Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2019 Mar 5;93(6):e02203-18. doi: 10.1128/JVI.02203-18

Peroxiredoxin 1, a Novel HBx-Interacting Protein, Interacts with Exosome Component 5 and Negatively Regulates Hepatitis B Virus (HBV) Propagation through Degradation of HBV RNA

Lin Deng a,✉, Xiang Gan b, Masahiko Ito c, Ming Chen d, Hussein H Aly e, Chieko Matsui a, Takayuki Abe a, Koichi Watashi e, Takaji Wakita e, Tetsuro Suzuki c, Toru Okamoto f, Yoshiharu Matsuura f, Masashi Mizokami g, Ikuo Shoji a, Hak Hotta d,h,✉
Editor: Rozanne M Sandri-Goldini
PMCID: PMC6401444  PMID: 30567989

Hepatitis B virus (HBV) infection is a major global health problem. HBx plays important roles in HBV replication and viral carcinogenesis through its interaction with host factors. In this study, we identified Prdx1 as a novel HBx-binding protein. We provide evidence suggesting that Prdx1 promotes HBV RNA decay through interaction with HBV RNA and Exosc5, leading to downregulation of HBV RNA. These results suggest that Prdx1 negatively regulates HBV propagation. Our findings may shed new light on the roles of Prdx1 and Exosc5 in host defense mechanisms in HBV infection.

KEYWORDS: HBx, Prdx1, hepatitis B virus

ABSTRACT

Hepatitis B virus (HBV) infection is a major risk factor for the development of chronic liver diseases, including cirrhosis and hepatocellular carcinoma (HCC). A growing body of evidence suggests that HBV X protein (HBx) plays a crucial role in viral replication and HCC development. Here, we identified peroxiredoxin 1 (Prdx1), a cellular hydrogen peroxide scavenger, as a novel HBx-interacting protein. Coimmunoprecipitation analysis coupled with site-directed mutagenesis revealed that the region from amino acids 17 to 20 of the HBx, particularly HBx Cys17, is responsible for the interaction with Prdx1. Knockdown of Prdx1 by siRNA significantly increased the levels of intracellular HBV RNA, HBV antigens, and extracellular HBV DNA, whereas knockdown of Prdx1 did not increase the activities of HBV core, enhancer I (Enh1)/X, preS1, and preS2/S promoters. Kinetic analysis of HBV RNA showed that knockdown of Prdx1 inhibited HBV RNA decay, suggesting that Prdx1 reduces HBV RNA levels posttranscriptionally. The RNA coimmunoprecipitation assay revealed that Prdx1 interacted with HBV RNA. The exosome component 5 (Exosc5), a member of the RNA exosome complexes, was coimmunoprecipitated with Prdx1, suggesting its role in regulation of HBV RNA stability. Taken together, these results suggest that Prdx1 and Exosc5 play crucial roles in host defense mechanisms against HBV infection.

IMPORTANCE Hepatitis B virus (HBV) infection is a major global health problem. HBx plays important roles in HBV replication and viral carcinogenesis through its interaction with host factors. In this study, we identified Prdx1 as a novel HBx-binding protein. We provide evidence suggesting that Prdx1 promotes HBV RNA decay through interaction with HBV RNA and Exosc5, leading to downregulation of HBV RNA. These results suggest that Prdx1 negatively regulates HBV propagation. Our findings may shed new light on the roles of Prdx1 and Exosc5 in host defense mechanisms in HBV infection.

INTRODUCTION

The human hepatitis B virus (HBV) belongs to the Hepadnaviridae family and has a 3.2-kb circular, partially double-stranded DNA genome. Despite the availability of effective prophylactic vaccines and improvement of therapeutics, HBV infection remains a major public health problem worldwide. Two billion people are estimated to be infected with HBV and more than 350 million are chronic carriers of the virus (1, 2). Chronic HBV infection is a risk factor for severe liver diseases, including cirrhosis and primary hepatocellular carcinoma (HCC) (3).

The HBV X protein (HBx), a 154-amino-acid (aa) polypeptide with a molecular weight of 17 kDa, is a multifunctional viral regulator involved in the viral life cycle and HBV-associated HCC (4). A growing body of evidence suggests that HBx is required for efficient HBV replication (5–9). Studies of HBx transgenic mice have shown that HBx participates in the development of HCC (10–12). A large number of studies have reported the impact of HBx expression on the modulation of apoptotic signaling pathways in various experimental systems. HBx induces (13–15) or inhibits (16, 17) apoptosis in multiple cellular contexts. In addition, HBx regulates numerous cellular signal transduction pathways, including AP-1 (18–20), NF-κB (21, 22), phosphatidylinositol 3-kinase/AKT (23) and the activating transcription factor/cyclic AMP-responsive element binding transcription factor (CREB) (24). Notably, HBx induces activation of the transcription factor NF-E2-related factor 2 (Nrf2)/antioxidant response element signaling pathway (25, 26) against oxidative damage, accompanied by an increase in reactive oxygen species production in hepatocytes expressing HBx (27, 28).

HBx exerts its activities by interacting with a large number of cellular partners, including p53 (29), damaged DNA binding protein 1 (30), protein arginine methyltransferase 1 (31), and jumonji C domain-containing 5 (32). However, the precise mechanisms underlying the interaction of HBx with the host factors in the life cycle of HBV remain unclear. In this study, we identified peroxiredoxin 1 (Prdx1) as a novel HBx-interacting protein by tandem affinity purification coupled with mass spectrometry analysis.

Prdx1 is a member of the peroxiredoxin family of cysteine-dependent peroxidase enzymes, which play dominant roles in regulating peroxide levels in the cells (33). Prdx1 is a multifunctional protein that acts as a hydrogen peroxide scavenger, molecular chaperone, and immune modulator. It is noteworthy that the function of Prdx1 is not restricted to its antioxidant activity; novel roles of Prdx1 have been recognized in inflammation, cancer, and innate immunity (34). Although Prdx1 has been reported to function as a tumor suppressor (35, 36), Prdx1 is overexpressed in HCC patients (37), and Prdx1 promotes tumorigenesis of esophageal squamous cell carcinoma (38) and prostate cancer (39). In addition, Prdx1 binds RNA and acts as an RNA chaperone (40, 41). We previously reported that E6-associated protein mediates the ubiquitin-dependent proteasomal degradation of Prdx1 (42).

In this study, we identified Prdx1 as a novel HBx-interacting protein. We demonstrate that Prdx1 plays roles in the repression of HBV propagation by binding to HBV RNA and accelerating HBV RNA degradation. We propose that Prdx1 negatively regulates HBV propagation to protect the host cells.

RESULTS

Identification of Prdx1 as a novel HBx-interacting protein.

To elucidate a novel role of HBx in HBV replication and HBV-associated pathogenesis, we sought to identify novel HBx-interacting proteins by tandem affinity purification and NanoLC-MS/MS (JBioS, Saitama, Japan). Huh-7.5 cells transfected with pEF1A-HBx(aa 1 to 90)-Myc-His6 plasmid or empty plasmid pEF1A-Myc-His6 were lysed and potential HBx-binding proteins were purified using Myc tag and His6 tag. After elution with imidazole, HBx-associated proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and visualized by silver staining (Fig. 1A). The specific bands were excised and analyzed by NanoLC-MS/MS. A novel HBx-interacting protein, Prdx1, was one of the identified proteins (Table 1). Prdx1 is the multifunctional protein that acts as a hydrogen peroxide scavenger, molecular chaperone, and immune modulator (34).

FIG 1.

FIG 1

Prdx1 is a novel HBx-interacting protein. (A) Identification of Prdx1 as a novel HBx-interacting protein. Huh-7.5 cells were transfected with pEF1A-HBx(aa 1 to 90)-Myc-His6 or an empty plasmid pEF1A-Myc-His6 as a control. Cell lysates were harvested at 48 h posttransfection. HBx-interacting proteins were purified by tandem affinity purification using Myc tag and His6 tag. The purified proteins were subjected to SDS-PAGE and silver staining. The specific bands were excised and analyzed by NanoLC-MS/MS. Arrows indicate Prdx1 and HBx(aa 1 to 90), respectively. (B) Schematic diagram of full-length and deletion mutants of HBx. The black box represents Myc-His6 tag. (C to F) Interaction of HBx proteins with endogenous Prdx1. Huh-7.5 cells were transfected with expression plasmids for each HBx deletion mutant (C and D) or HBx(aa 1 to 90)-alanine substitution mutant (E) or HBc (F). At 48 h posttransfection, cells were harvested, and the cell lysates were immunoprecipitated with anti-Myc tag beads, followed by immunoblotting with anti-Prdx1 antibody (C, D, E, F, upper panels) or anti-c-Myc antibody (C, D, E, and F, lower panels). (G) Sequence alignment of HBx (aa 1 to 30) from all main HBV genotypes (genotypes A to H).

TABLE 1.

Identification of Prdx1 by tandem mass spectrometrya

Residues Sequence
8–16 IGHPAPNFK
17–27 ATAVMPDGQFK
28–35 DISLSDYK
69–92 LNCQVIGASVDSHFCHLAWVNTPK
93–109 KQGGLGPMNIPLVSDPK
111–120 TIAQDYGVLK
129–140 GLFIIDDKGILR
141–151 QITVNDLPVGR
152–158 SVDETLR
159–168 LVQAFQFTDK
a

The protein was peroxiredoxin 1 (Prdx1; GenBank accession no. NP_002565).

Cys17 of HBx was crucial for the interaction with endogenous Prdx1.

To determine a Prdx1-binding site(s) on HBx, coimmunoprecipitation analysis was performed. Huh-7.5 cells were transfected with the full-length HBx expression plasmid pEF1A-HBx-Myc-His6 or a series of HBx mutant plasmids (Fig. 1B). Cell lysates were immunoprecipitated with anti-Myc antibody. Immunoprecipitation analysis revealed that endogenous Prdx1 was coimmunoprecipitated with full-length HBx (Fig. 1C, upper panel, lane 12). Next, coimmunoprecipitation analysis showed that the deletion mutant HBx(aa 21 to 90) failed to coprecipitate with the endogenous Prdx1 (Fig. 1D, upper panel, lane 11), whereas other deletion mutants of HBx maintained the interaction (Fig. 1C, upper panel, lanes 8 to 11; Fig. 1D, upper panel, lanes 8 to 10 and 12). These results suggest that the region from aa 16 to 20 of HBx is involved in the interaction with Prdx1 (Fig. 1B).

To identify the specific aa residues of HBx required for the interaction with Prdx1, alanine-scanning mutagenesis of HBx in the region from aa 16 to 20 was performed (Fig. 1B). The point mutants HBx(aa 1 to 90) C17A, L18A, R19A and P20A markedly reduced the interaction with endogenous Prdx1 (Fig. 1E, upper panel, lanes 10 to 13). These results suggest that the region from aa 17 to 20 of HBx is important for the interaction with Prdx1. The point mutant HBx(aa 1 to 90) C17A failed to interact with Prdx1 (Fig. 1E, upper panel, lane 10). This result suggests that HBx Cys17 is crucial for the interaction with Prdx1. In addition, the immunoprecipitation analysis revealed that endogenous Prdx1 specifically interacted with HBx(aa 1 to 90), but not with HBc protein (Fig. 1F, upper panel, lanes 5 and 6). This result indicates that HBx specifically interacts with Prdx1. Notably, the region from aa 17 to 20 (CLRP) of HBx is highly conserved among all the HBV genotypes (Fig. 1G). These results suggest that HBx-Prdx1 interaction is common to all the HBV genotypes. Interestingly, this region has an amino acid sequence similar to the putative binding motifs CXXC, PXXP, and LXXLL of Prdx1 (43).

HBx was colocalized with Prdx1 predominantly in the cytoplasm.

To examine the subcellular localization of HBx and Prdx1, we performed immunofluorescence staining. Huh-7.5 cells were transfected with pEF1A-HBx-Myc-His6, pCAG-FLAG-Prdx1, or both. When expressed alone, Myc-His6-tagged HBx was localized in both the nucleus and the cytoplasm (Fig. 2, top panel). Cytoplasmic HBx was strongly expressed, showing granular staining (Fig. 2, top panel, HBx-Myc-His6). FLAG-Prdx1 was mainly localized in the cytoplasm (Fig. 2, third panel, FLAG-Prdx1). When HBx-Myc-His6 and FLAG-Prdx1 were coexpressed, the merged yellow signals suggest that HBx-Myc-His6 and FLAG-Prdx1 were predominantly colocalized in the cytoplasm (Fig. 2, fourth panel, merge). In contrast, the HBx(C17A)-Myc-His6 mutant that lacks interaction with Prdx1 was localized only in the nucleus (Fig. 2, second panel, HBx-Myc-His6). We found no colocalization of HBx(C17A)-Myc-His6 with FLAG-Prdx1 (Fig. 2, bottom panel, merge). These results are consistent with the finding that Cys17 of HBx is crucial for the interaction with Prdx1.

FIG 2.

FIG 2

HBx and Prdx1 were predominantly colocalized in the cytoplasm. Huh-7.5 cells were transfected with expression plasmids for HBx-Myc-His6 (top panel), HBx(C17A)-Myc-His6 (second panel), FLAG-Prdx1 (third panel), HBx-Myc-His6 and FLAG-Prdx1 (fourth panel), or HBx(C17A)-Myc-His6 and FLAG-Prdx1 (bottom panel), respectively. At 48 h posttransfection, the cells were stained with anti-c-Myc mouse monoclonal antibody, followed by Alexa Fluor 594-conjugated goat anti-mouse IgG (red) and anti-FLAG rabbit polyclonal antibody, followed by Alexa Fluor 488-conjugated goat anti-rabbit IgG (green). The cells were stained with Hoechst 33342 for the nuclei (blue). These stained cells were examined using a Zeiss LSM700 scanning laser confocal microscope. Scale bar, 20 μm.

Knockdown of Prdx1 increased the levels of HBV RNA.

To examine the effects of the HBx-Prdx1 interaction on HBV transcription, HepG2 cells were transfected with HBV genotype B expression plasmid pUC19-HBV-Bj_JPN56 in the presence or absence of two sets of Prdx1 small interfering RNA (siRNA). HBV transcription was quantified by real-time quantitative reverse transcription-PCR (RT-qPCR) using primers amplifying the HBV pregenomic RNA (pgRNA), as well as the 2.4- and 2.1-kb mRNA, or by Northern blotting. Endogenous Prdx1 expression in HepG2 cells was markedly reduced by Prdx1 siRNA1 or 2 (Fig. 3A, bottom panel, lanes 2 and 3). Knockdown of Prdx1 significantly increased HBV-Bj_JPN56 RNA levels compared to the controls (Fig. 3A, upper panel, lanes 2 and 3; Fig. 3B, upper panel, lane 2).

FIG 3.

FIG 3

Knockdown of Prdx1 increased the amounts of HBV RNA. HepG2 cells were transfected with Prdx1 siRNA1, Prdx1 siRNA2, or control siRNA (40 nM). At 24 h after siRNA transfection, the cells were transfected with pUC19-HBV-Bj_JPN56 (A and B), pUC19-HBV-C-AT_JPN (C), or pUC19-HBV-DIND60 (D). The cells were harvested at 48 h after plasmid transfection. Total RNA was extracted, and HBV RNA was quantitated by RT-qPCR (A, C, and D) or Northern blot analysis (B). Ribosomal RNAs (18S and 28S) were presented as loading controls. Immunoblot analysis revealed the expression of endogenous Prdx1 and GAPDH in transfected cells. The data represent means ± the SEM from three independent experiments, and the value for the control cells was arbitrarily expressed as 1.0. *, P < 0.05, compared to the control.

To determine whether knockdown of Prdx1 affects HBV RNA levels of genotypes C and D, HepG2 cells were transfected with expression plasmids for genotype C HBV-C-AT_JPN or genotype D HBV-DIND60 in the presence or absence of Prdx1 siRNA. Similarly, endogenous Prdx1 expression in HepG2 cells was markedly reduced by either Prdx1 siRNA1 or 2 (Fig. 3C, bottom panel, lanes 2 and 3; Fig. 3D, bottom panel, lane 2). Knockdown of Prdx1 significantly increased RNA levels of HBV-C-AT_JPN and HBV-DIND60 compared to the controls (Fig. 3C, upper panel, lanes 2 and 3; Fig. 3D, upper panel, lane 2), indicating that knockdown of Prdx1 increases the levels of HBV RNA.

Knockdown of Prdx1 increased the level of HBx protein in HBx-expressing cells and HBV antigens in HBV-replicating cells.

To determine the effect of knockdown of Prdx1 on the protein expression levels of HBx, HBV polymerase (Pol), large HBs (LHBs), and HBc, HepG2 cells were transfected with the Myc-His6-tagged HBx, HBV Pol, LHBs, or HBc expression plasmids in the presence or absence of Prdx1 siRNA1. The immunoblot analysis revealed that knockdown of Prdx1 increased the HBx-Myc-His6 level in HBx-expressing cells (Fig. 4A, upper panel, lane 2). In contrast, knockdown of Prdx1 did not show any effect on the protein levels of HBV Pol-Myc-His6 (Fig. 4B, upper panel, lane 2), LHBs-Myc-His6 (Fig. 4C, upper panel, lane 2), and HBc-Myc-His6 (Fig. 4D, upper panel, lane 2).

FIG 4.

FIG 4

Knockdown of Prdx1 increased the level of HBx protein in HBx-expressing cells and HBV antigens in HBV-replicating cells. HepG2 cells were transfected with Prdx1 siRNA1 or control siRNA (40 nM). At 24 h after siRNA transfection, cells were transfected with pEF1A-HBx-Myc-His6 (A), pEF1A-HBV Pol-Myc-His6 (B), pEF1A-LHBs-Myc-His6 (C), pEF1A-HBc-Myc-His6 (D), or pUC19-HBV-Bj_JPN56 or pUC19-HBV-C-AT_JPN (E), followed by incubation for 48 h. The expression levels of Myc-His6-tagged HBx, HBV Pol, LHBs, HBc, and Prdx1 in cell lysates were analyzed by immunoblotting with anti-c-Myc-antibody (A, B, C, and D, top panels) and anti-Prdx1 antibody (A, B, C, and D, second panels), respectively. The expression levels of HBV antigens and Prdx1 in pUC19-HBV-Bj_JPN- or pUC19-HBV-CAT_JPN-transfected cells were analyzed by immunoblotting with anti-HBx antibody (E, top panels), anti-HBs (E, second panels), anti-HBc (E, third panels), and anti-Prdx1 antibody (E, fourth panels), respectively. The level of GAPDH served as a loading control. The level of HBsAg in the culture supernatant of HepG2-expressing HBV-Bj_JPN (F) or HBV-CAT_JPN (G) with or without Prdx1 siRNA (40 nM, 72 h) was measured by ELISA. Data represent means ± the SEM of data from three independent experiments, and the value for the control cells was arbitrarily expressed as 1.0. *, P < 0.05, compared to the control.

To further determine the effects of knockdown of Prdx1 on the protein levels of HBx, HBs and HBc in HBV-replicating cells, HepG2 cells were transfected with pUC19-HBV-Bj_JPN56 or pUC19-HBV-C-AT_JPN in the presence or absence of Prdx1 siRNA1. The immunoblot analysis revealed that knockdown of Prdx1 moderately increased the expression of HBx (Fig. 4E, top panel, lanes 2 and 4), small HBs (SHBs) (Fig. 4E, second panel, lanes 2 and 4), and HBc (Fig. 4E, third panel, lanes 2 and 4) in HBV-Bj_JPN56- and HBV-C-AT_JPN-replicating cells.

In addition, we quantified the levels of extracellular HBsAg by enzyme linked immunosorbent assay (ELISA) in HBV-Bj_JPN56- and HBV-C-AT_JPN-replicating cells in the presence or absence of two sets of Prdx1 siRNA. Consistently, knockdown of Prdx1 significantly increased the amount of HBsAg in the culture medium in HBV-Bj_JPN56- and HBV-C-AT_JPN-replicating cells (Fig. 4F and G). These results indicate that knockdown of Prdx1 increases levels of HBx protein in cells expressing HBx protein alone, and also other HBV antigens, as well in HBV-replicating cells.

Knockdown of Prdx1 increased HBV propagation in Hep38.7-Tet cells.

To further assess the effect of Prdx1 on HBV propagation in HBV-replicating cells, we used Hep38.7-Tet cells (44), a subclone of HepAD38 in which HBV replication is controlled by a tetracycline-regulated promoter. HBV replication was initiated by depletion of tetracycline 2 days after Prdx1 siRNA transfection (Fig. 5A, left panel). After tetracycline was depleted from the culture media, the cells were cultured for an additional 1, 2, and 3 days, respectively. Endogenous Prdx1 was efficiently knocked down by siRNA (Fig. 5A, right panel, lanes 2, 4, and 6). The intracellular expression levels of HBV RNA were determined by RT-qPCR. Knockdown of Prdx1 significantly increased HBV RNA levels compared to the controls at 2 and 3 days after depletion of tetracycline (Fig. 5B). The amounts of extracellular HBV DNA (Fig. 5C), as well as HBsAg (Fig. 5D) and HBeAg (Fig. 5E), in the medium were consistently increased by knockdown of Prdx1. These data suggest that Prdx1 plays a role in inhibiting HBV propagation.

FIG 5.

FIG 5

Knockdown of Prdx1 increased HBV propagation in Hep38.7-Tet cells. (A) Schematic representation of the experimental design. Hep38.7-Tet cells were transfected with Prdx1 siRNA1 or control siRNA (40 nM) in the presence of tetracycline (Tet, 400 ng/ml). At 48 h after transfection, the culture medium was exchanged for medium without Tet. The total cellular RNA and culture medium were collected at the indicated time points. Immunoblotting indicated the expression of endogenous Prdx1 and GAPDH in transfected cells. Intracellular HBV RNA (B) and extracellular HBV DNA (C) were quantitated by RT-qPCR. HBs (D) and HBe (E) antigens in the culture supernatant were measured by ELISA. *, P < 0.05; **, P < 0.01, compared to the controls.

Knockdown of Prdx1 did not enhance the activities of HBV promoters.

To determine whether Prdx1-mediated downregulation of HBV RNA is due to a transcriptional mechanism, we examined the effects of Prdx1-knockdown on the activities of four different HBV promoters (core, enhancer I [Enh1]/X, preS1, and preS2/S). HepG2 cells were cotransfected with pEF1A-HBx-Myc-His6 and the firefly luciferase reporter carrying the entire core promoter (nucleotides [nt] 900 to 1817), Enh1/X promoter (nt 950 to 1373), preS1 promoter (nt 2707 to 2847), or preS2/S promoter (nt 2937 to 3204) in the presence or absence of Prdx1 siRNA1. Promoter reporter assays demonstrated that knockdown of Prdx1 did not affect the activities of the HBV core or Enh1/X promoters (Fig. 6A and B). In addition, we found that knockdown of Prdx1 slightly reduced the activity of HBV preS1 promoter (Fig. 6C) and significantly reduced the activity of preS2/S promoter (Fig. 6D). These results clearly indicated that knockdown of Prdx1 did not enhance the activities of HBV promoters. Thus, we concluded that the Prdx1-mediated downregulation of HBV RNA was not due to a transcriptional inhibition.

FIG 6.

FIG 6

Knockdown of Prdx1 did not enhance the activities of HBV promoters. HepG2 cells were transfected with Prdx1 siRNA1 or control siRNA (40 nM). At 24 h after siRNA transfection, cells were cotransfected with pEF1A-HBx-Myc-His6 and the firefly luciferase reporter carrying the entire core promoter (nt 900 to 1817) (A), Enh1/X promoter (nt 950 to 1373) (B), preS1 promoter (nt 2707 to 2847) (C), or preS2/S promoter (nt 2937 to 3204) (D). pRL-TK-Renilla was used as an internal control. At 48 h after plasmid transfection, the cells were harvested. The luciferase activity was measured and normalized to the Renilla activity. Data represent means ± the SEM of data from three independent experiments, and the value for the control cells was arbitrarily expressed as 1.0. *, P < 0.05, compared to the control.

Knockdown of Prdx1 increased the stability of HBV RNA.

To determine whether Prdx1-mediated HBV RNA reduction is due to acceleration of HBV RNA decay by Prdx1, we performed a kinetic analysis of HBV RNA decay in HepG2 cells transfected with Prdx1 siRNA1 or control siRNA. After Prdx1 siRNA1-transfection, HepG2 cells were transfected with pUC19-HBV-C-AT_JPN. At 48 h after plasmid transfection, an RNA polymerase inhibitor, actinomycin D, was added to the medium to stop the HBV RNA transcription. The HBV RNA levels were determined by RT-qPCR in a time course study. HBV RNA was decreased more slowly in Prdx1 siRNA1-transfected cells than in the control cells (Fig. 7A), suggesting that Prdx1 participates in HBV RNA degradation. To further examine the role of the interaction between Prdx1 and HBx in the HBV RNA degradation, we used HBx-deficient (stop-codon-inserted) HBV-C-AT_JPN and found that Prdx1 knockdown had no effect on HBV RNA decay in HBx-deficient (ΔHBx) cells (Fig. 7B). These results suggest that Prdx1 participates in HBV RNA degradation via the interaction with HBx protein. We also observed that Prdx1 knockdown had no effect on stability of HBc RNA (Fig. 7C), further supporting the idea that HBx is required for Prdx1-mediated HBV RNA reduction.

FIG 7.

FIG 7

Knockdown of Prdx1 increased the stability of HBV RNA. HepG2 cells were transfected with Prdx1 siRNA1 or control siRNA (40 nM). At 24 h after siRNA transfection, cells were transfected with pUC19-HBV-C-AT_JPN (A), pUC19-HBV-C-AT_JPN(ΔHBx) (B), or pEF1A-HBc-Myc-His6 (C). At 48 h after plasmid transfection, the cells were treated with actinomycin D (10 μg/ml). Total cellular RNA was collected at the indicated time points, and HBV RNA levels or HBc RNA were determined by RT-qPCR. The mRNA levels of three housekeeping genes, B2M (D), TBP (E), and GUSB (F), in the indicated cells were determined by RT-qPCR. Data represent means ± the SEM of data from two independent experiments, and the value for the control cells at time point 0 h was arbitrarily expressed as 100%. *, P < 0.05, compared to the controls.

To determine whether Prdx1 knockdown affects the stability of host RNAs, three commonly used housekeeping genes in human hepatic tissues, such as β2-microglobulin (B2M), TATA box binding protein (TBP), and β-glucuronidase (GUSB), were selected (45, 46). We analyzed the mRNA decay of the three genes in HepG2 cells transfected with pUC19-HBV-C-AT_JPN or pUC19-HBV-C-AT_JPN (ΔHBx) in the presence or absence of Prdx1 siRNA1. We found that Prdx1 knockdown had no effect on mRNA decay of M2B (Fig. 7D), TBP (Fig. 7E), and GUSB (Fig. 7F). These results suggest that Prdx1 knockdown-mediated downregulation of HBV RNA is not due to the global downregulation of the host RNA abundance in HBV-replicating cells.

Prdx1 interacted with HBV RNA.

To determine whether Prdx1 interacts with HBV RNA, HepG2 cells were cotransfected with pUC19-HBV-C-AT_JPN and pCAG-FLAG-Prdx1, and a cell-based RNA coimmunoprecipitation (RIP) assay was performed. The levels of HBV RNA associated with Prdx1 protein were quantitated by RT-qPCR. Equivalent amounts of FLAG-Prdx1 immunoprecipitates were confirmed by Western blotting (Fig. 8H). The level of HBV RNA, was considerably higher in the FLAG-Prdx1 immunoprecipitates than in the control (Fig. 8B). These results suggest that Prdx1 forms a complex with HBV RNA. To determine the role of HBx in the interaction between Prdx1 and HBV RNA, we used pUC19-HBV-C-AT_JPN (ΔHBx) and found that the levels of mutant HBV RNA was also significantly higher in the FLAG-Prdx1 immunoprecipitates than in the control (Fig. 8C). These results suggest that Prdx1 can bind HBV RNA in the presence or absence of the HBx protein.

FIG 8.

FIG 8

Prdx1 interacted with HBV RNA. (A) Schematic representation showing positions of HBV-C-AT_JPN, HBV-C-AT_JPN (ΔHBx), HBV Pol, LHBs, HBc, and HBx. Plasmid pUC19-HBV-C-AT_JPN contains a 1.24 overlength HBV genome (GenBank accession number AB246345.1) (60). pUC19-HBV-C-AT_JPN (ΔHBx) contains a stop codon (CAA to TAA, C1395T) at codon 8 in the HBx open reading frame (32). The HBV nucleotide positions are according to Liu et al. (64). Cp and EF1α represent the HBV core promoter and EF1α promoter, respectively. The black box represents Myc-His6 tag. P1, P2, P3, and P4 represent the positions of the primers for each RT-qPCR analysis. HepG2 cells were cotransfected with pCAG-FLAG-Prdx1 and pUC19-HBV-C-AT_JPN (B), pUC19-HBV-C-AT_JPN (ΔHBx) (C), pEF1A-HBV Pol-Myc-His6 (D), pEF1A-LHBs-Myc-His6 (E), pEF1A-HBcMyc-His6 (F), or pEF1A-HBx-Myc-His6 (G). At 48 h after transfection, the cells were harvested. Cell lysates were extracted, and a RIP assay was performed using either mouse anti-FLAG M2 antibody or control mouse IgG immobilized to protein G-agarose beads. Coprecipitated RNA was isolated from beads and HBV RNA was determined by RT-qPCR using indicated primers. Data represent means ± the SEM of data from two independent experiments, and the value for the control cells was arbitrarily expressed as 1.0. *, P < 0.05. (H and I) The input cell lysate and the efficiency of immunoprecipitation of FLAG-Prdx1 were determined by immunoblotting.

To determine whether Prdx1 specifically interacts with any HBV RNA sequences, the interaction between Prdx1 and RNA of HBV Pol, LHBs, HBc, or HBx was analyzed (Fig. 8A). HepG2 cells were cotransfected with pCAG-FLAG-Prdx1, together with either pEF1A-HBV Pol-Myc-His6, pEF1A-LHBs-Myc-His6, pEF1A-HBc-Myc-His6, or pEF1A-HBx-Myc-His6. Equivalent amounts of FLAG-Prdx1 immunoprecipitates were confirmed by Western blotting (Fig. 8I, lanes 7, 9, 11, 13, and 15). We found that more RNAs of HBV Pol (nt 2307 to 1623) and HBx (nt 1374 to 1838) were precipitated in the FLAG-Prdx1 immunoprecipitates than in the controls (Fig. 8D and G). In contrast, precipitated RNAs of LHBs (nt 2848 to 835) and HBc (nt 1901 to 2452) were not changed in the immunoprecipitates with or without FLAG-Prdx1 (Fig. 8E and F). These results suggest that at least two regions of HBV RNA, nt 2452 to 2848 and nt 1374 to 1838, are involved in the interaction between Prdx1 and HBV RNA.

Knockdown of Exosc5 increased HBV RNA stability.

To investigate whether exosome component 5 (Exosc5), a member of the RNA exosome complexes, is involved in Prdx1-mediated reduction of HBV RNA, we first examined the interaction between Prdx1 and Exosc5 in the presence or absence of HBV by coimmunoprecipitation analysis. HepG2 cells were cotransfected with pUC19-HBV-C-AT_JPN and pCAG-FLAG-Prdx1, and a coimmunoprecipitation assay was performed using mouse anti-FLAG M2 monoclonal antibody or control mouse IgG. Endogenous Exosc5 was coimmunoprecipitated with FLAG-Prdx1 either in the presence or in the absence of HBV replication (Fig. 9A, upper panel, lanes 4 and 6). Consistently, HBx expressed in the HBV-replicating cells was coimmunoprecipitated with FLAG-Prdx1 (Fig. 9A, middle panel, lane 6), suggesting that Prdx1 formed a complex with HBx and Exosc5. To examine whether Exosc5 is involved in Prdx1-mediated reduction of HBV RNA, we performed a kinetic analysis of HBV RNA decay in HepG2 cells in the presence or absence of Exosc5 siRNA and Prdx1 siRNA. Prdx1 and Exosc5 were efficiently knocked down in siRNA-transfected cells (Fig. 9C, siExosc5, upper panel, lanes 3 and 4; siPrdx1, middle panel, lanes 2 and 4). HBV RNA decay in Exosc5-knockdown cells was much slower than that in the Prdx1-knockdown cells (Fig. 9B, compare triangles with squares). Interestingly, in Exosc5 and Prdx1 double-knockdown cells (Fig. 9B, diamonds), HBV RNA decay was significantly slower than that in the Exosc5 single-knockdown cells (Fig. 9B, triangles). These results suggest that Exosc5 and Prdx1 are cooperatively involved in HBV RNA decay.

FIG 9.

FIG 9

Knockdown of Exosc5 increased HBV RNA stability. (A) FLAG-Prdx1 interacted with endogenous Exosc5. HepG2 cells were cotransfected with expression plasmids for FLAG-Prdx1 and HBV-C-AT_JPN or an empty plasmid as a control. At 48 h after transfection, cell lysates were extracted, and coimmunoprecipitation was performed with mouse anti-FLAG M2 antibody or control mouse IgG. The cell lysates and the immunoprecipitates were probed with anti-Exosc5, -HBx, or -FLAG antibodies. (B) Knockdown of Exosc5 increases HBV RNA stability. HepG2 cells were transfected with either control siRNA, Prdx1 siRNA1, Exosc5 siRNA, or Prdx1 siRNA1 plus Exosc5 siRNAs, respectively. At 24 h after siRNA transfection, cells were transfected with pUC19-HBV-C-AT_JPN. The HBV RNA decay was analyzed as described in the legend to Fig. 7. Data represent means ± the SEM of data from two independent experiments, and the value for the control cells at time point 0 h was arbitrarily expressed as 100%. *, P < 0.05; **, P < 0.01, compared to the Prdx1 siRNA1-transfected cells. (C) The efficiency of Prdx1 and Exosc5 knockdown was analyzed by immunoblotting. The level of GAPDH served as a loading control.

DISCUSSION

In this study, we identified Prdx1 as a novel HBx-interacting host factor (Fig. 1). Prdx1 negatively regulated HBV propagation by accelerating the degradation of HBV RNA (Fig. 3 to 5 and Fig. 7), but the activity of four different HBV promoters was not enhanced by knockdown of Prdx1 (Fig. 6), suggesting that Prdx1 negatively regulates HBV propagation via posttranscriptional regulation of the HBV gene. To explore the molecular mechanism of Prdx1-mediated HBV RNA decay, we investigated the interaction between Prdx1 and HBV RNA. RIP assay showed that Prdx1 forms a complex with HBV RNA (Fig. 8). Next, we explored the possible involvement of the RNA exosome complex in Prdx1-mediated HBV RNA decay. Immunoprecipitation analysis revealed that Prdx1 forms a complex with Exosc5 and HBx (Fig. 9A). The HBV RNA decay was significantly slower in Exosc5 and Prdx1 double-knockdown cells than in the Exosc5 single- or Prdx1 single-knockdown cells (Fig. 9B). Taken together, our results suggest that Prdx1 negatively regulates HBV propagation by interacting with HBV RNA to facilitate its degradation (Fig. 10). To our knowledge, this is the first study to show the inhibitory activity of Prdx1 on HBV propagation.

FIG 10.

FIG 10

Proposed model for the role of Prdx1 in HBV propagation. Prdx1 interacts with HBx, HBV RNA, and Exosc5, leading to HBV RNA degradation. These results suggest that Prdx1 negatively regulates HBV propagation.

Prdx1 has been shown to modulate gene expression through association with transcription factors, such as NF-κB (47, 48), c-Myc (49), and androgen receptor (50, 51). Moreover, Prdx1 binds to RNA and acts as an RNA chaperone (40, 41). It is noteworthy that Prdx1 is required for the efficient transcription and replication of measles virus (52) and the propagation of H5N1 influenza virus (53). Prdx1 is incorporated in the virion of vaccinia virus, though its role in the viral life cycle is still unknown (54). Our findings may further expand the role of Prdx1 in HBV infection. It is noteworthy that Prdx1 formed a complex with a mutant HBV RNA that is deficient for HBx expression (Fig. 8C), whereas Prdx1 knockdown had no significant effect on the stability of the mutant HBV RNA in HBx-deficient HBV-replicating cells (Fig. 7B). Consistently, Prdx1 interacted with HBV Pol RNA (Fig. 8D), whereas knockdown of Prdx1 did not show any effect on the level of HBV Pol protein (Fig. 4B, upper panel, lanes 1 and 2). These findings support the conclusion that HBx is specifically required for Prdx1-mediated HBV RNA degradation, but not for the interaction between Prdx1 and HBV RNA. Our findings were further validated by the experiments using an HBx expression plasmid pEF1A-HBx-Myc-His6. Prdx1 interacted with HBx RNA (Fig. 8G), and moreover, knockdown of Prdx1 markedly increased the expression of HBx protein (Fig. 4A, upper panel, lanes 1 and 2). The RIP assay showed that at least two regions of HBV RNA, nt 2452 to 2848 and nt 1374 to 1838, were involved in the interaction between Prdx1 and HBV RNA (Fig. 8A). Further analysis of the physical interaction of Prdx1 with HBV RNA and Exosc5 may contribute to an understanding of the detailed mechanism of acceleration of HBV RNA decay. Considering the importance of HBV RNA in the viral life cycle, Prdx1-mediated HBV RNA decay may give us useful knowledge for the development of novel anti-HBV strategies.

The eukaryotic RNA exosome is an essential and conserved protein complex that can degrade or process RNA substrates in the 3′-to-5′ direction. Exosomal degradation has roles in normal RNA biogenesis and turnover, as well as surveillance of aberrant RNAs, including viral RNAs. Moreover, the RNA exosome can cooperate with its cofactors to specifically target an RNA substrate for degradation (55). The roles for the RNA exosome and its cofactors in the anti-HBV defense mechanism have been reported by other groups. The cytidine deaminase AID degrades HBV RNA through its interaction with HBV RNA and exosome component 3 (Exosc3) (56). RNA helicase superkiller viralicidic activity 2-like (SKIV2L) binds to HBV X-mRNA, Exosc4, and Exosc5, leading to the degradation of the HBV X-mRNA (57). Our findings suggest that Prdx1 recruits Exosc5 to HBV RNA through an association with HBx protein, providing a novel molecular mechanism for HBV RNA degradation. HBx-Myc-His6 and FLAG-Prdx1 were predominantly colocalized in the cytoplasm (Fig. 2, fourth panel, merge). In addition, Exosc5 was reported to localize in both the cytoplasm and the nucleus (58). Therefore, it is reasonable to assume that Prdx1- and Exosc5-mediated HBV RNA decay may occur in the cytoplasm. Interestingly, the coimmunoprecipitation analysis revealed that Prdx1 interacted with Exosc5 in the absence of HBV (Fig. 9A, lane 4). This finding raises a possibility that the Prdx1-Exosc5 complex may participate in the degradation of other viral RNA.

Collectively, these findings lead us to propose that Prdx1, a novel HBx-interacting protein, negatively regulates HBV propagation by interacting with HBV RNA to facilitate its degradation. These results suggest that Prdx1 and Exosc5 play crucial roles in host defense mechanisms against HBV infection.

MATERIALS AND METHODS

Cell culture.

Human hepatoblastoma HepG2 cells and human hepatoma Huh-7.5 cells (59) were cultured in Dulbecco modified Eagle medium (DMEM; high glucose) with l-glutamine (Wako Pure Chemical Industries, Osaka, Japan) and supplemented with 10% heat-inactivated fetal bovine serum (FBS; Biowest, Nuaillé, France), 100 U/ml penicillin, 100 μg/ml streptomycin (Gibco, Grand Island, NY), and 0.1 mM nonessential amino acids (Gibco). Hep38.7-Tet cells (44) were cultured with DMEM/F-12 (Gibco) supplemented with 10 mM HEPES (Gibco), 100 U/ml penicillin, 100 μg/ml streptomycin (Gibco), 10% FBS (Biowest), 5 μg/ml insulin (Sigma, St. Louis, MO), 400 μg/ml G418 (Nacalai Tesque, Kyoto, Japan), and 400 ng/ml tetracycline (Sigma).

Plasmids.

The HBV expression plasmids pUC19-HBV-Bj_JPN56, pUC19-HBV-C-AT_JPN and pUC19-DIND60 (60), and the plasmids pEF1A-HBx-Myc-His6 and pEF1A-HBc-Myc-His6 have been previously described (18). To express a series of HBx deletion mutants, each fragment was amplified by PCR using pEF1A-HBx-Myc-His6 as a template and cloned into the KpnI and XbaI sites of pEF1A-Myc-His6 (Invitrogen, Carlsbad, CA). A single point mutation was introduced into the pEF1A-HBx-Myc-His6 or pEF1A-HBx(aa 1 to 90)-Myc-His6 by using a QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA). To express HBV Pol, the cDNA fragment of nt 2307 to1623 derived from the HBV-C-AT_JPN strain was amplified by PCR using the plasmid pUC19-HBV-C-AT_JPN as a template. To express LHBs, the cDNA fragment of nt 2848 to 835 derived from the HBV-C-AT_JPN strain was amplified by PCR. Each of these amplified PCR products was inserted into the KpnI-EcoRI site of pEF1A-Myc-His6 (Invitrogen). The sequences of the plasmids used in this study were extensively confirmed by DNA sequencing. The plasmids pCAG-FLAG-Prdx1 (42) and pHBVΔX (C_JPNAT strain) (32) were used.

Tandem affinity purification.

Huh-7.5 cells were transfected with either pEF1A-HBx(aa 1 to 90)-Myc-His6 or empty plasmid and harvested at 48 h posttransfection. Harvested cells were lysed with a lysis buffer containing 150 mM NaCl, 50 mM Tris-HCl (pH 7.5), 1% Triton X-100, and a protease inhibitor cocktail (Roche, Mannheim, Germany) and centrifuged at 20,400 × g for 30 min at 4°C. The supernatants were incubated with anti-Myc tag beads (MBL, Nagoya, Japan) for 2 h at 4°C. After the beads were washed, the Myc-tagged proteins were eluted with the Myc peptide. The eluate was then incubated with Ni-NTA agarose beads (Qiagen, Valencia, CA) for another 2 h at 4°C, and His6-tagged proteins were eluted with imidazole. The eluted proteins were separated by SDS-PAGE and visualized with silver staining (Wako Pure Chemical Industries). Specific bands were cut from the gel and analyzed by NanoLC-MS/MS.

Immunoprecipitation and immunoblot analyses.

Immunoprecipitation and immunoblot analyses were performed as described previously (61). The primary antibodies used in this study were mouse monoclonal antibodies against c-Myc (9E10; Santa Cruz Biotechnology, Santa Cruz, CA), FLAG (Clone M2; Sigma), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Millipore, Billerica, MA); rabbit monoclonal antibody against Prdx1 (Cell Signaling Technology, Danvers, MA); rabbit polyclonal antibody against HBx (Abcam, Cambridge, UK), HBc (62), and Exosc5 (Novusbio, Littleton, CO); and horse polyclonal antibody against HBs (Abcam). Horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG and goat anti-rabbit IgG (Molecular Probes, Eugene, OR), and HRP-conjugated rabbit anti-horse IgG (Abcam) were used to visualize the respective proteins by means of an enhanced chemiluminescence detection system (ECL; GE Healthcare, Piscataway, NJ).

siRNA transfection.

Two sets of Prdx1 siRNA purchased from Qiagen (catalog no. SI00301259) and Origene (catalog no. SR303343C; Rockville, MD) were designated Prdx1 siRNA1 and Prdx1 siRNA2, respectively. Exosc5 siRNA was purchased from Qiagen (catalog no. SI00381983). HepG2 cells were transfected with siRNA at a final concentration of 40 nM using Lipofectamine RNAiMAX (Invitrogen). Allstars negative-control siRNA (Qiagen) was used as a control.

RIP assay.

HepG2 cells were cotransfected with pCAG-FLAG-Prdx1 and either pUC19-HBV-C-AT_JPN or pUC19-HBV-C-AT_JPN(ΔHBx), together with either pEF1A-HBV Pol-Myc-His6, pEF1A-LHBs-Myc-His6, pEF1A-HBc-Myc-His6, or pEF1A-HBx-Myc-His6. At 48 h after transfection, the RIP assay was performed using the RiboCluster Profile/RIP-Assay kit (MBL) according to the manufacturer’s instructions. Cultured cells were lysed and centrifuged, and the supernatants were incubated with mouse anti-FLAG M2 antibody-immobilized to protein G (Sigma) at 4°C for 16 h. Normal mouse IgG (Santa Cruz Biotechnology) was used as the isotype control. The pelleted beads were subjected to RNA isolation. The resultant output protein and RNA samples were utilized for immunoblotting and RT-qPCR, respectively. RT-qPCR was performed by using SYBR Premix Ex Taq II (TaKaRa, Kyoto, Japan) with SYBR green chemistry on a StepOnePlus real-time PCR system (Applied Biosystems, Foster City, CA). The primer sequences were as follows: P1, 5′-GCTTTCACTTTCTCGCCAAC-3′ and 5′-GAGTTCCGCAGTATGGATCG-3′; P2, 5′-GGACCCCTGCTCGTGTTACAGGC-3′ and 5′-GGACAAGAGGTTGGTGAGTGATTG-3′; P3, 5′-CTCGACACCGCCTCAGCTCTGP4-3′ and 5′-GCTGACTACTAATTCCCTGG-3′; and P4, 5′-CTCGGGGCCGTTTGGGACTCTATC-3′ and 5′-GGGCAAGACCTGGTGGGCGTTC-3′.

Quantification of intracellular HBV RNA and extracellular HBV DNA.

Total cellular RNA was isolated by using a ReliaPrep RNA cell miniprep system (Promega) according to the manufacturer’s instructions, and cDNA was generated by using a GoScript reverse transcription system (Promega). RT-qPCR was performed using SYBR Premix Ex Taq II (TaKaRa) with SYBR green chemistry on the StepOnePlus real-time PCR system. The primer sequences were as follows: HBV, 5′-GCTTTCACTTTCTCGCCAAC-3′ and 5′-GAGTTCCGCAGTATGGATCG-3′ (31). As an internal control, human GAPDH gene expression levels were measured using the primers 5′-GCCATCAATGACCCCTTCATT-3′ and 5′-TCTCGCTCCTGGAAGATGG-3′.

To quantitate extracellular HBV DNA, culture supernatants were collected from Hep38.7-Tet cells, and viral DNA was isolated using a QIAamp DNA minikit (Qiagen). RT-qPCR was performed using SYBR Premix Ex Taq II (TaKaRa) with SYBR green chemistry on the StepOnePlus real-time PCR system. The primer sequences were as follows: 5′-ACCAATCGCCAGTCAGGAAG-3′ and 5′-ACCAGCAGGGAAATACAGGC-3′.

Luciferase reporter assay.

To construct the entire HBV core promoter reporter luciferase plasmid pGL4.10-HBpg-Ce (62), a DNA fragment of the core promoter nucleotides (nt 900 to 1817) derived from genotype Ce was inserted into pGL4.10 firefly luciferase plasmid (Promega) using the KpnI and HindIII restriction sites. A nonsense mutation (ATG to TAG at nt 1374 to 1376) was introduced at the start codon of the HBx gene in pGL4.10-HBpg-Ce. Similarly, DNA fragments corresponding to the HBV genotype Ce EnhI/X (nt 950 to 1373), preS1 (nt 2707 to 2847), or preS2/S (nt 2937 to 3204) promoters were inserted into the pGL4.10 firefly luciferase plasmid. pRL-CMV-Renilla (Promega), which expresses Renilla luciferase, was used as an internal control. HepG2 cells cultured in a 24-well tissue culture plate were transiently transfected with the reporter constructs described above together with expression plasmid for Myc-His6-tagged HBx, in the presence or absence of Prdx1 siRNA. At 48 h after transfection, the cells were harvested, and a luciferase assay was performed using a dual-luciferase reporter assay system (Promega). Firefly and Renilla luciferase activities were measured with a GloMax 96 microplate luminometer (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity for each sample.

Indirect immunofluorescence.

Huh-7.5 cells seeded on glass coverslips in a 24-well plate were transfected with plasmids for the expression of Myc-His6-tagged HBx or HBx(C17A) and FLAG-tagged Prdx1. At 48 h after transfection, the cells were fixed, and indirect immunofluorescence was performed as described previously (63). The primary antibodies used for immunofluorescence were anti-c-Myc mouse monoclonal antibody (Santa Cruz Biotechnology) and anti-FLAG rabbit polyclonal antibody (Sigma). The secondary antibodies were Alexa Fluor 594-conjugated goat anti-mouse IgG and Alexa Fluor 488-conjugated goat anti-rabbit IgG (Molecular Probes). The stained cells were observed under a confocal laser scanning microscope (LSM700; Carl Zeiss, Oberkochen, Germany).

Detection of HBsAg and HBeAg.

The levels of HBsAg and HBeAg in the culture medium were measured by ELISA kits according to the manufacturer’s instructions (HBsAg: DIA source, Rue du Bosquet, Belgium; HBeAg: LifeSpan Bio Sciences, Seattle, WA).

Northern blotting.

Total cellular RNA was extracted using a ReliaPrep RNA cell miniprep system (Promega). Two micrograms of total RNA was electrophoresed in a 1.2% agarose/formaldehyde gel and transferred onto a positively charged nylon membrane (Roche). To detect HBV transcripts, the membrane was probed with a digoxigenin (DIG)-labeled plus-strand-specific RNA probe corresponding to nt 1369 to 1061 of the HBV genome. The probe preparation and subsequent DIG detection were performed using a DIG Northern starter kit (Roche). The amounts of 18S and 28S rRNA were used as loading controls.

RNA decay assay.

After Prdx1 siRNA1 transfection, HepG2 cells were transfected with pUC19-HBV-C-AT_JPN, mutated HBV plasmid, pUC19-HBV(ΔHBx, C-AT_JPN), which possesses a stop codon in the HBx coding region and lacks HBx protein expression, or pEF1A-HBc-Myc-His6. At 48 h after plasmid transfection, RNA synthesis was stopped using the RNA polymerase inhibitor actinomycin D (10 μg/ml), followed by further culture for 3, 6, or 9 h. At each time point, cells were harvested, and total RNA was extracted from the cells. The expression levels of HBV RNA, HBc RNA, and three housekeeping genes (B2M, TBP, and GUSB) were determined by RT-qPCR. RT-qPCR was performed using SYBR Premix Ex Taq II (TaKaRa) with SYBR green chemistry on the StepOnePlus real-time PCR system. The primer sequences were as follows: HBV, 5′-GCTTTCACTTTCTCGCCAAC-3′ and 5′-GAGTTCCGCAGTATGGATCG-3′; HBc, 5′CTCGACACCGCCTCAGCTCTGP4-3′ and 5′-GCTGACTACTAATTCCCTGG-3′; B2M, 5′-CATCCATCCGACATTGAAGTT-3′ and 5′-ACGGCAGGCATACTCATCTTT-3′; TBP, 5′-ATCACTGTTTCTTGGCGTGTG-3′ and 5′-CGCTGGAACTCGTCTCACTATT-3′; and GUSB, 5′-TACACGACACCCACCACCTAC-3′ and 5′-GGTTACTGCCCTTGACAGAGAT-3′.

Statistical analysis.

Results were expressed as means ± standard errors of the means (SEM). Statistical significance was evaluated by analysis of variance and was defined as a P value of <0.05.

ACKNOWLEDGMENTS

We are grateful to C. M. Rice (The Rockefeller University, New York, NY) for providing Huh-7.5 cells.

This study was supported in part by the Program on the Innovative Development and the Application of New Drugs for Hepatitis B from the Japan Agency for Medical Research and Development under grants JP15fk0310005, JP16fk0310503, JP17fk0310119, and JP18fk0310119. This study was also supported in part by a grant-in-aid for research on the Development and Application of Drugs for Hepatitis B from the Ministry of Health, Labor, and Welfare, Japan.

REFERENCES

  • 1.Trepo C, Chan HL, Lok A. 2014. Hepatitis B virus infection. Lancet 384:2053–2063. doi: 10.1016/S0140-6736(14)60220-8. [DOI] [PubMed] [Google Scholar]
  • 2.Seeger C, Mason WS. 2015. Molecular biology of hepatitis B virus infection. Virology 479-480:672–686. doi: 10.1016/j.virol.2015.02.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Arzumanyan A, Reis HM, Feitelson MA. 2013. Pathogenic mechanisms in HBV- and HCV-associated hepatocellular carcinoma. Nat Rev Cancer 13:123–135. doi: 10.1038/nrc3449. [DOI] [PubMed] [Google Scholar]
  • 4.Benhenda S, Cougot D, Buendia MA, Neuveut C. 2009. Hepatitis B virus X protein molecular functions and its role in virus life cycle and pathogenesis. Adv Cancer Res 103:75–109. doi: 10.1016/S0065-230X(09)03004-8. [DOI] [PubMed] [Google Scholar]
  • 5.Lucifora J, Arzberger S, Durantel D, Belloni L, Strubin M, Levrero M, Zoulim F, Hantz O, Protzer U. 2011. Hepatitis B virus X protein is essential to initiate and maintain virus replication after infection. J Hepatol 55:996–1003. doi: 10.1016/j.jhep.2011.02.015. [DOI] [PubMed] [Google Scholar]
  • 6.Leupin O, Bontron S, Schaeffer C, Strubin M. 2005. Hepatitis B virus X protein stimulates viral genome replication via a DDB1-dependent pathway distinct from that leading to cell death. J Virol 79:4238–4245. doi: 10.1128/JVI.79.7.4238-4245.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Tang H, Delgermaa L, Huang F, Oishi N, Liu L, He F, Zhao L, Murakami S. 2005. The transcriptional transactivation function of HBx protein is important for its augmentation role in hepatitis B virus replication. J Virol 79:5548–5556. doi: 10.1128/JVI.79.9.5548-5556.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Bouchard MJ, Wang LH, Schneider RJ. 2001. Calcium signaling by HBx protein in hepatitis B virus DNA replication. Science 294:2376–2378. doi: 10.1126/science.294.5550.2376. [DOI] [PubMed] [Google Scholar]
  • 9.Keasler VV, Hodgson AJ, Madden CR, Slagle BL. 2007. Enhancement of hepatitis B virus replication by the regulatory X protein in vitro and in vivo. J Virol 81:2656–2662. doi: 10.1128/JVI.02020-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Kim CM, Koike K, Saito I, Miyamura T, Jay G. 1991. HBx gene of hepatitis B virus induces liver cancer in transgenic mice. Nature 351:317–320. doi: 10.1038/351317a0. [DOI] [PubMed] [Google Scholar]
  • 11.Koike K, Moriya K, Iino S, Yotsuyanagi H, Endo Y, Miyamura T, Kurokawa K. 1994. High-level expression of hepatitis B virus HBx gene and hepatocarcinogenesis in transgenic mice. Hepatology 19:810–819. doi: 10.1002/hep.1840190403. [DOI] [PubMed] [Google Scholar]
  • 12.Yu DY, Moon HB, Son JK, Jeong S, Yu SL, Yoon H, Han YM, Lee CS, Park JS, Lee CH, Hyun BH, Murakami S, Lee KK. 1999. Incidence of hepatocellular carcinoma in transgenic mice expressing the hepatitis B virus X-protein. J Hepatol 31:123–132. doi: 10.1016/S0168-8278(99)80172-X. [DOI] [PubMed] [Google Scholar]
  • 13.Kim KH, Seong BL. 2003. Proapoptotic function of HBV X protein is mediated by interaction with c-FLIP and enhancement of death-inducing signal. EMBO J 22:2104–2116. doi: 10.1093/emboj/cdg210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Geng X, Huang C, Qin Y, McCombs JE, Yuan Q, Harry BL, Palmer AE, Xia NS, Xue D. 2012. Hepatitis B virus X protein targets Bcl-2 proteins to increase intracellular calcium, required for virus replication and cell death induction. Proc Natl Acad Sci U S A 109:18471–18476. doi: 10.1073/pnas.1204668109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Chirillo P, Pagano S, Natoli G, Puri PL, Burgio VL, Balsano C, Levrero M. 1997. The hepatitis B virus X gene induces p53-mediated programmed cell death. Proc Natl Acad Sci U S A 94:8162–8167. doi: 10.1073/pnas.94.15.8162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Elmore LW, Hancock AR, Chang SF, Wang XW, Chang S, Callahan CP, Geller DA, Will H, Harris CC. 1997. Hepatitis B virus X protein and p53 tumor suppressor interactions in the modulation of apoptosis. Proc Natl Acad Sci U S A 94:14707–14712. doi: 10.1073/pnas.94.26.14707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Liu Q, Chen J, Liu L, Zhang J, Wang D, Ma L, He Y, Liu Y, Liu Z, Wu J. 2011. The X protein of hepatitis B virus inhibits apoptosis in hepatoma cells through enhancing the methionine adenosyltransferase 2A gene expression and reducing S-adenosylmethionine production. J Biol Chem 286:17168–17180. doi: 10.1074/jbc.M110.167783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hayashi M, Deng L, Chen M, Gan X, Shinozaki K, Shoji I, Hotta H. 2016. Interaction of the hepatitis B virus X protein with the lysine methyltransferase SET and MYND domain-containing 3 induces activator protein 1 activation. Microbiol Immunol 60:17–25. doi: 10.1111/1348-0421.12345. [DOI] [PubMed] [Google Scholar]
  • 19.Tanaka Y, Kanai F, Ichimura T, Tateishi K, Asaoka Y, Guleng B, Jazag A, Ohta M, Imamura J, Ikenoue T, Ijichi H, Kawabe T, Isobe T, Omata M. 2006. The hepatitis B virus X protein enhances AP-1 activation through interaction with Jab1. Oncogene 25:633–642. doi: 10.1038/sj.onc.1209093. [DOI] [PubMed] [Google Scholar]
  • 20.Benn J, Su F, Doria M, Schneider RJ. 1996. Hepatitis B virus HBx protein induces transcription factor AP-1 by activation of extracellular signal-regulated and c-Jun N-terminal mitogen-activated protein kinases. J Virol 70:4978–4985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Chirillo P, Falco M, Puri PL, Artini M, Balsano C, Levrero M, Natoli G. 1996. Hepatitis B virus pX activates NF-κB-dependent transcription through a Raf-independent pathway. J Virol 70:641–646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Su F, Schneider RJ. 1996. Hepatitis B virus HBx protein activates transcription factor NF-κB by acting on multiple cytoplasmic inhibitors of rel-related proteins. J Virol 70:4558–4566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Rawat S, Bouchard MJ. 2015. The hepatitis B virus (HBV) HBx protein activates AKT to simultaneously regulate HBV replication and hepatocyte survival. J Virol 89:999–1012. doi: 10.1128/JVI.02440-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Cougot D, Wu Y, Cairo S, Caramel J, Renard CA, Levy L, Buendia MA, Neuveut C. 2007. The hepatitis B virus X protein functionally interacts with CREB-binding protein/p300 in the regulation of CREB-mediated transcription. J Biol Chem 282:4277–4287. doi: 10.1074/jbc.M606774200. [DOI] [PubMed] [Google Scholar]
  • 25.Schaedler S, Krause J, Himmelsbach K, Carvajal-Yepes M, Lieder F, Klingel K, Nassal M, Weiss TS, Werner S, Hildt E. 2010. Hepatitis B virus induces expression of antioxidant response element-regulated genes by activation of Nrf2. J Biol Chem 285:41074–41086. doi: 10.1074/jbc.M110.145862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Liu B, Fang M, He Z, Cui D, Jia S, Lin X, Xu X, Zhou T, Liu W. 2015. Hepatitis B virus stimulates G6PD expression through HBx-mediated Nrf2 activation. Cell Death Dis 6:e1980. doi: 10.1038/cddis.2015.322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lim W, Kwon S-H, Cho H, Kim S, Lee S, Ryu W-S, Cho H. 2010. HBx targeting to mitochondria and ROS generation are necessary but insufficient for HBV-induced cyclooxygenase-2 expression. J Mol Med (Berl) 88:359–369. doi: 10.1007/s00109-009-0563-z. [DOI] [PubMed] [Google Scholar]
  • 28.Ha HL, Yu DY. 2010. HBx-induced reactive oxygen species activates hepatocellular carcinogenesis via dysregulation of PTEN/Akt pathway. World J Gastroenterol 16:4932–4937. doi: 10.3748/wjg.v16.i39.4932. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Truant R, Antunovic J, Greenblatt J, Prives C, Cromlish JA. 1995. Direct interaction of the hepatitis B virus HBx protein with p53 leads to inhibition by HBx of p53 response element-directed transactivation. J Virol 69:1851–1859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Sitterlin D, Lee TH, Prigent S, Tiollais P, Butel JS, Transy C. 1997. Interaction of the UV-damaged DNA-binding protein with hepatitis B virus X protein is conserved among mammalian hepadnaviruses and restricted to transactivation-proficient X-insertion mutants. J Virol 71:6194–6199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Benhenda S, Ducroux A, Riviere L, Sobhian B, Ward MD, Dion S, Hantz O, Protzer U, Michel ML, Benkirane M, Semmes OJ, Buendia MA, Neuveut C. 2013. Methyltransferase PRMT1 is a binding partner of HBx and a negative regulator of hepatitis B virus transcription. J Virol 87:4360–4371. doi: 10.1128/JVI.02574-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Kouwaki T, Okamoto T, Ito A, Sugiyama Y, Yamashita K, Suzuki T, Kusakabe S, Hirano J, Fukuhara T, Yamashita A, Saito K, Okuzaki D, Watashi K, Sugiyama M, Yoshio S, Standley DM, Kanto T, Mizokami M, Moriishi K, Matsuura Y. 2016. Hepatocyte factor JMJD5 regulates hepatitis B virus replication through interaction with HBx. J Virol 90:3530–3542. doi: 10.1128/JVI.02776-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Perkins A, Nelson KJ, Parsonage D, Poole LB, Karplus PA. 2015. Peroxiredoxins: guardians against oxidative stress and modulators of peroxide signaling. Trends Biochem Sci 40:435–445. doi: 10.1016/j.tibs.2015.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ishii T, Warabi E, Yanagawa T. 2012. Novel roles of peroxiredoxins in inflammation, cancer and innate immunity. J Clin Biochem Nutr 50:91–105. doi: 10.3164/jcbn.11-109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Neumann CA, Krause DS, Carman CV, Das S, Dubey DP, Abraham JL, Bronson RT, Fujiwara Y, Orkin SH, Van Etten RA. 2003. Essential role for the peroxiredoxin Prdx1 in erythrocyte antioxidant defence and tumour suppression. Nature 424:561–565. doi: 10.1038/nature01819. [DOI] [PubMed] [Google Scholar]
  • 36.Cao J, Schulte J, Knight A, Leslie NR, Zagozdzon A, Bronson R, Manevich Y, Beeson C, Neumann CA. 2009. Prdx1 inhibits tumorigenesis via regulating PTEN/AKT activity. EMBO J 28:1505–1517. doi: 10.1038/emboj.2009.101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Sun QK, Zhu JY, Wang W, Lv Y, Zhou HC, Yu JH, Xu GL, Ma JL, Zhong W, Jia WD. 2014. Diagnostic and prognostic significance of peroxiredoxin 1 expression in human hepatocellular carcinoma. Med Oncol 31:786. doi: 10.1007/s12032-013-0786-2. [DOI] [PubMed] [Google Scholar]
  • 38.Gong F, Hou G, Liu H, Zhang M. 2015. Peroxiredoxin 1 promotes tumorigenesis through regulating the activity of mTOR/p70S6K pathway in esophageal squamous cell carcinoma. Med Oncol 32:455. doi: 10.1007/s12032-014-0455-0. [DOI] [PubMed] [Google Scholar]
  • 39.Riddell JR, Bshara W, Moser MT, Spernyak JA, Foster BA, Gollnick SO. 2011. Peroxiredoxin 1 controls prostate cancer growth through Toll-like receptor 4-dependent regulation of tumor vasculature. Cancer Res 71:1637–1646. doi: 10.1158/0008-5472.CAN-10-3674. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Kim JH, Lee JM, Lee HN, Kim EK, Ha B, Ahn SM, Jang HH, Lee SY. 2012. RNA-binding properties and RNA chaperone activity of human peroxiredoxin 1. Biochem Biophys Res Commun 425:730. doi: 10.1016/j.bbrc.2012.07.142. [DOI] [PubMed] [Google Scholar]
  • 41.Kwon SC, Yi H, Eichelbaum K, Fohr S, Fischer B, You KT, Castello A, Krijgsveld J, Hentze MW, Kim VN. 2013. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol 20:1122–1130. doi: 10.1038/nsmb.2638. [DOI] [PubMed] [Google Scholar]
  • 42.Nasu J, Murakami K, Miyagawa S, Yamashita R, Ichimura T, Wakita T, Hotta H, Miyamura T, Suzuki T, Satoh T, Shoji I. 2010. E6AP ubiquitin ligase mediates ubiquitin-dependent degradation of peroxiredoxin 1. J Cell Biochem 111:676–685. doi: 10.1002/jcb.22752. [DOI] [PubMed] [Google Scholar]
  • 43.Bertoldi M. 2016. Human peroxiredoxins 1 and 2 and their interacting protein partners; through structure toward functions of biological complexes. Protein Pept Lett 23:69–77. [DOI] [PubMed] [Google Scholar]
  • 44.Ogura N, Watashi K, Noguchi T, Wakita T. 2014. Formation of covalently closed circular DNA in Hep38.7-Tet cells, a tetracycline inducible hepatitis B virus expression cell line. Biochem Biophys Res Commun 452:315–321. doi: 10.1016/j.bbrc.2014.08.029. [DOI] [PubMed] [Google Scholar]
  • 45.Fu LY, Jia HL, Dong QZ, Wu JC, Zhao Y, Zhou HJ, Ren N, Ye QH, Qin LX. 2009. Suitable reference genes for real-time PCR in human HBV-related hepatocellular carcinoma with different clinical prognoses. BMC Cancer 9:49. doi: 10.1186/1471-2407-9-49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Riemers FM, Rothuizen J, Penning LC. 2013. Towards a standardized method to acquire and store liver samples and guidelines to improve quality control and exchange of relative expression data. EMJ Hepatol 1:78–84. [Google Scholar]
  • 47.Hansen JM, Moriarty-Craige S, Jones DP. 2007. Nuclear and cytoplasmic peroxiredoxin-1 differentially regulate NF-κB activities. Free Radic Biol Med 43:282–288. doi: 10.1016/j.freeradbiomed.2007.04.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Wang X, He S, Sun JM, Delcuve GP, Davie JR. 2010. Selective association of peroxiredoxin 1 with genomic DNA and COX-2 upstream promoter elements in estrogen receptor negative breast cancer cells. Mol Biol Cell 21:2987–2995. doi: 10.1091/mbc.E10-02-0160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Egler RA, Fernandes E, Rothermund K, Sereika S, de Souza-Pinto N, Jaruga P, Dizdaroglu M, Prochownik EV. 2005. Regulation of reactive oxygen species, DNA damage, and c-Myc function by peroxiredoxin 1. Oncogene 24:8038–8050. doi: 10.1038/sj.onc.1208821. [DOI] [PubMed] [Google Scholar]
  • 50.Park SY, Yu X, Ip C, Mohler JL, Bogner PN, Park YM. 2007. Peroxiredoxin 1 interacts with androgen receptor and enhances its transactivation. Cancer Res 67:9294–9303. doi: 10.1158/0008-5472.CAN-07-0651. [DOI] [PubMed] [Google Scholar]
  • 51.Chhipa RR, Lee KS, Onate S, Wu Y, Ip C. 2009. Prx1 enhances androgen receptor function in prostate cancer cells by increasing receptor affinity to dihydrotestosterone. Mol Cancer Res 7:1543–1552. doi: 10.1158/1541-7786.MCR-08-0546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Watanabe A, Yoneda M, Ikeda F, Sugai A, Sato H, Kai C. 2011. Peroxiredoxin 1 is required for efficient transcription and replication of measles virus. J Virol 85:2247–2253. doi: 10.1128/JVI.01796-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Liu C, Zhang A, Guo J, Yang J, Zhou H, Chen H, Jin M. 2012. Identification of human host proteins contributing to H5N1 influenza virus propagation by membrane proteomics. J Proteome Res 11:5396–5405. doi: 10.1021/pr3006342. [DOI] [PubMed] [Google Scholar]
  • 54.Chung CS, Chen CH, Ho MY, Huang CY, Liao CL, Chang W. 2006. Vaccinia virus proteome: identification of proteins in vaccinia virus intracellular mature virion particles. J Virol 80:2127–2140. doi: 10.1128/JVI.80.5.2127-2140.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Zinder JC, Lima CD. 2017. Targeting RNA for processing or destruction by the eukaryotic RNA exosome and its cofactors. Genes Dev 31:88–100. doi: 10.1101/gad.294769.116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Liang G, Liu G, Kitamura K, Wang Z, Chowdhury S, Monjurul AM, Wakae K, Koura M, Shimadu M, Kinoshita K, Muramatsu M. 2015. TGF-beta suppression of HBV RNA through AID-dependent recruitment of an RNA exosome complex. PLoS Pathog 11:e1004780. doi: 10.1371/journal.ppat.1004780. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Aly HH, Suzuki J, Watashi K, Chayama K, Hoshino S, Hijikata M, Kato T, Wakita T. 2016. RNA exosome complex regulates stability of the hepatitis B virus X-mRNA transcript in a non-stop-mediated (NSD) RNA quality control mechanism. J Biol Chem 291:15958–15974. doi: 10.1074/jbc.M116.724641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Brouwer R, Allmang C, Raijmakers R, van Aarssen Y, Egberts WV, Petfalski E, van Venrooij WJ, Tollervey D, Pruijn GJ. 2001. Three novel components of the human exosome. J Biol Chem 276:6177–6184. doi: 10.1074/jbc.M007603200. [DOI] [PubMed] [Google Scholar]
  • 59.Blight KJ, McKeating JA, Rice CM. 2002. Highly permissive cell lines for subgenomic and genomic hepatitis C virus RNA replication. J Virol 76:13001–13014. doi: 10.1128/JVI.76.24.13001-13014.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Sugiyama M, Tanaka Y, Kato T, Orito E, Ito K, Acharya SK, Gish RG, Kramvis A, Shimada T, Izumi N, Kaito M, Miyakawa Y, Mizokami M. 2006. Influence of hepatitis B virus genotypes on the intra- and extracellular expression of viral DNA and antigens. Hepatology 44:915–924. doi: 10.1002/hep.21345. [DOI] [PubMed] [Google Scholar]
  • 61.Deng L, Nagano FM, Tanaka M, Nomura TY, Ikeda M, Kato N, Sada K, Hotta H. 2006. NS3 protein of Hepatitis C virus associates with the tumour suppressor p53 and inhibits its function in an NS3 sequence-dependent manner. J Gen Virol 87:1703–1713. doi: 10.1099/vir.0.81735-0. [DOI] [PubMed] [Google Scholar]
  • 62.Li Y, Ito M, Sun S, Chida T, Nakashima K, Suzuki T. 2016. LUC7L3/CROP inhibits replication of hepatitis B virus via suppressing enhancer II/basal core promoter activity. Sci Rep 6:36741. doi: 10.1038/srep36741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Deng L, Adachi T, Kitayama K, Bungyoku Y, Kitazawa S, Ishido S, Shoji I, Hotta H. 2008. Hepatitis C virus infection induces apoptosis through a Bax-triggered, mitochondrion-mediated, caspase 3-dependent pathway. J Virol 82:10375–10385. doi: 10.1128/JVI.00395-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Liu Y, Nie H, Mao R, Mitra B, Cai D, Yan R, Guo JT, Block TM, Mechti N, Guo H. 2017. Interferon-inducible ribonuclease ISG20 inhibits hepatitis B virus replication through directly binding to the epsilon stem-loop structure of viral RNA. PLoS Pathog 13:e1006296. doi: 10.1371/journal.ppat.1006296. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES