EYFP)Cos/J, Line 006148) mice were obtained from the JAX laboratory (11). CBFβf/f Id2CreERt2 Rosa26Ryfp and control Id2CreERt2 Rosa26Ryfp mice were bred at the Albany Medical College (AMC) Animal Research Facility. Balb/c mice were purchased from Taconic Biosciences.

For deletion of CBFβ in ILC2, five doses of 5mg tamoxifen were administrated intraperitoneally every other day. 28 days after the first tamoxifen treatment, mice were administrated with a single dose of IL-33 (400ng, Biolegend) intraperitoneally. Balb/c mice received a single dose of intranasal administration of Alternaria extracts (100ug, Greer) as described (2). CBFβ inhibitor Ro5–3335 (50mg/kg, EMD) was administered intraperitoneally 24hr before Alternaria challenge. AHR was measured 12 hours after Alternaria challenge by a FlexiVent system (SCIREQ). All mice experiments were approved by the AMC Institutional Animal Care and Use Committee.

ILC2 culture, in vitro Th2 differentiation, and 4-hydroxytamoxifen (4-OHT) treatment

Sorted lung ILC2 or ILC2 line were cultured with 10ng/ml IL-2, IL-7 and IL-33 for 5 days. 100nM 4-OHT (Sigma) was added to primary lung ILC2 culture at day 6. Cells were cultured for 9 more days in the presence of 4-OHT. Cytokine production of YFP+ cells were examined by intracellular staining and flow cytometry analysis. In some experiments, YFP+ cells were sorted after 5 days of culture with 4-OHT, and cultured for another 4 days in the presence of 4-OHT. Growth rate of YFP+ cells were measured as the inverse of doubling time. In vitro Th2 differentiation was performed as described (12).

Flow cytometry analysis

Antibodies were purchased from eBioscience, Biolegend, or MD bioscience. Flow cytometric analysis was performed on FACSCanto (BD Biosciences). Flow cytometry cell sorting was performed on a FACSAria II (BD Biosciences).

Examination of gene transcription and translation

mRNA was extracted by Qiagen RNeasy kits. Gene expression was examined by QPCR. Microarray analysis was performed at Boston University Microarray and Sequencing Resource (Accession number: GSE116062, https://www.ncbi.nlm.nih.gov/geo). Gene enrichment analyses were provided by Boston University Clinical & Translational Science Institute translational bioinformatics consultation service (CTSA GRANT U54-TR001012).

Sucrose gradients were performed to examine gene translation. Specifically, cells were treated with 100 μg/ml cycloheximide (Sigma) for 10 mins, and lysed on ice. Cell lysates were layered onto 10%−50% sucrose gradients, and centrifuged in an SW41 Ti rotor at 35,000 rpm for 2 hrs. 60 fractions were carefully collected. OD260 absorption for each fraction was recorded. Unassociated RNA (pooled from fractions 1–9) and polysome-associated RNA (pooled from fractions 41–59) were extracted and examined by QPCR. Translation was determined by the ratio of polysome-associated RNA versus unassociated RNA, and normalized to Gapdh.

Chromatin Immunoprecipitation (CHIP), and CRISPR-mediate gene knockout

ILC2 cell line was described previously (13). Specifically, an immortalized cell line was established with small intestinal lamina propria ILC2 by selection of spontaneous mutants. The ILC2 line cells have been maintained with IL-2 and IL-33, and therefore they phenotypically and functionally resemble activated primary ILC2. CHIP was performed as we previously described (13). LentiCRISPRv2GFP was a gift from David Feldser (Addgene plasmid # 82416). gRNA encoding sequences were cloned into LentiCRISPRv2GFP vectors to achieve gene knockout effects as described (14). Two gRNA sequences targeting Cbfb achieved effective knockout effects. The gRNA (CGATCTCCGAGCGACCGTCG) was used throughout this study, but major findings were verified using the other gRNA (ACCGCCTCACCTCGCACTCG) with similar results. Non-target control (NTC, TGCGAATACGCCCACGCGATGGG) was used to generate control CRISPR constructs. Lentiviral transduction of ILC2 was performed as described (15). Gene knockout effects were verified by western blotting.

Statistical analysis

Data are shown as mean ± SD. Unpaired t-test was used to compare the difference of two groups.

Result and Discussion

CBFβ is required for ILC2 activation in vivo

To examine the role of CBFβ in mature ILC2 maintenance and function, we generated CBFβf/f Id2CreERt2 Rosa26Ryfp (CBFβf/f) and control Id2CreERt2 Rosa26Ryfp (CBFβ+/+) mice. Because mature ILC2 express high amounts of Id2, tamoxifen administration results in deletion of Cbfb in ILC2 of CBFβf/f mice. The deletion efficiency is indicated by expression of YFP. Comparable numbers of YFP+ ILC2 appeared in CBFβf/f and control CBFβ+/+ mice 4 weeks after tamoxifen treatment, indicating that the loss of CBFβ did not affect the survival and maintenance of ILC2 at homeostasis (Fig. 1A–C). QPCR verified effective deletion of Cbfb in YFP+ ILC2 of CBFβf/f mice (Fig. 1D).

Figure 1. CBFβ is required for ILC2 activation in vivo.

Figure 1.

A, Gating strategy to identify lung ILC2. B, Representative profiles of YFP+ ILC2 in the lungs of tamoxifen-treated CBFβf/f Id2CreERt2 Rosa26Ryfp (CBFβf/f) and control Id2CreERt2 Rosa26Ryfp (CBFβ+/+) mice. C, Numbers of YFP+ ILC2 in the lungs. D, YFP+ or YFP− ILC2 in the lungs of tamoxifen-treated mice were sorted by flow cytometry cell sorting. mRNA levels of Cbfb was examined using primers that targeted the deleted exons. E, Mice were administrated with a single dose of IL-33 or PBS. Expression of IL-13 and IL-5 was examined by intracellular staining at 12 hours after IL-33 or PBS administration. F, Percentages of IL-13+ or IL-5+ ILC2 after PBS or IL-33 administration. G, Histograms comparing the expression of IL-5 and IL-13 in YFP+ ILC2. H, Balb/c mice received intraperitoneal injection of CBFβ inhibitor Ro5–3335 or vehicle (DMSO) followed by intranasal administration of Alternaria extracts or PBS. Numbers of bronchoalveolar lavage cells in mice were shown. I, Airway hyperresponsiveness was examined by FlexiVent analysis. Data are from three independent experiments. *P<0.05, **P<0.01, n.s., not significant.

To examine whether CBFβ regulates ILC2 function, we activated ILC2 in vivo by treating mice with IL-33. A single dose of IL-33 induced production of IL-5 and IL-13 in mature lung ILC2 within 12 hours (Fig. 1E–G). CBFβ deficient ILC2, however, failed to efficiently produce IL-5 or IL-13 in vivo (Fig. 1E–G). Thus, CBFβ is required for ILC2 activation in vivo.

To confirm the relevance of CBFβ-mediated ILC2 activation, we used a model of acute Alternaria allergen inhalation. Alternaria alternata is a fungal allergen that triggers acute and severe asthma attacks. As described (2, 16), a single dose of Alternaria inhalation rapidly upregulated IL-5 and IL-13 expression in lung ILC2 within 12 hours (Supplemental Fig. 1). CD4+ Th2 cells were not activated at this time point (2). Treatment with CBFβ inhibitor (Ro5–3335) reduced production of IL-5 and IL-13 from ILC2 (Supplemental Fig. 1). Alternaria inhalation rapidly induced airway eosinophil and neutrophil infiltration that was prevented by Ro5–3335 (Fig. 1H). Acute Alternaria inhalation also rapidly elicited strong AHR that was suppressed by Ro5–3335 (Fig. 1I). Together, CBFβ inhibition repressed ILC2 activation in response to acute Alternaria allergen inhalation and prevented ILC2-mediated AHR.

Cell intrinsic CBFβ is required for ILC2 activation

We sought to understand whether CBFβ controls ILC2 activation through cell-intrinsic mechanisms. We cultured highly-purified lung ILC2 from CBFβf/f or control CBFβ+/+ mice in the presence of IL-7, IL-2, IL-33 and 4-OHT. Induction of CRE expression by 4-OHT resulted in the appearance of YFP+ cells in both CBFβf/f and control CBFβ+/+ ILC2 cultures. However, CBFβ deficient ILC2 (YFP+ CBFβf/f) proliferated at a much lower rate than control ILC2 (YFP+ CBFβ+/+) (Fig. 2A). CBFβ deficient ILC2 also failed to efficiently produce IL-13 or IL-5 in response to IL-33 (Fig. 2B–C). Thus, cell intrinsic CBFβ is required for ILC2 activation. Similar results have been obtained with CRISPR technique-mediated knockout of CBFβ in an ILC2 cell line, verifying an essential cell intrinsic role for CBFβ in ILC2 activation (Supplemental Fig. 2A–D).

Figure 2. Cell intrinsic CBFβ is essential for ILC2 cytokine production.

Figure 2.

A, Sort purified ILC2 from CBFβf/f Id2CreERt2 Rosa26Ryfp (CBFβf/f) and control Id2CreERt2 Rosa26Ryfp (CBFβ+/+) mice were cultured with IL-33, IL-2, IL-7 and 4-OHT. YFP+ cells were sorted after 5 days of 4-OHT treatment, and cultured for another 4 days. Growth rates were calculated as the inverse of doubling time (day−1). B, Cultured cells were re-stimulated with fresh IL-33 (10ng/ml) for 2.5 hours in the presence of Monensin. IL-13 and IL-5 expression from YFP+ ILC2 were examined by flow cytometry analysis. C, Mean fluorescence intensity (MFI) of IL-13 and IL-5 in YFP+ ILC2 re-stimulated with IL-33. Data are from 3 mice per group. *P<0.05.

CBFβ controls the expression of key ILC2 product genes at both transcriptional and translational levels.

To determine the mechanisms through which CBFβ controls ILC2 activation, we examined gene expression of purified YFP+ ILC2 from the lungs of CBFβf/f and CBFβ+/+ mice that were treated with tamoxifen and challenged with IL-33. GATA3 is a critical transcriptional controller in ILC2. However, deletion of Cbfb did not affect Gata3 mRNA levels in ILC2 in vivo, indicating that CBFs might control ILC2 activation through GATA3-independent mechanisms (Fig. 3A). Interestingly, mRNA expression for Il13 and Vegfa, but not Il5, was reduced in CBFβ deficient ILC2 (Fig. 3A). Conserved CBF binding sites were identified at the −90bp Il13 promoter and the −7.4Kb Vegfa enhancer regions. CHIP indicated that RUNX proteins directly bound to both conserved regulatory regions in ILC2 line cells (Fig. 3B). Thus, CBF transcriptional complex may directly control the transcription of some ILC2 genes.

Figure 3. CBFs directly regulate the transcription of Il13 and Vegfa in ILC2.

Figure 3.

A, YFP+ ILC2 were sort purified from the lungs of CBFβf/f Id2CreERt2 Rosa26Ryfp (CBFβf/f) and control Id2CreERt2 Rosa26Ryfp (CBFβ+/+) mice that were treated with tamoxifen and challenged with IL-33. Gene expression was examined by QPCR analyses. B, Chromatin immunoprecipitation assay was performed with ILC2 cell line. DNA region lacking CBF binding site was used as a negative control. Data are from triplicate samples representative of 3 independent experiments. *P<0.05, n.s., not significant.

Nevertheless, the changes in Il5 and Il13 mRNA were rather moderate when compared to the remarkable decrease in protein expression in CBFβ deficient ILC2 (Fig. 1E). Thus, additional post-transcriptional mechanisms are likely to be involved. We further examined the gene expression of purified CBFβ deficient and control ILC2 from the lungs of tamoxifen-treated mice (Fig. 4A). Interestingly, CBFβ deficient ILC2 had reduced expression of many ribosomal protein genes (Fig. 4A). They included the ribosome structural genes (rpl3, rpl5, rps2, rps15a), p component molecules (pop4, rpp30, and rpp38), and other key molecules involved in ribosome biogenesis and function (riok2, ddx21, rrp1b, rcl1 and nol11). Micro-array analysis with CBFβ knockout and control ILC2 line cells verified that loss of CBFβ expression led to extensive reduction in mRNA expression for genes related to ribosome biogenesis, RNA processing and translation (Fig. 4B). Thus, CBFβ promotes the expression of ribosomal protein genes in activated ILC2.

Figure 4. CBFβ promotes the translation of key genes in ILC2.

Figure 4.

A, YFP+ ILC2 were sort purified from the lungs of CBFβf/f Id2CreERt2 Rosa26Ryfp (CBFβf/f) or control Id2CreERt2 Rosa26Ryfp (CBFβ+/+) mice that were treated with tamoxifen and challenged with IL-33. Gene expression was examined by QPCR analyses with freshly isolated cells. B, ILC2 cell line was transduced with LentiCRISPRv2GFP lentivirus that targeted CBFβ (CBFβ CRISPR) or non-target control (NTC CRISPR). Microarray analyses were performed with sorted GFP+ cells at day 6 post-transduction. Gene set enrichment analyses were performed. C, Sort purified ILC2 from CBFβf/f and CBFβ+/+ mice were cultured in the presence of IL-33, IL-2, IL-7 and 4-OHT. YFP+ cells were sorted after 5 days of 4-OHT treatment and re-cultured with IL-2, IL-7 and IL-33 overnight. Sucrose gradient centrifugation was performed to separate polysome-associated RNA and free RNA. Translational rates of the indicated genes were determined by the ratio of polysome-associated RNA versus free RNA. Data were normalized to Gapdh. D, ILC2 cell line was transduced with the indicated LentiCRISPRv2GFP lentivirus. GFP+ ILC2 were sorted at 10 days post transduction and re-cultured with IL-33 and IL-2 overnight. Sucrose gradient centrifugation was performed, and 60 fractions were carefully collected from the top to the bottom of the centrifuge tubes. Shown is OD260 absorption of each fraction. Data are from three independent experiments. *P<0.05.

To directly examine whether CBFβ promotes gene translation in ILC2, we deleted Cbfb in cultured ILC2 by in vitro 4-OHT treatment and then performed sucrose gradient centrifugation to separate polysome-associated RNA from unassociated RNA (Fig. 4C). We measured the efficiency of gene translation as the ratio of polysome-associated RNA versus unassociated RNA. The translational levels of Il5, Il13 and Vegfa, were all reduced in CBFβ deficient ILC2, indicating that CBFβ is required for optimal gene translation in ILC2 (Fig. 4C). Similar results have been obtained with CBFβ knockout ILC2 line cells (Supplemental Fig. 2 E–F). In contrast, CRISPR-mediated knockout of CBFβ did not affect the translation of Il13 in CD4+ T cells cultured under Th2 polarization condition, indicating that CBFβ was not required for Il13 translation in Th2 cells in vitro (Supplemental Fig. 2 G). We next compared the ribosome profiles of CBFβ knockout and control ILC2 line cells. CBFβ knockout ILC2 had much smaller polysome-associated peaks, indicating defects in ribosome biogenesis and/or function (Fig. 4D). Together, these data indicate that CBFβ promotes ribosome biogenesis and/or function, thus enhancing gene translation during ILC2 activation.

Our study revealed an essential role for CBFβ in ILC2 activation and function. Of note, the positive regulation of ILC2 function by CBFβ is opposite to the repressive role of CBFβ in CD4+ Th2 differentiation (8, 9). Thus, despite striking functional similarity between ILC2 and CD4+ Th2 cells, there are important differences in molecular control between these two closely related lineages. The diametric regulation of innate and adaptive type-2 immunity by CBFβ might help balance the delicate immune responses at mucosal barrier sites. Such complexity in molecular control necessitates the search for new immune response endotypes in complicated human diseases such as asthma and allergy, and dictates the importance of personalized medicine based on the specific immune responses involved.

CBFs appear to play diverse roles in different cell types and at distinct developmental stages. CBFs are required for the generation of EILP, the maintenance of ILC1 and the specification of fetal LTi progenitors (5, 17, 18). However, they are dispensable for the maintenance of ILC2 and ILC3 at homeostasis. In addition, our data indicate that CBFβ promotes ribosome biogenesis and gene translation in mature ILC2. Ribosome biogenesis is also reduced in RUNX1 deficient hematopoietic stem cells (19). However, deficiency of RUNX proteins does not affect the ribosome biogenesis of CD34+flt3+ Multipotent Progenitors, and even results in enhanced rRNA transcription and protein synthesis in mouse calvaria cells (19, 20). Thus, CBFs control the expression of ribosome biogenesis genes through cell type-specific mechanisms. Similarly, CBFs repress the expression of type-2 cytokines in CD4+ T cells, but promote cytokine production in ILC2. The existence of lineage-specific co-activators and co-repressors might help explain the differential and even opposing roles of CBFs in different cell types. Searching for ILC2-s/pecific functional partners of CBFβ might reveal unique lineage specific molecular pathways that control ILC2 activation and function.

Supplementary Material

1

Acknowledgments

This work was supported by the U.S. National Institutes of Health Grants R01HL137813, R01AG057782, K22AI116728 (to Q.Y.), the Alexandrine and Alexander L. Sinsheimer Scholar Award (to Q.Y.), and the NIH Intramural Research Programs of the National Cancer Institute and the Center for Cancer Research (to A.B.), and of the National Institute of Allergy and Infectious Disease (to J.Z.)

Abbreviations used in this article:

ILC2

group 2 innate lymphoid cell

CBFβ

core binding factor β

AHR

airway hyperresponsiveness

CRISPR

clustered regulatory interspaced short palindromic repeats

Reference

  • 1.Artis D, and Spits H. 2015. The biology of innate lymphoid cells. Nature 517: 293–301. [DOI] [PubMed] [Google Scholar]
  • 2.Shen X, Pasha MA, Hidde K, Khan A, Liang M, Guan W, Ding Y, Haczku A, and Yang Q. 2018. Group 2 innate lymphoid cells promote airway hyperresponsiveness through production of VEGFA. J Allergy Clin Immunol 141: 1929–1931 e1924. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Guo Y, Maillard I, Chakraborti S, Rothenberg EV, and Speck NA. 2008. Core binding factors are necessary for natural killer cell development and cooperate with Notch signaling during T-cell specification. Blood 112: 480–492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Growney JD, Shigematsu H, Li Z, Lee BH, Adelsperger J, Rowan R, Curley DP, Kutok JL, Akashi K, Williams IR, Speck NA, and Gilliland DG. 2005. Loss of Runx1 perturbs adult hematopoiesis and is associated with a myeloproliferative phenotype. Blood 106: 494–504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Harly C, Cam M, Kaye J, and Bhandoola A. 2018. Development and differentiation of early innate lymphoid progenitors. J Exp Med 215: 249–262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Talebian L, Li Z, Guo Y, Gaudet J, Speck ME, Sugiyama D, Kaur P, Pear WS, Maillard I, and Speck NA. 2007. T-lymphoid, megakaryocyte, and granulocyte development are sensitive to decreases in CBFbeta dosage. Blood 109: 11–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Seo W, Ikawa T, Kawamoto H, and Taniuchi I. 2012. Runx1-Cbfbeta facilitates early B lymphocyte development by regulating expression of Ebf1. J Exp Med 209: 1255–1262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Naoe Y, Setoguchi R, Akiyama K, Muroi S, Kuroda M, Hatam F, Littman DR, and Taniuchi I. 2007. Repression of interleukin-4 in T helper type 1 cells by Runx/Cbf beta binding to the Il4 silencer. J Exp Med 204: 1749–1755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Komine O, Hayashi K, Natsume W, Watanabe T, Seki Y, Seki N, Yagi R, Sukzuki W, Tamauchi H, Hozumi K, Habu S, Kubo M, and Satake M. 2003. The Runx1 transcription factor inhibits the differentiation of naive CD4+ T cells into the Th2 lineage by repressing GATA3 expression. J Exp Med 198: 51–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Djuretic IM, Levanon D, Negreanu V, Groner Y, Rao A, and Ansel KM. 2007. Transcription factors T-bet and Runx3 cooperate to activate Ifng and silence Il4 in T helper type 1 cells. Nat Immunol 8: 145–153. [DOI] [PubMed] [Google Scholar]
  • 11.Huang S, O’Donovan KJ, Turner EE, Zhong J, and Ginty DD. 2015. Extrinsic and intrinsic signals converge on the Runx1/CBFbeta transcription factor for nonpeptidergic nociceptor maturation. Elife 4: e10874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Fang D, Cui K, Hu G, Gurram RK, Zhong C, Oler AJ, Yagi R, Zhao M, Sharma S, Liu P, Sun B, Zhao K, and Zhu J. 2018. Bcl11b, a novel GATA3-interacting protein, suppresses Th1 while limiting Th2 cell differentiation. J Exp Med 215: 1449–1462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Zhang K, Xu X, Pasha MA, Siebel CW, Costello A, Haczku A, MacNamara K, Liang T, Zhu J, Bhandoola A, Maillard I, and Yang Q. 2017. Cutting Edge: Notch Signaling Promotes the Plasticity of Group-2 Innate Lymphoid Cells. J Immunol 198: 1798–1803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Sanjana NE, Shalem O, and Zhang F. 2014. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods 11: 783–784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Yang Q, Monticelli LA, Saenz SA, Chi AW, Sonnenberg GF, Tang J, De Obaldia ME, Bailis W, Bryson JL, Toscano K, Huang J, Haczku A, Pear WS, Artis D, and Bhandoola A. 2013. T cell factor 1 is required for group 2 innate lymphoid cell generation. Immunity 38: 694–704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Doherty TA, Khorram N, Chang JE, Kim HK, Rosenthal P, Croft M, and Broide DH. 2012. STAT6 regulates natural helper cell proliferation during lung inflammation initiated by Alternaria. Am J Physiol Lung Cell Mol Physiol 303: L577–588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ebihara T, Song C, Ryu SH, Plougastel-Douglas B, Yang L, Levanon D, Groner Y, Bern MD, Stappenbeck TS, Colonna M, Egawa T, and Yokoyama WM. 2015. Runx3 specifies lineage commitment of innate lymphoid cells. Nat Immunol 16: 1124–1133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Tachibana M, Tenno M, Tezuka C, Sugiyama M, Yoshida H, and Taniuchi I. 2011. Runx1/Cbfbeta2 complexes are required for lymphoid tissue inducer cell differentiation at two developmental stages. J Immunol 186: 1450–1457. [DOI] [PubMed] [Google Scholar]
  • 19.Cai X, Gao L, Teng L, Ge J, Oo ZM, Kumar AR, Gilliland DG, Mason PJ, Tan K, and Speck NA. 2015. Runx1 Deficiency Decreases Ribosome Biogenesis and Confers Stress Resistance to Hematopoietic Stem and Progenitor Cells. Cell Stem Cell 17: 165–177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Young DW, Hassan MQ, Pratap J, Galindo M, Zaidi SK, Lee SH, Yang X, Xie R, Javed A, Underwood JM, Furcinitti P, Imbalzano AN, Penman S, Nickerson JA, Montecino MA, Lian JB, Stein JL, van Wijnen AJ, and Stein GS. 2007. Mitotic occupancy and lineage-specific transcriptional control of rRNA genes by Runx2. Nature 445: 442–446. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

RESOURCES