Abstract
Background
The geographic distribution of Dermacentor reticulatus is expanding in Europe. Surveillance of this tick species and its pathogens is desirable, as it transmits pathogens of public and veterinary importance. A high-throughput real-time PCR-based array was used to screen 1.741 D. reticulatus ticks from Belgium, Germany, The Netherlands, and Great Britain for the presence of 28 tick-borne bacteria and twelve protozoan parasites. The presence of pathogen DNA was confirmed by conventional PCR followed by sequencing.
Results
The array detected the presence of DNA from Borrelia spp. (7%), B. afzelii (0.1%), B. garinii (0.1%), B. spielmanii (0.1%), B. miyamotoi (0.2%), Anaplasma marginale (0.1%), A. phagocytophilum (0.1%), Ehrlichia canis (2%), Rickettsia helvetica (0.2%), spotted fever group Rickettsia (9.6%), Francisella tularensis or Francisella-like endosymbionts (95%), Coxiella burnettii (0.1%), Babesia divergens (0.2%), B. canis (0.9%) B. vogeli (5.6%), and Theileria equi (0.1%). Only the presence of B. canis and spotted fever group Rickettsia could be confirmed by conventional PCR and sequencing. The spotted fever Rickettsia-positive samples were all identified as R. raoultii.
Conclusions
We successfully detected and determined the prevalence of B. canis and R. raoultii in D. reticulatus. An high-throughput array that allows fast and comprehensive testing of tick-borne pathogens is advantageous for surveillance and future epidemiological studies. The importance of thorough validation of real-time PCR-based assays and careful interpretation is evident.
Keywords: Molecular biology, Microbiology
1. Introduction
Dermacentor reticulatus (Fabricius, 1794) is considered to be the second most important tick species in Europe, after Ixodes ricinus, in terms of its spread and impact on public and veterinary health [1, 2]. Dermacentor reticulatus is recorded in many European countries, but is relatively rare in the dry Mediterranean climate zone, and absent in the cold Scandinavian countries (https://ecdc.europa.eu/en/publications-data/dermacentor-reticulatus-current-known-distribution-january-2018). The occurrence of D. reticulatus is highly focal within its large distribution area [3], probably because of its ecological requirements [1]. Several studies indicated geographic expansion of D. reticulatus within Europe in the last several decades. These studies suggested that the geographical spread of D. reticulatus is facilitated by international tourism and trade, and that changes in climate, land use and environmental protection have resulted in more favorable habitats [4, 5, 6, 7, 8].
Dermacentor reticulatus transmits a set of pathogens to humans, which can cause serious disease if not diagnosed and treated appropriately in a timely manner. These pathogens are Omsk haemorrhagic fever virus, tick-borne encephalitis virus, Rickettsia raoultii, and R. slovaca [1], the latter two causing tick-borne lymphadenopathy (TIBOLA, [9]). Dermacentor reticulatus is also the vector of Anaplasma marginale, Babesia canis, B. caballi, and Theileria equi, which cause serious diseases and economic loss in domesticated animals [10, 11]. The list of pathogens detected in D. reticulatus using molecular techniques is much longer [1], and includes for example Borrelia burgdorferi s.l., R. helvetica, A. phagocytophilum, and Coxiella burnetii. It should be noted that molecular detection techniques have several advantages, but also weaknesses, including the inability to distinguish living from dead microorganisms and the risk exists for contamination or PCR artefacts from various sources. Whether D. reticulatus carries and transmits all these pathogens as infectious agents needs to be established in experimental or epidemiological studies.
Surveillance of tick-borne diseases ideally includes the monitoring of the geographic distribution of ticks, as well as the monitoring of tick-borne pathogens in ticks and vertebrate hosts ([12, 13]. For adequate monitoring of pathogens with relatively low infection rates, many ticks need to be tested. This becomes even more challenging when monitoring many pathogens. Recently, a high-throughput array was successfully developed and implemented for the molecular detection of 25 tick-borne bacteria and twelve parasites for Ixodes ricinus [14]. This array utilizes a microfluidic system (BioMarkTM dynamic array system, Fluidigm) that is capable of performing parallel real-time PCRs using either 96.96 chips or 48.48 chips resulting in either 9216 or 2304 individual reactions, respectively [15].
The aim of this study was to conduct and evaluate a monitoring of tick-borne human and animal pathogens in D. reticulatus, using a high-throughput array. Accordingly, the high-throughput array used for I. ricinus was modified, and used for the screening of 1.741 D. reticulatus ticks from Belgium, Germany, The Netherlands, and Great Britain. The presence of pathogen DNA was confirmed by conventional PCR followed by sequencing.
2. Materials and methods
2.1. Primers and probes design
Most primers and probes as well as the positive controls were already used and described in a previous study [14]. Pathogens, targeted gene fragments and primers/probe sets used in the microfluidic array approach are listed in Table 1. For each pathogen and tick, primers and probes were designed, two of them specifically for this study. Each design was validated with different type of reference DNA materials (Table 1) by real-time TaqMan PCR on a LightCycler® 480 (LC480) (Roche Applied Science, Germany). Real-time PCR assays were performed in a final volume of 12 μl using the LightCycler® 480 Probe Master Mix 1X (Roche Applied Science, Germany), with primers and probes at 200 nM and 2 μl of control DNA. Thermal cycling conditions were as follows: 95 °C for 5 min, 45 cycles at 95 °C for 10s and 60 °C for 15s and one final cycle of cooling at 40 °C for 10s. Some pathogens were targeted by real time PCRs on two different sequences to improve detection (Table 1).
Table 1.
List of primers, probes and positive controls used for the fluidigm array. Most primers and probes as well as the positive controls were already used and described in a previous study [14]. Length of the PCR product in base pairs (bp).
| Pathogens | Target | Primers | Sequence | Length | Positive control |
|---|---|---|---|---|---|
| Borrelia burgdorferi | rpoB | Bo_bu_rpoB_F Bo_bu_rpoB_R Bo_bu_rpoB_P | GCTTACTCACAAAAGGCGTCTT GCACATCTCTTACTTCAAATCCT AATGCTCTTGGACCAGGAGGACTTTCA | 83 bp | Culture of B31 |
| Borrelia garinii | rpoB | Bo_ga_rpoB_F Bo_ga_rpoB_R Bo_ga_rpoB_P | TGGCCGAACTTACCCACAAAA ACATCTCTTACTTCAAATCCTGC TCTATCTCTTGAAAGTCCCCCTGGTCC | 88 bp | Culture of NE11 |
| Borrelia afzelii | flaB | Bo_af_fla_F Bo_af_fla_R Bo_af_fla_P |
GGAGCAAATCAAGATGAAGCAAT TGAGCACCCTCTTGAACAGG TGCAGCCTGAGCAGCTTGAGCTCC | 116 bp | Culture of VS641 |
| Borrelia valaisiana | ospA | Bo_va_ospA_F Bo_va_ospA_R Bo_va_ospA_P | ACTCACAAATGACAGATGCTGAA GCTTGCTTAAAGTAACAGTACCT TCCGCCTACAAGATTTCCTGGAAGCTT | 135 bp | Culture of VS116 |
| Borrelia miyamotoi | glpQ | B_miy_glpQ_F B_miy_glpQ_R B_miy_glpQ_P | CACGACCCAGAAATTGACACA GTGTGAAGTCAGTGGCGTAAT TCGTCCGTTTTCTCTAGCTCGATTGGG | 94 bp | Plasmida |
| Borrelia spielmanii | fla | Bo_sp_fla_F Bo_sp_fla_R Bo_sp_fla_P |
ATCTATTTTCTGGTGAGGGAGC TCCTTCTTGTTGAGCACCTTC TTGAACAGGCGCAGTCTGAGCAGCTT | 71 bp | Plasmid |
| Borrelia lusitaniae | rpoB | Bo_lu_rpoB_F Bo_lu_rpoB_R Bo_lu_rpoB_P | CGAACTTACTCATAAAAGGCGTC TGGACGTCTCTTACTTCAAATCC TTAATGCTCTCGGGCCTGGGGGACT | 87 bp | Culture of Poti-B1 |
| Borrelia bissettii | rpoB | Bo_bi_rpoB_F Bo_bi_rpoB_R Bo_bi_rpoB_P | GCAACCAGTCAGCTTTCACAG CAAATCCTGCCCTATCCCTTG AAAGTCCTCCCGGCCCAAGAGCATTAA | 118 bp | Plasmida |
| Borrelia spp. | 23SrRNA | Bo_sl_23S_F Bo_sl_23S_R Bo_sl_23S_P | GAGTCTTAAAAGGGCGATTTAGT CTTCAGCCTGGCCATAAATAG AGATGTGGTAGACCCGAAGCCGAGT | 73 bp | Culture of B31 |
| Anaplasma marginale | msp1b | An_ma_msp1_F An_ma_msp1_R An_ma_msp1_P | CAGGCTTCAAGCGTACAGTG GATATCTGTGCCTGGCCTTC ATGAAAGCCTGGAGATGTTAGACCGAG | 85 bp | Experimentally infected cow |
| Anaplasma platys | groEL | An_pl_groEL_F An_pl_groEL_R An_pl_groEL_P | TTCTGCCGATCCTTGAAAACG CTTCTCCTTCTACATCCTCAG TTGCTAGATCCGGCAGGCCTCTGC |
75 bp | Dog blood |
| Anaplasma ovis | msp4 | An_ov_msp4_F An_ov_msp4_R An_ov_msp4_P | TCATTCGACATGCGTGAGTCA TTTGCTGGCGCACTCACATC AGCAGAGAGACCTCGTATGTTAGAGGC | 92 bp | Plasmida |
| Anaplasma bovis | groEL | An_bov_groEL_F An_bov_groEL_R An_bov_groEL_P |
GGGAGATAGTACACATCCTTG CTGATAGCTACAGTTAAGCCC AGGTGCTGTTGGATGTACTGCTGGACC |
73 bp | Plasmida |
| Anaplasma centrale | groEL | An_ce_groEL_F An_ce_groEL_R An_ce_groEL_P | AGCTGCCCTGCTATACACG GATGTTGATGCCCAATTGCTC CTTGCATCTCTAGACGAGGTAAAGGGG | 79 bp | Plasmida |
| Anaplasma phagocytophilum | msp2 | An_ph_msp2_F An_ph_msp2_R An_ph_msp2_P | GCTATGGAAGGCAGTGTTGG GTCTTGAAGCGCTCGTAACC AATCTCAAGCTCAACCCTGGCACCAC | 77 bp | Culture |
| Ehrlichia ruminantium | dsb | Eh_ru_dsb_F Eh_ru_dsb_R Eh_ru_dsb_P | CTCAGAGGGTAATAGATTTACTC GTATGCAATATCTTCAAGCTCAG ACTACAGGCCAAGCACAAGCAGAAAGA | 107 bp | Culture of Gardel |
| Ehrlichia canis | dsb | Eh_ca_dsb_F Eh_ca_dsb_R Eh_ca_dsb_P | AATACTTGGTGAGTCTTCACTCA GTTGCTTGTAATGTAGTGCTGC AAGTTGCCCAAGCAGCACTAGCTGTAC | 110 bp | Plasmida |
| Ehrlichia chaffeensis | dsb | Eh_ch_dsb_F Eh_ch_dsb_R Eh_ch_dsb_P | TATTGCTAATTACCCTCAAAAAGTC GAGCTATCCTCAAGTTCAGATTT ATTGACCTCCTAACTAGAGGGCAAGCA | 117 bp | Amblyomma americanum |
| Neoehrlichia mikurensis | groEL | Nm_groEL_F Nm_groEL_R Nm_groEL_P | AGAGACATCATTCGCATTTTGGA TTCCGGTGTACCATAAGGCTT AGATGCTGTTGGATGTACTGCTGGACC | 96 bp | Ixodes ricinus |
| Rickettsia conorii | 23S-5S ITS | Ri_co_ITS_F Ri_co_ITS_R Ri_co_ITS_P | CTCACAAAGTTATCAGGTTAAATAG CGATACTCAGCAAAATAATTCTCG CTGGATATCGTGGCAGGGCTACAGTAT | 118 bp | Culture |
| Rickettsia slovaca | 23S-5S ITS | Ri_sl_ITS_F Ri_sl_ITS_R Ri_sl_ITS_P |
GTATCTACTCACAAAGTTATCAGG CTTAACTTTTACTACAATACTCAGC TAATTTTCGCTGGATATCGTGGCAGGG | 138 bp | Culture |
| Rickettsia massiliae | 23S-5S ITS | Ri_ma_ITS_F Ri_ma_ITS_R Ri_ma_ITS_P | GTTATTGCATCACTAATGTTATACTG GTTAATGTTGTTGCACGACTCAA TAGCCCCGCCACGATATCTAGCAAAAA | 128 bp | Culture |
| Rickettsia helvetica | 23S-5S ITS | Ri_he_ITS_F Ri_he_ITS_R Ri_he_ITS_P | AGAACCGTAGCGTACACTTAG GAAAACCCTACTTCTAGGGGT TACGTGAGGATTTGAGTACCGGATCGA | 79 bp | Culture |
| Rickettsia aeschlimannii | ITS | Rick_aesch_ITS_F Rick_aesch_ITS_R Rick_aesch_ITS_P |
CTCACAAAGTTATCAGGTTAAATAG CTTAACTTTTACTACGATACTTAGCA TAATTTTTGCTGGATATCGTGGCGGGG |
134 bp | Culture |
| Spotted fever group | gltA | SFG_gltA_F SFG_gltA_R SFG_gltA_P |
CCTTTTGTAGCTCTTCTCATCC GCGATGGTAGGTATCTTAGCAA TGGCTATTATGCTTGCGGCTGTCGGT | 145 bp | |
| Bartonella henselae | pap31 | Bar_he_pap_F Bar_he_pap_R Bar_he_pap_P | CCGCTGATCGCATTATGCCT AGCGATTTCTGCATCATCTGCT ATGTTGCTGGTGGTGTTTCCTATGCAC | 107 bp | Culture of Berlin 1 |
| Bartonella quintana | bqtR | Bar_qu_bqt_F Bar_qu_bqt_R Bar_qu_bqt_P | TCCATCACAAGATCTCCGCG CGTGCCAATGCTCGTAACCA TTTAAGAGAGGAGGTAGAAGAGGCTCC | 80 bp | Culture |
| Francisella tularensis and Francisella-like endosymbionts | tul4 | Fr_tu_tul4_F Fr_tu_tul4_R Fr_tu_tul4_P |
ACCCACAAGGAAGTGTAAGATTA GTAATTGGGAAGCTTGTATCATG AATGGCAGGCTCCAGAAGGTTCTAAGT | 76 bp | Culture of CIP 5612T |
| fopA | Fr_tu_fopA_F Fr_tu_fopA_R Fr_tu_fopA_P | GGCAAATCTAGCAGGTCAAGC CAACACTTGCTTGAACATTTCTAG AACAGGTGCTTGGGATGTGGGTGGTG | 91 bp | ||
| Coxiella burnetii and Coxiella-like | icd | Co_bu_icd_F Co_bu_icd_R Co_bu_icd_P | AGGCCCGTCCGTTATTTTACG CGGAAAATCACCATATTCACCTT TTCAGGCGTTTTGACCGGGCTTGGC | 74 bp | Culture |
| IS1111 | Co_bu_IS_F Co_bu_IS_R Co_bu_IS_P |
TGGAGGAGCGAACCATTGGT CATACGGTTTGACGTGCTGC ATCGGACGTTTATGGGGATGGGTATCC | 86 bp | ||
| Babesia divergens | hsp70 | Bab_di_hsp70_F Bab_di_hsp70_R Bab_di_hsp70_P | CTCATTGGTGACGCCGCTA CTCCTCCCGATAAGCCTCTT AGAACCAGGAGGCCCGTAACCCAGA | 83 bp | Culture of RFS |
| Babesia caballi | RAP1 | Ba_ca_rap1_F Ba_ca_rap1_R Ba_ca_rap1_P | GTTGTTCGGCTGGGGCATC CAGGCGACTGACGCTGTGT TCTGTCCCGATGTCAAGGGGCAGGT | 94 bp | Plasmida |
| Babesia canis (3 subspecies) | RNA 18S | Ba_ca_18S_F Ba_ca_18S_R Ba_ca_18S_P |
TGGCCGTTCTTAGTTGGTGG AGAAGCAACCGGAAACTCAAATA ACCGGCACTAGTTAGCAGGTTAAGGTC | 104 bp | Dog blood |
| Babesia canis vogeli | hsp70 | Ba_vo_hsp70_F Ba_vo_hsp70_R Ba_vo_hsp70_P | TCACTGTGCCTGCGTACTTC TGATACGCATGACGTTGAGAC AACGACTCCCAGCGCCAGGCCAC | 87 bp | Dog blood |
| Babesia venatorum (EU1) | RNA 18S | Ba_EU_18S_F Ba_EU_18S_R Ba_EU_18S_P | GCGCGCTACACTGATGCATT CAAAAATCAATCCCCGTCACG CATCGAGTTTAATCCTGTCCCGAAAGG | 91 bp | Plasmida |
| Babesia microti | CCTeta | Ba_mi_CCT_F Ba_mi_CCT_R Ba_mi_CCT_P | ACAATGGATTTTCCCCAGCAAAA GCGACATTTCGGCAACTTATATA TACTCTGGTGCAATGAGCGTATGGGTA | 145 bp | Culture of R1 |
| Babesia bovis | CCTeta | Ba_bo_CCT_F Ba_bo_CCT_R Ba_bo_CCT_P | GCCAAGTAGTGGTAGACTGTA GCTCCGTCATTGGTTATGGTA TAAAGACAACACTGGGTCCGCGTGG | 100 bp | Culture of MO7 |
| Babesia bigemina | RNA 18S | Ba_bi_18S_F Ba_bi_18S_R Ba_bi_18S_P |
ATTCCGTTAACGAACGAGACC TTCCCCCACGCTTGAAGCA CAGGAGTCCCTCTAAGAAGCAAACGAG | 99 bp | Plasmida |
| Babesia major | CCTeta | Ba_ma_CCT_F Ba_ma_CCT_R Ba_ma_CCT_P | CACTGGTGCGCTGATCCAA TCCTCGAAGCATCCACATGTT AACACTGTCAACGGCATAAGCACCGAT | 75 bp | Plasmida |
| Babesia ovis | RNA 18S | Ba_ov_18S_F Ba_ov_18S_R Ba_ov_18S_P |
TCTGTGATGCCCTTAGATGTC GCTGGTTACCCGCGCCTT TCGGAGCGGGGTCAACTCGATGCAT | 92 bp | Plasmida |
| Theileria equi | ema1 | Th_eq_ema1_F Th_eq_ema1_R Th_eq_ema1_P | GGCTCCGGCAAGAAGCACA CTTGCCATCGACGACCTTGA CTTCAAGGCTCCAGGCAAGCGCGT | 66 bp | Plasmida |
| Theileria annulata | RNA 18S | Th_an_18S_F Th_an_18S_R Th_an_18S_P |
GCGGTAATTCCAGCTCCAATA AAACTCCGTCCGAAAAAAGCC ACATGCACAGACCCCAGAGGGACAC | 126 bp | Culture of D7 |
| Ixodes ricinus | ITS2 | Ix_ri_ITS2_F Ix_ri_ITS2_R Ix_ri_ITS2_P |
CGAAACTCGATGGAGACCTG ATCTCCAACGCACCGACGT TTGTGGAAATCCCGTCGCACGTTGAAC | 77 bp | Tick |
| Ixodes persulcatus | ITS2 | Ix_pe_ITS2_F Ix_pe_ITS2_R Ix_pe_ITS2_P | TGCGTTGCGTCTTCTCTTGTT TCGATAAAACCAGGTAGGAGGA TTTCGGAGCAAGTACAGAGGGAGCAAA | 111 bp | Tick |
| Dermacentor reticulatus | ITS2 | De_re_ITS2_F De_re_ITS2_R De_re_ITS2_P | AACCCTTTTCCGCTCCGTG TTTTGCTAGAGCTCGACGTAC TACGAAGGCAAACAACGCAAACTGCGA | 83 bp | Tick |
| Dermacentor marginatus | ITS2 | De_ma_ITS2_F De_ma_ITS2_R De_ma_ITS2_P | GCACGTTGCGTTGTTTGCC CCGCTCCGCGCAAGAATCT TTCGGAGTACGTCGAGCTCTAGCAGA | 139 bp | Tick |
| Escherichia coli | eae | eae-F eae-R eae-P |
CATTGATCAGGATTTTTCTGGTGATA CTCATGCGGAAATAGCCGTTA ATAGTCTCGCCAGTATTCGCCACCAATACC |
102 bp | Culture of EDL933 |
Plasmids are recombinant pBluescript IISK+ containing the target gene.
2.2. Study area and tick collection
The distribution of D. reticulatus in Great Britain was recently published by Medlock et al. (2017), with three main foci in Wales, Devon and Essex [16]. Samples from three separate locations in Wales (Morfa Harlech, Morfa Gwyllt and Borth) and one location in Essex (Old Hall marshes) were selected. Questing ticks were collected during spring using blanket dragging, with samples from Wales collected during 2010–2012 and from Essex in 2016. Dermacentor reticulatus ticks were collected by blanket dragging in Belgium at four locations: Beveren, De Panne, Moen and Straimont. Beveren and Moen were visited in 2010 [17]. Moen and Beveren were visited in 2011 on a few occasions. Ticks were collected in De Panne in 2012. Straimont was sampled on a few occasions in 2013. Ticks were collected using blanket dragging in Germany on 60 sampling sites in the federal state of Bavaria, Germany between 2010 and 2013 and D. reticulatus ticks were found at three of them. Sites were sampled at least once in spring or autumn. Ticks from the Netherlands were collected using blanket dragging from several locations in coastal areas, mostly situated in the southwestern part of the country. Typical habitats were moist open grassland grazed by cattle, in nature reserves along loughs. Surveillance took place in 2014, 2015 and 2016 and was most successful in the months of March and October.
2.3. DNA extraction and pre-amplification with a mixture of pathogen-specific primers
Ticks were identified to species level using a stereomicroscope and morphological keys [18]. Dermacentor reticulatus ticks were cut into pieces using disposable surgical knives and lysed overnight in lysis buffer (ATL buffer, Qiagen, Germany). The DNA extraction was performed using the Blood and Tissue kit (Qiagen, Germany). Ticks from Germany were washed twice in distilled water, air-dried and DNA was extracted individually using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions for tissue. Ticks were disrupted in a TissueLyser (Qiagen) with 80μl phosphate buffered saline, pH7.4, and a 5mm stainless steel bead in 2ml Eppendorf tubes for 5 min at 20bpm. Incubation was carried out over night at 56 °C. For every 24 to 48 samples, a negative extraction control containing sterile water was included. Quality and quantity of the extracted DNA were checked with a photospectrometer (NanoDrop®ND-1000; PeqLab, Erlangen, Germany).The TaqMan PreAmp Master Mix (Applied Biosystems, France) was used for the pre-amplification of DNA lysates according to the manufacturer's instructions (TaqMan PreAmp Master Mix Kit Protocol). All forward and reverse primers, except those targeting tick species (Table 1), were pooled and mixed at a final concentration of 200 nM each. The reaction was performed in a final volume of 5 μl containing 2.5 μl TaqMan PreAmp Master Mix, 1.2 μl of pooled primers mix and 1.3 μl of DNA lysate, with one cycle at 95 °C for 10 min, 14 cycles at 95 °C for 15 sec and 4 min at 60 °C. At the end of the cycling program the reactions were diluted 1:10. Pre-amplified DNAs were stored at -20 °C until further processing.
2.4. High-throughput real-time PCR system
The BioMarkTM real-time PCR system (Fluidigm, USA) was used for high-throughput microfluidic real-time PCR amplification using the 48.48 dynamic arrays (Fluidigm) as described [14]. In short, amplifications were performed using 6-carboxyfluorescein (FAM)- and black hole quencher (BHQ1)-labeled TaqMan probes with TaqMan Gene expression master mix (Applied Biosystems, France). The thermal profile comprised 2 min at 50 °C and 10 min at 95 °C, followed by 40 cycles of a 2-step amplification profile consisting of 15 s at 95 °C for denaturation and 1 min at 60 °C for annealing and extension. Data were acquired on the BioMarkTM Real-Time PCR System and analyzed using the Fluidigm Real-time PCR Analysis software to obtain cross point (Cp) values. Negative controls with water were included per chip. The detection of D. reticulatus DNA served as a confirmation of the tick species tested and as a positive control of the DNA extraction. A positive processing control, which is a DNA extract from the EDL933 strain of Escherichia coli, was added to each sample.
2.5. Confirmation by PCR and sequencing
Analysis of the qPCR was performed using the second derivative calculations for Cp (crossing point) values. Curves were assessed visually. A qPCR was considered positive when the Cp values were <40 and the amplification curves were sigmoid shaped. Alternatively, confirmation of the presence of pathogen DNA in samples was performed by conventional PCRs (Table 2), using specific primers, targeting different genes or regions than the ones used in the BioMarkTM system. Amplicons were sequenced by dideoxy-dye terminal sequencing of both strands by Baseclear (Leiden, Netherlands). The sequences were stored and processed in Bionumerics (Version 7.1, Applied Math, Belgium) after subtraction of the primer sequences, and compared with known sequences from GenBank nucleotide sequence database (http://www.ncbi.nlm.nih.gov).
Table 2.
PCR-based methods used to confirm the presence of pathogenic DNA in ticks. A qPCR was considered positive when the Cp values were <40 and the amplification curves were sigmoid shaped. Some confirmation tests only detect several (geno)species of a pathogens. A PCR was considered positive when it could be sequenced using Sanger sequencing and when the obtained sequence was at least 99% similar to known sequences from GenBank.
| Pathogen | Target | PCR | Reference |
|---|---|---|---|
| Borrelia spp. | OspA | qPCR | [26] |
| Flagelin B | qPCR | [26] | |
| 23S-5S IGS | PCR | [27] | |
| GlpQ | PCR | [28] | |
| Flagelin B | PCR | [28] | |
| Bossp_16S-rRNA | PCR | [29] | |
| Bossp_IGS | Nested- PCR | [30] | |
| Bossp_p66 | Nested- PCR | [31] | |
| MLST (8 targets) | Nested- PCR | [32] | |
| E. canis | Msp2 | qPCR | [33] |
| GroEL | qPCR | [34] | |
| 16S-rRNA | PCR | [35] | |
| GroEL | Nested-PCR | [36] | |
| 16S -rRNA | PCR | [37] | |
| Anaplasma spp. | Msp2 | qPCR | [33] |
| GroEL | qPCR | [34] | |
| 16S-rRNA | PCR | [35] | |
| GroEL | Nested-PCR | [36] | |
| Babesia & Theileria spp. | 18S-rRNA | qPCR | [38] |
| 18S-rRNA | PCR | [39] | |
| BabG | PCR | [40] | |
| F. tularensis | FopA | qPCR | [41] |
| ISFtu | qPCR | [41] | |
| Coxiella spp. | IS1111 | qPCR | [42] |
| Com | qPCR | [42] | |
| SFG-Rickettsia | GltA | qPCR | [19] |
| GltA | PCR | [43] | |
| 16S-rRNA | PCR | [44] | |
| OmpA | PCR | [45] | |
| OmpB | PCR | [46] |
3. Results
3.1. Fluidigm-array
Most primer and probe combinations, 46 out of 48 (Table 1), were successfully tested and validated on I. ricinus [14]. Primers and probes targeting specifically Anaplasma bovis and Rickettsia aeschlimannii were designed for this study (Table 1). These primers and probes identified their corresponding positive control samples via Taqman® real-time PCRs on a LightCycler 480 apparatus, but did not react with any of the other positive control samples described in Table 1. Several of the targeted pathogens cannot be cultured, or are rare and consequently unavailable from field samples, therefore plasmids containing target sequences were used as positive controls. A total of 1.753 tick lysates were tested using the BioMarkTM system. Seven samples from the Netherlands were positive on the I. ricinus target and negative for D. reticulatus. The results from these samples were discarded from further analyses. One sample was positive for both the I. ricinus and the D. reticulatus target, probably due to a cross-contamination somewhere in the processing of the samples (Table 3). Five samples did not react with any of the tick targets, and were negative for all pathogens, whereas the E. coli target was positive. The results from these samples were also discarded from further analyses.
Table 3.
Number of positive tick lysates from the four countries using the microfluidic tool (BioMarkTMsystem). Pathogens detected with the microfluidic array are in bold. *One sample was positive for targets of the three different B. burgdorferi s.l. genospecies.
| Pathogen | Belgium | Great Britain | Germany | The Netherlands |
|---|---|---|---|---|
| Samples tested | 513 | 113 | 255 | 860 |
| Borrelia spp. | 32 | 8 | 16 | 64 |
| B. burgdorferi s.s | 0 | 0 | 0 | 0 |
| B. garinii | 0 | 0 | 0 | 1* |
| B. afzelii | 0 | 0 | 0 | 1* |
| B. valaisiana | 0 | 0 | 0 | 0 |
| B. lusitaniae | 0 | 0 | 0 | 0 |
| B. spielmanii | 0 | 0 | 0 | 1* |
| B. bissetti | 0 | 0 | 0 | 0 |
| B. miyamotoi | 0 | 0 | 0 | 3 |
| Anaplasma marginale | 0 | 0 | 0 | 1 |
| A. platys | 0 | 0 | 0 | 0 |
| A. phagocytophilum | 1 | 0 | 1 | 3 |
| A. ovis | 0 | 0 | 0 | 0 |
| A. centrale | 0 | 0 | 0 | 0 |
| A. bovis | 0 | 0 | 0 | 0 |
| E. chaffeensis | 0 | 0 | 0 | 0 |
| E. ruminantium | 0 | 0 | 0 | 0 |
| E. canis | 5 | 3 | 10 | 8 |
| Neoehrlichia mikurensis | 0 | 0 | 0 | 0 |
| Rickettsia conorii | 0 | 0 | 0 | 0 |
| R. slovaca | 0 | 0 | 0 | 0 |
| R. massiliae | 0 | 0 | 0 | 0 |
| R. helvetica | 3 | 0 | 0 | 1 |
| R. aeschlimannii | 0 | 0 | 0 | 0 |
| SFG Rickettsia | 44 | 34 | 87 | 2 |
| Bartonella henselae | 0 | 0 | 0 | 0 |
| B. quintana | 0 | 0 | 0 | 0 |
| Francisella tularensis (tul4) | 0 | 0 | 0 | 0 |
| Francisella tularensis (fopA) | 458 | 112 | 251 | 834 |
| Coxiella burnetii (icd) | 1 | 0 | 0 | 0 |
| Coxiella burnetii (IS1111) | 0 | 0 | 0 | 0 |
| Babesia divergens | 0 | 3 | 0 | 0 |
| B. microti | 0 | 0 | 0 | 0 |
| Babesia canis | 0 | 16 | 0 | 0 |
| B. vogeli | 0 | 0 | 54 | 33 |
| B. bovis | 9 | 0 | 0 | 0 |
| B. caballi | 0 | 0 | 0 | 0 |
| B. venatorum | 0 | 0 | 0 | 0 |
| B. bigemina | 0 | 0 | 0 | 0 |
| B. major | 0 | 0 | 0 | 0 |
| B. ovis | 0 | 0 | 0 | 0 |
| Theileria equi | 0 | 0 | 1 | 0 |
| T. annulata | 0 | 0 | 0 | 0 |
| Ixodes ricinus | 0 | 0 | 0 | 1 |
| I. persulcatus | 0 | 0 | 0 | 0 |
| Dermacentor reticulatus | 513 | 113 | 255 | 860 |
| D. marginatus | 0 | 0 | 0 | 0 |
| Positive processing control | 513 | 113 | 255 | 860 |
The remaining 1741 lysates were positive with the D. reticulatus target and analysed for the presence and absence of pathogen DNA. Among the targeted pathogens, 18 bacteria (B. burgdorferi s.s, B. valaisiana, B. lusitaniae, B. bissetti, A. platys, A. ovis, A. centrale, A. bovis, E. chaffeensis, E. ruminantium, Neoehrlichia mikurensis, Rickettsia conorii, R. slovaca, R. massiliae, R. helvetica, R. aeschlimannii, Bartonella henselae, and B. quintana) and eight protozoan parasites (Babesia microti, B. bovis, B. caballi, B. venatorum, B. bigemina, B. major, B. ovis, and T. annulata) were not detected in any of the 1741 D. reticulatus lysates. Of the 1741 D. reticulatus-positive lysates, samples were positive for Borrelia spp. (n = 120), three targets of B. burgdorferi s.l. (n = 1), B. miyamotoi (n = 3), A. marginale (n = 1), A. phagocytophilum (n = 5), E. canis (n = 26), R. helvetica (n = 4), SFG Rickettsia (n = 167), F. tularensis or F. tularensis-like endosymbionts (n = 1655), Coxiella burnetii or Coxiella-like bacteria (n = 1), Babesia canis (n = 16), B. divergens (n = 3), B. vogeli (n = 87), and Theileria equi (n = 1) using the BioMarkTM (Table 3). In order to confirm the results obtained on the BioMarkTM system and to validate this new method on D. reticulatus, qPCR, classical PCR and sequencing were performed on extracted DNA for a subset of field samples.
3.2. Confirmation
The presence of B. canis was confirmed by a qPCR targeting the 18S-rRNA fragment in all 16 samples, and could be confirmed by conventional PCR followed by sequencing in 10 out of 16 samples. The ten obtained 18S-rRNA sequences were all identical and 100% similar to an 18S-rRNA sequence from the B. canis isolates Bc1, A1/A2 and several others retrieved from Genbank (accession numbers AY072926 and KX839230). From the 167 samples that reacted with the SFG Rickettsia on the array, 128 were confirmed by a qPCR targeting SFG Rickettsia [19] and 103 could be confirmed by a conventional PCR followed by sequencing. All these GltA sequence fragments were >99% identical and >99% similar to the IM16 isolate of R. raoultii (accession number KY474576).
The presence of B. burgdorferi s.l., which reacted with three targets in the high-throughput array, was confirmed by the OspA qPCR (Table 2), but could not be confirmed with any of the other confirmation (q)PCR tests for B. burgdorferi s.l. or Borrelia spp.. None of the 120 Borrelia spp.-positive and three B. miyamotoi samples could be amplified or confirmed with any of the 16 control Borrelia spp. and B. burgdorferi s.l. (q)PCRs (Table 4). The presence of A. phagocytophilum, A. marginale, E. canis, R. helvetica, F. tularensis, C. burnetii, B. divergens, B. vogeli, and T. equi could not be confirmed either.
Table 4.
Confirmed presence of tick-borne pathogen DNA in D. reticulatus. Samples which were positive in the microfluidic array were retested by other qPCR or PCR tests (Table 2) to confirm the presence of DNA of a tick-borne pathogen.
| Pathogen | Fluidigm positive | Confirmed (from Table 2) | Countries |
|---|---|---|---|
| Borrelia spp. | 120 | No | |
| B. burgdorferi s.l. | 1 | 1 (qPCR) | Germany |
| B. miyamotoi | 3 | No | |
| Anaplasma marginale | 1 | No | |
| A. phagocytophilum | 5 | No | |
| E. canis | 26 | No | |
| Rickettsia helvetica | 4 | No | |
| SFG Rickettsia(R. raoultii) | 167 | 128 (qPCR), 103 (PCR/Seq) | All countries |
| F. tularensis and FLEs | 1655 | No | |
| Coxiella burnetii and Coxiella-like | 1 | No | |
| Babesia canis | 16 | 16 (qPCR), 10 (PCR/Seq) | Great Britain |
| B. divergens | 3 | No | |
| B. vogeli | 87 | No | |
| Theileria equi | 1 | No |
4. Discussion
In this study, we evaluated a PCR-based method using multiple primers and probe sets to perform high-throughput monitoring of pathogens in an emerging tick species from Europe. An initial step of pre-amplification was necessary to increase the sensitivity of the array, otherwise not all positive DNA controls could be detected. The array enabled important quality control steps concurrent with pathogen detection, namely the confirmation of the presence of tick DNA, the (anticipated) tick species and a positive processing control. These controls are often neglected/omitted in other tick screening studies [20, 21]. As a consequence, twelve samples were excluded from further analyses in this study. In one sample, the presence of I. ricinus and D. reticulatus DNA was detected. We assume that a contamination had taken place during the DNA extraction or PCR preparation.
Two commonly reported pathogens in D. reticulatus, B. canis and R. raoultii were detected by the array, which could also be confirmed by established qPCR and conventional PCR followed by sequencing. Not all B. canis- and R. raoultii-positive samples could be confirmed (Table 4), probably because of the relatively low DNA-load in the samples, as was evidenced by high Cp-values in these samples (not shown). The detection of F. tularensis using the fopA-target was compromised by the presence of Francisella-like endosymbionts in 95% of the D. reticulatus samples (Table 3, [22]). The other F. tularensis marker, tul4, remained negative. Therefore, we conclude that F. tularensis is absent or not-detectable in the investigated samples. Furthermore, the primers and probe sets for the sensitive and specific detection of F. tularensis need further optimization, so the current results obtained for these species should be interpreted with care.
Three subspecies of B. canis could be detected by the primer/probe set targeting a small fragment of the 18SrRNA gene. Another primer/probe set targeting a fragment of the hsp70 gene was used for the specific detection of B. canis vogeli. Both of these qPCRs were specific when they were used on DNA reference samples and didn't cross-react with I. ricinus ticks. The presence of B. canis could be confirmed by conventional PCR and sequencing. However, the presence of B. canis vogeli in the B. canis vogeli-specific-positive samples from the array could not be confirmed. High-throughput screenings of different tick species (D. marginatus, Rhipicephalus bursa, and Amblyomma variegatum), also generated false-positive results, as they could never be confirmed by nested PCR (not shown). Therefore, a new primer/probe set should be designed for the detection of B. canis vogeli.
The presence of E. canis DNA in 28 samples and several negative controls could not be confirmed by alternative PCR-based methods. Probably, the signal arose from a previous laboratory contamination when a high concentration of the positive control, a plasmid, was accidentally used (not shown). As discussed previously, laboratory contaminations can be problematic when using DNA amplification techniques for the detection of pathogens [23]. This issue can be resolved by designing a new primers/probe set targeting another gene fragment of E. canis.
The array detected DNA of several tick-borne pathogens, namely R. helvetica, A. phagocytophilum, B. burgdorferi s.l., C. burnetii and B. divergens. These pathogens have been detected in D. reticulatus by means of molecular methods before [23], but their presence could not be confirmed by conventional PCRs in the present study. With molecular techniques alone, it is not possible to infer the presence of infectious agents in D. reticulatus, or to infer its vector competence for these agents. Further investigations on the vector competence of D. reticulatus are necessary before the results of these pathogens are meaningful for surveillance of vector-borne pathogens.
Both A. marginale and T. equi were detected by the array, each in one sample, but neither of them could be confirmed by a confirmatory PCR. One explanation might be that the array is more sensitive than the conventional PCRs, for example due to the pre-amplification step. Another possibility is that the primers/probe of T. equi is cross reacting with other samples. For this, new primer/probe sets are currently being designed. It was not possible to investigate this further, due to the limited number of positive samples (n = 1, each). Thus, these results should be interpreted with care. Further validation of the detection properties of the primer/probe combinations for A. marginale and T. equi should be performed in future studies.
This array has been developed for epidemiologic rather than diagnostic purposes. Therefore, detection limits and sensitivity have not been experimentally determined. Furthermore, the normal range of the pathogen concentration present in a naturally infected tick is extremely difficult, if not impossible, to determine. The detection limit of a pathogen in a defined area is also determined by the infection rate of a pathogen in the tick species. For example, other studies have already shown the presence of B. canis in The Netherlands, where B. canis was not detected in the 860 tick lysates [24, 25]. In other words, a sufficient number of ticks according to the expected prevalence should be screened to enable the detection of some pathogens.
5. Conclusion
This study clearly demonstrates the utility of a fast tool that allows comprehensive testing of high numbers of tick-borne pathogens in ticks, which can be easily customized to fit regional demands or to screen samples for new or emerging diseases. This study further demonstrates the importance of thorough validation of this novel approach and that careful interpretation of the results is necessary.
Further studies will have to confirm whether this approach heralds the necessary breakthrough in epidemiological surveillance of vector-borne pathogens, broadening the monitoring of human and animal diseases.
Declarations
Author contribution statement
Hein Sprong, Sara Moutailler: conceived and designed the experiments; Wrote the paper.
Manoj Fonville: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data.
Cornelia Silaghi, Lisa Weis: Conceived and designed the experiments; Performed the experiments; Contributed reagents, materials, analysis tools or data.
Arjan Stroo, Adolfo Ibañez-Justicia, Jolyon Medlock, Paul Heyman, Benjamin Cull, Kayleigh Hansford: Conceived and designed the experiments; Performed the experiments.
Christel Cochez: Contributed reagents, materials, analysis tools or data.
Arieke Docters van Leeuwen, Elodie Devillers: Performed the experiments; Analyzed and interpreted the data.
Funding statement
This work was supported by the Dutch Ministry of Health, Welfare and Sport (VWS). This project was done under the framework of EurNegVec COST Action TD1303.
Competing interest statement
The authors declare no conflict of interest.
Additional information
Additional data associated with this study is available on request.
References
- 1.Foldvari G., Siroky P., Szekeres S., Majoros G., Sprong H. Dermacentor reticulatus: a vector on the rise. Parasit Vectors. 2016;9(1):314. doi: 10.1186/s13071-016-1599-x. https://www.ncbi.nlm.nih.gov/pubmed/27251148 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Sprong H., Azagi T., Hoornstra D., Nijhof A.M., Knorr S., Baarsma M.E. Control of Lyme borreliosis and other Ixodes ricinus-borne diseases. Parasit Vectors. 2018;11(1):145. doi: 10.1186/s13071-018-2744-5. https://www.ncbi.nlm.nih.gov/pubmed/29510749 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Rubel F., Brugger K., Pfeffer M., Chitimia-Dobler L., Didyk Y.M., Leverenz S. Geographical distribution of dermacentor marginatus and dermacentor reticulatus in Europe. Ticks Tick Borne Dis. 2016;7(1):224–233. doi: 10.1016/j.ttbdis.2015.10.015. https://www.ncbi.nlm.nih.gov/pubmed/26552893 [DOI] [PubMed] [Google Scholar]
- 4.Medlock J.M., Jameson L.J., Phipps L.P. Status of dermacentor reticulatus in the UK. Vet. Rec. 2011;168(14):386–387. doi: 10.1136/vr.d2186. https://www.ncbi.nlm.nih.gov/pubmed/21498271 [DOI] [PubMed] [Google Scholar]
- 5.Siroky P., Kubelova M., Bednar M., Modry D., Hubalek Z., Tkadlec E. The distribution and spreading pattern of Dermacentor reticulatus over its threshold area in the Czech Republic--how much is range of this vector expanding? Vet. Parasitol. 2011;183(1–2):130–135. doi: 10.1016/j.vetpar.2011.07.006. https://www.ncbi.nlm.nih.gov/pubmed/21802855 [DOI] [PubMed] [Google Scholar]
- 6.Karbowiak G. The occurrence of the Dermacentor reticulatus tick--its expansion to new areas and possible causes. Ann Parasitol. 2014;60(1):37–47. https://www.ncbi.nlm.nih.gov/pubmed/24930245 [PubMed] [Google Scholar]
- 7.Kloch A., Mierzejewska E.J., Karbowiak G., Slivinska K., Alsarraf M., Rodo A. Origins of recently emerged foci of the tick Dermacentor reticulatus in central Europe inferred from molecular markers. Vet. Parasitol. 2017;237:63–69. doi: 10.1016/j.vetpar.2017.02.020. https://www.ncbi.nlm.nih.gov/pubmed/28285892 [DOI] [PubMed] [Google Scholar]
- 8.Hofmeester T.R., van der Lei P.B., Docters van Leeuwen A., Sprong H., van Wieren S.E. New foci of Haemaphysalis punctata and Dermacentor reticulatus in The Netherlands. Ticks Tick Borne Dis. 2016;7(2):367–370. doi: 10.1016/j.ttbdis.2015.12.009. https://www.ncbi.nlm.nih.gov/pubmed/26726807 [DOI] [PubMed] [Google Scholar]
- 9.Portillo A., Santibanez S., Garcia-Alvarez L., Palomar A.M., Oteo J.A. Rickettsioses in Europe. Microb. Infect. 2015;17(11–12):834–838. doi: 10.1016/j.micinf.2015.09.009. https://www.ncbi.nlm.nih.gov/pubmed/26384814 [DOI] [PubMed] [Google Scholar]
- 10.Aubry P., Geale D.W. A review of bovine anaplasmosis. Transbound Emerg. Dis. 2011;58(1):1–30. doi: 10.1111/j.1865-1682.2010.01173.x. https://www.ncbi.nlm.nih.gov/pubmed/21040509 [DOI] [PubMed] [Google Scholar]
- 11.Solano-Gallego L., Sainz A., Roura X., Estrada-Pena A., Miro G. A review of canine babesiosis: the European perspective. Parasites Vectors. 2016;9(1):336. doi: 10.1186/s13071-016-1596-0. https://www.ncbi.nlm.nih.gov/pubmed/27289223 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Braks M., Medlock J.M., Hubalek Z., Hjertqvist M., Perrin Y., Lancelot R. Vector-borne disease intelligence: strategies to deal with disease burden and threats. Front Public Health. 2014;2:280. doi: 10.3389/fpubh.2014.00280. https://www.ncbi.nlm.nih.gov/pubmed/25566522 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Braks M., van der Giessen J., Kretzschmar M., van Pelt W., Scholte E.J., Reusken C. Towards an integrated approach in surveillance of vector-borne diseases in Europe. Parasit Vectors. 2011;4:192. doi: 10.1186/1756-3305-4-192. https://www.ncbi.nlm.nih.gov/pubmed/21967706 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Michelet L., Delannoy S., Devillers E., Umhang G., Aspan A., Juremalm M. High-throughput screening of tick-borne pathogens in Europe. Front. Cell Infect. Microbiol. 2014;4:103. doi: 10.3389/fcimb.2014.00103. https://www.ncbi.nlm.nih.gov/pubmed/25120960 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Liu J., Hansen C., Quake S.R. Solving the "world-to-chip" interface problem with a microfluidic matrix. Anal. Chem. 2003;75(18):4718–4723. doi: 10.1021/ac0346407. https://www.ncbi.nlm.nih.gov/pubmed/14674446 [DOI] [PubMed] [Google Scholar]
- 16.Medlock J.M., Hansford K.M., Vaux A.G.C., Cull B., Abdullah S., Pietzsch M.E. Distribution of the tick Dermacentor reticulatus in the United Kingdom. Med. Vet. Entomol. 2017;31(3):281–288. doi: 10.1111/mve.12235. https://www.ncbi.nlm.nih.gov/pubmed/28419493 [DOI] [PubMed] [Google Scholar]
- 17.Cochez C., Lempereur L., Madder M., Claerebout E., Simons L., De Wilde N. Foci report on indigenous Dermacentor reticulatus populations in Belgium and a preliminary study of associated babesiosis pathogens. Med. Vet. Entomol. 2012;26(3):355–358. doi: 10.1111/j.1365-2915.2011.00998.x. https://www.ncbi.nlm.nih.gov/pubmed/22211927 [DOI] [PubMed] [Google Scholar]
- 18.Estrada-Peña A., Bouattour A., Camicas J.-L., Walker A.R. University of Zaragoza; Zaragoza: 2004. Ticks of Domestic Animals in the Mediterranean Region. A Guide to Identification of Species. [Google Scholar]
- 19.Stenos J., Graves S.R., Unsworth N.B. A highly sensitive and specific real-time PCR assay for the detection of spotted fever and typhus group Rickettsiae. Am. J. Trop. Med. Hyg. 2005;73(6):1083–1085. https://www.ncbi.nlm.nih.gov/pubmed/16354816 [PubMed] [Google Scholar]
- 20.Takken W., van Vliet A.J., Verhulst N.O., Jacobs F.H., Gassner F., Hartemink N. Acarological risk of Borrelia burgdorferi sensu lato infections across space and time in The Netherlands. Vector Borne Zoonotic Dis. 2017;17(2):99–107. doi: 10.1089/vbz.2015.1933. https://www.ncbi.nlm.nih.gov/pubmed/27893309 [DOI] [PubMed] [Google Scholar]
- 21.Coipan E.C., Jahfari S., Fonville M., Maassen C.B., van der Giessen J., Takken W. Spatiotemporal dynamics of emerging pathogens in questing Ixodes ricinus. Front Cell Infect Microbiol. 2013;3:36. doi: 10.3389/fcimb.2013.00036. https://www.ncbi.nlm.nih.gov/pubmed/23908971 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Michelet L., Joncour G., Devillers E., Torina A., Vayssier-Taussat M., Bonnet S.I. Tick species, tick-borne pathogens and symbionts in an insular environment off the coast of Western France. Ticks Tick Borne Dis. 2016;7(6):1109–1115. doi: 10.1016/j.ttbdis.2016.08.014. https://www.ncbi.nlm.nih.gov/pubmed/27622976 [DOI] [PubMed] [Google Scholar]
- 23.Tijsse-Klasen E., Koopmans M.P., Sprong H. Tick-borne pathogen - reversed and conventional discovery of disease. Front Public Health. 2014;2:73. doi: 10.3389/fpubh.2014.00073. https://www.ncbi.nlm.nih.gov/pubmed/25072045 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Jongejan F., Ringenier M., Putting M., Berger L., Burgers S., Kortekaas R. Novel foci of Dermacentor reticulatus ticks infected with Babesia canis and Babesia caballi in The Netherlands and in Belgium. Parasites Vectors. 2015;8:232. doi: 10.1186/s13071-015-0841-2. https://www.ncbi.nlm.nih.gov/pubmed/25889392 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Matjila T.P., Nijhof A.M., Taoufik A., Houwers D., Teske E., Penzhorn B.L. Autochthonous canine babesiosis in The Netherlands. Vet. Parasitol. 2005;131(1–2):23–29. doi: 10.1016/j.vetpar.2005.04.020. https://www.ncbi.nlm.nih.gov/pubmed/15923085 [DOI] [PubMed] [Google Scholar]
- 26.Heylen D., Tijsse E., Fonville M., Matthysen E., Sprong H. Transmission dynamics of Borrelia burgdorferi s.l. in a bird tick community. Environ. Microbiol. 2013;15(2):663–673. doi: 10.1111/1462-2920.12059. https://www.ncbi.nlm.nih.gov/pubmed/23279105 [DOI] [PubMed] [Google Scholar]
- 27.Coipan E.C., Fonville M., Tijsse-Klasen E., van der Giessen J.W., Takken W., Sprong H. Geodemographic analysis of Borrelia burgdorferi sensu lato using the 5S-23S rDNA spacer region. Infect. Genet. Evol. 2013;17:216–222. doi: 10.1016/j.meegid.2013.04.009. https://www.ncbi.nlm.nih.gov/pubmed/23602839 [DOI] [PubMed] [Google Scholar]
- 28.Hovius J.W., de Wever B., Sohne M., Brouwer M.C., Coumou J., Wagemakers A. A case of meningoencephalitis by the relapsing fever spirochaete Borrelia miyamotoi in Europe. Lancet. 2013;382(9892):658. doi: 10.1016/S0140-6736(13)61644-X. https://www.ncbi.nlm.nih.gov/pubmed/23953389 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Ornstein K., Barbour A.G. A reverse transcriptase-polymerase chain reaction assay of Borrelia burgdorferi 16S rRNA for highly sensitive quantification of pathogen load in a vector. Vector Borne Zoonotic Dis. 2006;6(1):103–112. doi: 10.1089/vbz.2006.6.103. https://www.ncbi.nlm.nih.gov/pubmed/16584333 [DOI] [PubMed] [Google Scholar]
- 30.Bunikis J., Garpmo U., Tsao J., Berglund J., Fish D., Barbour A.G. Sequence typing reveals extensive strain diversity of the Lyme borreliosis agents Borrelia burgdorferi in North America and Borrelia afzelii in Europe. Microbiology. 2004;150(Pt 6):1741–1755. doi: 10.1099/mic.0.26944-0. https://www.ncbi.nlm.nih.gov/pubmed/15184561 [DOI] [PubMed] [Google Scholar]
- 31.Bunikis J., Tsao J., Garpmo U., Berglund J., Fish D., Barbour A.G. Typing of Borrelia relapsing fever group strains. Emerg. Infect. Dis. 2004;10(9):1661–1664. doi: 10.3201/eid1009.040236. https://www.ncbi.nlm.nih.gov/pubmed/15498172 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Coipan E.C., Jahfari S., Fonville M., Oei G.A., Spanjaard L., Takumi K. Imbalanced presence of Borrelia burgdorferi s.l. multilocus sequence types in clinical manifestations of Lyme borreliosis. Infect. Genet. Evol. 2016;42:66–76. doi: 10.1016/j.meegid.2016.04.019. https://www.ncbi.nlm.nih.gov/pubmed/27125686 [DOI] [PubMed] [Google Scholar]
- 33.Courtney J.W., Kostelnik L.M., Zeidner N.S., Massung R.F. Multiplex real-time PCR for detection of anaplasma phagocytophilum and Borrelia burgdorferi. J. Clin. Microbiol. 2004;42(7):3164–3168. doi: 10.1128/JCM.42.7.3164-3168.2004. https://www.ncbi.nlm.nih.gov/pubmed/15243077 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Jahfari S., Fonville M., Hengeveld P., Reusken C., Scholte E.J., Takken W. Prevalence of Neoehrlichia mikurensis in ticks and rodents from north-west Europe. Parasit Vectors. 2012;5:74. doi: 10.1186/1756-3305-5-74. https://www.ncbi.nlm.nih.gov/pubmed/22515314 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Siarkou V.I., Mylonakis M.E., Bourtzi-Hatzopoulou E., Koutinas A.F. Sequence and phylogenetic analysis of the 16S rRNA gene of Ehrlichia canis strains in dogs with clinical monocytic ehrlichiosis. Vet. Microbiol. 2007;125(3–4):304–312. doi: 10.1016/j.vetmic.2007.05.021. https://www.ncbi.nlm.nih.gov/pubmed/17624694 [DOI] [PubMed] [Google Scholar]
- 36.Alberti A., Zobba R., Chessa B., Addis M.F., Sparagano O., Pinna Parpaglia M.L. Equine and canine Anaplasma phagocytophilum strains isolated on the island of Sardinia (Italy) are phylogenetically related to pathogenic strains from the United States. Appl. Environ. Microbiol. 2005;71(10):6418–6422. doi: 10.1128/AEM.71.10.6418-6422.2005. https://www.ncbi.nlm.nih.gov/pubmed/16204571 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Schouls L.M., Van De Pol I., Rijpkema S.G., Schot C.S. Detection and identification of Ehrlichia, Borrelia burgdorferi sensu lato, and Bartonella species in Dutch Ixodes ricinus ticks. J. Clin. Microbiol. 1999;37(7):2215–2222. doi: 10.1128/jcm.37.7.2215-2222.1999. https://www.ncbi.nlm.nih.gov/pubmed/10364588 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Oines O., Radzijevskaja J., Paulauskas A., Rosef O. Prevalence and diversity of Babesia spp. in questing Ixodes ricinus ticks from Norway. Parasit Vectors. 2012;5:156. doi: 10.1186/1756-3305-5-156. https://www.ncbi.nlm.nih.gov/pubmed/22862883 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Wielinga P.R., Fonville M., Sprong H., Gaasenbeek C., Borgsteede F., van der Giessen J.W. Persistent detection of Babesia EU1 and Babesia microti in Ixodes ricinus in The Netherlands during a 5-year surveillance: 2003-2007. Vector Borne Zoonotic Dis. 2009;9(1):119–122. doi: 10.1089/vbz.2008.0047. https://www.ncbi.nlm.nih.gov/pubmed/18759637 [DOI] [PubMed] [Google Scholar]
- 40.Bonnet S., Jouglin M., Malandrin L., Becker C., Agoulon A., L'Hostis M. Transstadial and transovarial persistence of Babesia divergens DNA in Ixodes ricinus ticks fed on infected blood in a new skin-feeding technique. Parasitology. 2007;134(Pt 2):197–207. doi: 10.1017/S0031182006001545. https://www.ncbi.nlm.nih.gov/pubmed/17076925 [DOI] [PubMed] [Google Scholar]
- 41.Janse I., Hamidjaja R.A., Bok J.M., van Rotterdam B.J. Reliable detection of Bacillus anthracis, Francisella tularensis and Yersinia pestis by using multiplex qPCR including internal controls for nucleic acid extraction and amplification. BMC Microbiol. 2010;10:314. doi: 10.1186/1471-2180-10-314. https://www.ncbi.nlm.nih.gov/pubmed/21143837 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.de Bruin A., de Groot A., de Heer L., Bok J., Wielinga P.R., Hamans M. Detection of Coxiella burnetii in complex matrices by using multiplex quantitative PCR during a major Q fever outbreak in The Netherlands. Appl. Environ. Microbiol. 2011;77(18):6516–6523. doi: 10.1128/AEM.05097-11. https://www.ncbi.nlm.nih.gov/pubmed/21784920 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Roux V., Rydkina E., Eremeeva M., Raoult D. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. Int. J. Syst. Bacteriol. 1997;47(2):252–261. doi: 10.1099/00207713-47-2-252. https://www.ncbi.nlm.nih.gov/pubmed/9103608 [DOI] [PubMed] [Google Scholar]
- 44.Christova I., Van De Pol J., Yazar S., Velo E., Schouls L. Identification of Borrelia burgdorferi sensu lato, Anaplasma and Ehrlichia species, and spotted fever group Rickettsiae in ticks from Southeastern Europe. Eur. J. Clin. Microbiol. Infect. Dis. 2003;22(9):535–542. doi: 10.1007/s10096-003-0988-1. https://www.ncbi.nlm.nih.gov/pubmed/12938010 [DOI] [PubMed] [Google Scholar]
- 45.Blair P.J., Jiang J., Schoeler G.B., Moron C., Anaya E., Cespedes M. Characterization of spotted fever group rickettsiae in flea and tick specimens from northern Peru. J. Clin. Microbiol. 2004;42(11):4961–4967. doi: 10.1128/JCM.42.11.4961-4967.2004. https://www.ncbi.nlm.nih.gov/pubmed/15528680 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Choi Y.J., Jang W.J., Ryu J.S., Lee S.H., Park K.H., Paik H.S. Spotted fever group and typhus group rickettsioses in humans, South Korea. Emerg. Infect. Dis. 2005;11(2):237–244. doi: 10.3201/eid1102.040603. https://www.ncbi.nlm.nih.gov/pubmed/15752441 [DOI] [PMC free article] [PubMed] [Google Scholar]
