Species identification of European forest pathogens of the genus Milesina (Pucciniales) using urediniospore morphology and molecular barcoding including M.woodwardiana sp. nov

Ben Bubner; Ramona Buchheit; Frank Friedrich; Volker Kummer; Markus Scholler

doi:10.3897/mycokeys.48.30350

. 2019 Mar 5;48:1–40. doi: 10.3897/mycokeys.48.30350

Species identification of European forest pathogens of the genus Milesina (Pucciniales) using urediniospore morphology and molecular barcoding including M.woodwardiana sp. nov.

Ben Bubner ¹, Ramona Buchheit ², Frank Friedrich ³, Volker Kummer ⁴, Markus Scholler ^2,^✉

PMCID: PMC6414474 PMID: 30872942

Abstract Abstract

Species of rust fungi of the genus Milesina (Pucciniastraceae, Pucciniales) are distributed mainly in northern temperate regions. They host-alternate between needles of fir (Abies spp.) and fronds of ferns (species of Polypodiales). Milesina species are distinguished based on host taxonomy and urediniospore morphology. In this study, 12 species of Milesina from Europe were revised. Specimens were examined by light and scanning electron microscopy for urediniospore morphology with a focus on visualising germ pores (number, size and position) and echinulation. In addition, barcode loci (ITS, nad6, 28S) were used for species delimitation and for molecular phylogenetic analyses. Barcodes of 72 Milesina specimens were provided, including 11 of the 12 species.

Whereas urediniospore morphology features were sufficient to distinguish all 12 Milesina species except for 2 (M.blechni and M.kriegeriana), ITS sequences separated only 4 of 11 species. Sequencing with 28S and nad6 did not improve species resolution. Phylogenetic analysis, however, revealed four phylogenetic groups within Milesina that also correlate with specific urediniospore characters (germ pore number and position and echinulation). These groups are proposed as new sections within Milesina (sections Milesina, Vogesiacae M. Scholler & Bubner, sect. nov., Scolopendriorum M. Scholler & Bubner, sect. nov. and Carpaticae M. Scholler & Bubner, sect. nov.). In addition, Milesinawoodwardiana Buchheit & M. Scholler, sp. nov. on Woodwardiaradicans, a member of the type section Milesina, is newly described. An identification key for European Milesina species, based on urediniospore features, is provided.

Keywords: Abies alba , Polypodiales , GBOL, germ pores, host alternation, Uredinopsis , Europe

Introduction

Several genera of rust fungi (Pucciniales) in Europe alternate their hosts between Abies spp. (aecial host with spore states 0 and I) and ferns of the order Polypodiales (telial host with spore states II, III and IV or III and IV). These are species of the genera Calyptospora J.G. Kühn (Thekopsora Magnus p.p.), Hyalopsora Magnus, Milesina Magnus (= Milesia F.B. White; see Aime et al. 2018b) and possibly Uredinopsis Magnus (Gäumann 1959; Klenke and Scholler 2015). All are assigned to the Pucciniastraceae.

The genus Milesina Magnus was monographed by Faull (1932). Today, 36 species are known worldwide (Kirk et al. 2001) and 11 species in Europe (Gäumann 1959; Klenke and Scholler 2015). Most species occur in parts of the northern hemisphere with temperate climates and Abies populations (Faull 1932). A few species are also found in the southern hemisphere outside the natural area of Abies species (Liu 1971), for example, South and Central America, South Africa and New Zealand (Berndt 2008). According to Sinclair and Lyon (2005), species of the genus Milesina and Uredinopsis (both called fir-fern rust) may cause needle browning and/or defoliation and occasionally cause economic damage in Christmas tree plantations in Canada. Aeciospores from needles infect ferns. Symptoms on fern fronds are pale green to yellow spots, which later become necrotic and are typically confined by veins (Sinclair and Lyon 2005).

Fern rust species on the telial hosts are characterised and distinguished mainly by host taxonomy (telial host genus), size, shape and ornamentation of urediniospores (e.g. Moss 1926, Faull 1932, Berndt 2008) and the results of inoculation experiments (Hunter 1935, 1936, Kamei 1940, Klebahn 1916; Mayor 1944). In contrast to urediniospores, teliospores are either not formed regularly or at all and teliospore features are obscure. So far, it is not possible to morphologically distinguish species on their aecial hosts Abies spp. (spore and sori features). Urediniospore features alone were also hardly sufficient to distinguish species (e.g. Faull 1932, Gäumann 1959, Majewski 1977). Thus, fern host identification is often the only criterion to link records to a certain species. This is problematic because some fern species may be infected by two (or possibly even more) Milesina spp. (e.g. Dryopteris spp. and Polystichum spp. in Europe; Gäumann 1959, Klenke and Scholler 2015).

In the present study, the urediniospore morphology of European Milesina species was investigated by light and scanning electron microscopical techniques. The morphological approach is supplemented by a molecular phylogenetic approach based on the ITS (Internal Transcribed Spacer) region of the rDNA, which has been shown to be the best marker for barcode species within fungi (Schoch et al. 2012). As secondary barcodes, nad6 (subunit 6 of NADH dehydrogenase) and 28S rDNA have been used. The molecular data were generated within the German Barcode of Life Project GBOL (Geiger et al. 2016). The present study has three objectives, to:

i) provide a detailed morphological description of urediniospores of all European Milesina spp., including the development of a method to visualise their germ pores. Germ pores are known to be a valuable taxonomic feature, for example, in grass rust fungi (Cummins 1971). So far, germ pores have not been visualised in the major studies on Milesina spp. (Berndt 2008; Faull 1932).

ii) provide molecular barcodes (ITS, nad6, 28S) for Central European species of Milesina spp. within the German Barcode of Life project (Geiger et al. 2016).

iii) assess the assignment of morphological species by comparison with the molecular data.

Methods

Herbaria

Dried herbarium specimens from the following public herbaria were used: B, FH, G, GLM, GZU, HBG, KR, M, PUR, S and W (acronyms according to Index Herbariorum, Holmgren et al. 1990).

Light microscopy (LM)

Urediniospores and cross sections of sori (uredinia) from dried Milesina specimens were mounted in a mixture of lactic acid and glycerol (Kirk et al. 2001) and examined with a light microscope (Zeiss Axioskop 2 plus) at a magnification of 400× or 1000×. If a sufficient amount of spore material were available, 30 spores per specimen were arbitrarily selected and measured. The number of examined specimens was between two (M.magnusiana) and 23 (M.kriegeriana). The number of spores examined depended on sample size and varied for each measurement and also between specimens. The length and width of 30 spores (2–4 specimens per species) and sori (only specimens with Woodwardia host), the length of 15 spines, the cell wall thickness of 10 spores and the distance between 20 spines were measured for each specimen (2–16 specimens per species). For spine base diameters, see next chapter.

Germ pore number and their position in the wall of urediniospores were evaluated by an adapted technique originally developed for the genus Tranzschelia (Scholler et al. 2014). Spores were mounted in Hoyer’s medium (Cunningham 1972) on a slide, then cover slips were pressed until the spores were disrupted and released the plasma. Then the slides were placed on a drier at 40 °C. After two to five days, the numbers of germ pores were counted in phase contrast illumination at 400× magnification for 120 spores of each species. Only the specimens with the best observable germ pores were used for the analysis. In addition, the diameter of pores was measured at 400× magnification.

Specimens were photographed with a Jenoptik ProgRes CT3 digital camera attached to a Zeiss Axioskop 2 plus light microscope (Oberkochen), using differential interference contrast (DIC) and phase contrast as illumination techniques. Images were captured with PROGRES CAPTUREPRO version 2.10.0.1 software. The pictures of the uredinia of Milesina sp. were taken with a ProgRes CT3 digital camera (Jena) attached to a Zeiss Stemi 508 (Zeiss, Oberkochen). All values determined in this study were rounded to one decimal place and outliers were not included in the species description.

Scanning Electron Microscopy (SEM)

Uredinia and urediniospores of dried specimens of Milesina spp. were placed on a holder with conductive double-sided tape (Leit-Tabs, Plano GmbH). Scanning electron microscope images were obtained on a Philips XL 30 FEG environmental scanning electron microscope operated at acceleration voltages of 12 kV at a chamber pressure of 133 Pa (1 Torr). In order to achieve a better contrast and less charge effects, the samples were coated first with a mixture of gold (80%) and palladium (20%) (MED 020, BAL-TEC).

SEM studies were carried out to study surface structures which are not visible by light microscopy. Spine base diameters (30 per species) were also measured with SEM and the software IMAGEJ 1.5.

Statistical Analysis

The statistical analyses for germ pore numbers and boxplots were carried out with the programme R 3.4.3 (R Core Team 2017).

DNA extraction, PCR and sequencing

Samples were prepared from herbarium specimens by excising single rust pustules including the plant material. They were placed into micro tubes with 8–12 ceramic beads, 1.4 mm diameter (Bio-Budget technologies, Krefeld, Germany), frozen at -20 °C overnight and homogenised on a Bead Ruptor (biolabproducts, Bebensee, Germany) at a speed of 7.45 m/s for 25 s. After freezing the samples again for 10 min at -20 °C, homogenisation was repeated. DNA was extracted with the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. Selected samples were homogenised with glass mini mortars and pestles (Roth, Karlsruhe, Germany) in 400 µl of the homogenisation buffer included in the extraction kit.

Molecular barcodes were generated for three loci: ITS (Internal Transcribed Spacer of the ribosomal DNA in the nucleus), 28S (coding for the large subunit of the ribosomal RNA gene located on the ribosomal DNA in the nucleus), nad6 (coding for subunit 6 of NADH dehydrogenase, mitochondrial DNA). Primer sequences are listed in Table 1.

Table 1.

Primers and PCR conditions.

Locus		Primer	Sequence	Reference	Annealing temperature	Cycle number
ITS	amplicon 1	ITS1F	CTTGGTCATTTAGAGGAAGTAA	(Gardes and Bruns 1993)	60–50 °C	10 cycles with -1 °C per cycle (60–50 °C), then 30 cycles (50 °C)
	amplicon 1	ITS4rust	CAGATTACAAATTTGGGCT	(Beenken et al. 2012)	60–50 °C
	amplicon 2*	ITS5u	CAAGGTTTCTGTAGGTG	(Pfunder et al. 2001)	60–50 °C	10 cycles with -1 °C per cycle (60–50 °C), then 30 cycles (60 °C)
	amplicon 2*	ITS4	TCCTCCGCTTATTGATATGC	(O´Donnell 1993)	60–50 °C
28S	amplicon 1	ITS4BRF	GGACCATGTACAAGTCTGTTGA	(Vialle et al. 2009)	50 °C	40
28S	amplicon 1	LR5	ATCCTGAGGGAAACTTC	(Vilgalys and Hester 2009)	50 °C	40
nad6	amplicon 1	Nad6PucciF1	TTCGATAATAAGTAGCCTAATAGTG	(Vialle et al. 2013)	47 °C	40
nad6	amplicon 1	Nad6PucciR1	AAATACAATAGGGCCAATCAT	(Vialle et al. 2013)	47 °C	40

Open in a new tab

*voucher KR-M-0035533, KR-M-0048135

PCR was performed with the Accuprime Taq Polymerase System (Life Technologies, Karlsruhe, Germany) using the supplied buffer II and the following final concentrations: 2 mM MgCl₂, 0.2 mM of each dNTP and 500 nM of each primer. The PCR programme was as follows: 3 min denaturation at 94 °C, 40 amplification cycles (94 °C for 30 s, 50 °C for 30 s and 68 °C for 60 s) and 7 min strand completion at 68 °C. PCR products were visualised in 1.6% agarose gel. Deviations from the 50 °C annealing temperature are listed in Table 1.

After purification of the PCR product with QIAquick-PCR Purification Kit (Qiagen, Hilden, Germany), it was sent to GATC Biotech AG (Konstanz, Germany) for sequencing. Sequencing was performed with the same primers used for the PCR. Forward and reverse sequences were edited and assembled with the software package GENEIOUS 10.0 (Biomatters, Auckland, New Zealand).

Phylogenetic analysis

Several comparison sequences were selected in order to compare the branch length between Milesina species with branch lengths between related genera. Criteria of selection were availability within the GBOL project and membership in the Pucciniales suborder Melampsorineae sensu Aime (2006) and Aime et al. (2018b). The genera included Puccinia (GenBank) Pucciniastrum, Uredinopsis, Cronartium (GenBank) and Melampsoridium as outgroup. GenBank accessions of Cronartiumribicola ITS sequences are DQ445908 (Hietala et al. 2008), GU727730 (Mulvey and Hansen 2011) and KX574673 (Vogler et al. 2017). GenBank accessions for Pucciniagraminis are AY874141, AY874143 and AY874146 (Abbasi et al. 2005).

Sequences were aligned with the ClustalW algorithm implemented in the programme BioEdit, version 7.1.3.0 (Hall 1999) using the standard parameters offered by the programme. Alignments were used for phylogenetic reconstruction by three different methods:

i) Neighbour-Joining (NJ) analysis was performed with the programme PAUP* 4.0b10 (Sinauer, Sunderland, MA, USA) using the Kimura-2-parameter substitution model. Node support values for NJ were calculated from 1000 bootstrap replicates.

ii) Maximum-Likelihood (ML) analysis: The original NEXUS alignment was reformatted to the extended PHYLIP format using the programme Mesquite 2.75 (http://mesquiteproject.org/mesquite/mesquite.html). The PHYLIP alignment was analysed under the ML criterion on the web-based RAxML black box (Stamatakis et al. 2008 https://www.genome.jp/tools/raxml/. Both formats were accessed on 01.09.2018). The used substitution model was GTR without GAMMA correction for amongst-site heterogeneity. Node support values were calculated from 100 bootstrap replicates.

c) Bayesian Inference (BI) analysis: The DNA-Substitution model GTR+I+G was used for performing Bayesian analysis with the programme MrBayes 3.2 (Ronquist et al. 2012). Two independent MCMC runs were performed, each with four chains over 1 000 000 generations. Every 100^th tree was sampled. Initial burn-in was 25% and summarisations were calculated after the standard deviation of split frequencies reached below 0.01. The resulting tree file contained posterior probability values for node support.

Tree files resulting from the three methods were visualised using the programme TreeGraph 2 (Stöver and Müller 2010). Alignments are provided as NEXUS files in the Online Supplemental Material (Suppl. materials 1–3).

Results

Barcoding success for ITS, nad6 and 28S

ITS sequences were generated for 72 specimens of 11 Milesina species (Table 2). These include 10 of 11 Milesina species known to be present in Europe. Only for M.magnusiana no material was available. In addition, we sequenced an unknown Milesina species from the Canary Islands which politically belongs to Europe but geographically may belong to Africa. All specimens are from the fungus collection of the State Museum of Natural History Museum Karlsruhe, Germany (Acronym KR) as listed in the Methods section. An additional 43 specimens (data not shown) yielded no sequences. Thus, the success rate for sequencing was 63%. Amongst the unsuccessful specimens, 17 were collected before 2010 and 12 failed specimens were collected in 2017. The oldest successfully sequenced specimens were from 1999 (M.murariae, KR-M-0025191; M.scolopendrii KR-M-0025400). No attempts have been made to sequence M.magnusiana because only two old species from 1933 and 1964 (M-0290299, M-0205474) were available. Nine ITS sequences were generated for the genera Chrysomyxa, Melampsoridium and Uredinopsis (Table 3).

Table 2.

Milesina specimens: herbarium, lab and GenBank accession numbers.

Species	Host plant species	Voucher (all herbarium KR)	Lab no.	ITS	28S	nad6
M. blechni	Struthiopteris spicant	KR-M-0038517	B1426	MH908410
	Struthiopteris spicant	KR-M-0038523	B1427	MH908411
	Struthiopteris spicant	KR-M-0038519	B1428	MH908412	MK302189
	Struthiopteris spicant	KR-M-0038516	B1442	MH908421	MK302193
	Struthiopteris spicant	KR-M-0049039	B1893	MH908463
M. carpatica	Dryopteris filix-mas	KR-M-0048589	B1662	MH908451
M. carpatica	Dryopteris filix-mas	KR-M-0043192	B1780	MH908454
M. exigua	Polystichum braunii	KR-M-0050247	B2206	MH908478	MK302211	MK302182
M. feurichii	Asplenium septentrionale	KR-M-0043159	B1964	MH908476
M. kriegeriana	Dryopteris carthusiana	KR-M-0043170	B1435	MH908417
	Dryopteris dilatata	KR-M-0043182	B1438	MH908418
	Dryopteris dilatata	KR-M-0043165	B1440	MH908419	MK302191
	Dryopteris dilatata	KR-M-0039321	B1441	MH908420	MK302192
	Dryopteris carthusiana	KR-M-0048087	B1469	MH908441	MK302203
	Dryopteris carthusiana	KR-M-0048085	B1470	MH908442	MK302204	MK302166
	Dryopteris carthusiana	KR-M-0048086	B1471	MH908443	MK302205
	Dryopteris dilatata	KR-M-0043162	B1472	MH908444
	Dryopteris dilatata	KR-M-0048088	B1473	MH908445
	Dryopteris dilatata	KR-M-0043151	B1474	MH908446
	Dryopteris dilatata	KR-M-0043184	B1475	MH908447
	Dryopteris filix-mas	KR-M-0043178	B1476	MH908448
	Dryopteris dilatata	KR-M-0048357	B1494	MH908449
	Dryopteris dilatata	KR-M-0048477	B1602	MH908450	MK302206
	Dryopteris dilatata	KR-M-0048480	B1685	MH908452	MK302207
M. murariae	Asplenium ruta-muraria	KR-M-0048133	B1443	MH908422	MK302194
	Asplenium ruta-muraria	KR-M-0048134	B1444	MH908423	MK302195
	Asplenium ruta-muraria	KR-M-0048132	B1445	MH908424	MK302196
	Asplenium ruta-muraria	KR-M-0035461	B1446	MH908425	MK302197	MK302150
	Asplenium ruta-muraria	KR-M-0036224	B1447	MH908426		MK302151
	Asplenium ruta-muraria	KR-M-0036225	B1448	MH908427		MK302152
	Asplenium ruta-muraria	KR-M-0025768	B1449	MH908428		MK302153
	Asplenium ruta-muraria	KR-M-0025185	B1450	MH908429		MK302154
	Asplenium ruta-muraria	KR-M-0025184	B1451	MH908430		MK302155
	Asplenium ruta-muraria	KR-M-0025191	B1452	MH908431		MK302156
	Asplenium ruta-muraria	KR-M-0043149	B1852	MH908459		MK302168
	Asplenium ruta-muraria	KR-M-0043154	B1853	MH908460		MK302169
M. polypodii	Polypodium vulgare	KR-M-0043177	B1429	MH908413
	Polypodium interjectum	KR-M-0043189	B1431	MH908414
	Polypodium vulgare	KR-M-0043190	B1432	MH908415	MK302190
	Polypodium vulgare	KR-M-0043161	B1433	MH908416
	Polypodium vulgare	KR-M-0043152	B1466	MH908439		MK302164
	Polypodium vulgare	KR-M-0048818	B1846	MH908455
	Polypodium vulgare	KR-M-0043157	B1847	MH908456
	Polypodium vulgare	KR-M-0043146	B1848	MH908457
	Polypodium vulgare	KR-M-0043173	B1849	MH908458
	Polypodium vulgare	KR-M-0048694	B1778	MH908453		MK302167
M. scolopendrii	Asplenium scolopendrium	KR-M-0043186	B1455	MH908434	MK302198	MK302159
	Asplenium scolopendrium	KR-M-0043153	B1456	MH908435		MK302160
	Asplenium scolopendrium	KR-M-0025400	B1457	MH908436	MK302199	MK302161
	Asplenium scolopendrium	KR-M-0049066	B1896	MH908464		MK302170
	Asplenium scolopendrium	KR-M-0049049	B1897	MH908465		MK302171
	Asplenium scolopendrium	KR-M-0049050	B1898	MH908466	MK302208	MK302172
	Asplenium scolopendrium	KR-M-0049051	B1899	MH908467	MK302209	MK302173
M. sp.	Abies alba	KR-M-0043687	B1458	MH908437	MK302200	MK302162
	Abies alba	KR-M-0042052	B1459	MH908438	MK302201	MK302163
	Abies alba	KR-M-0018587	B1860	MH908461
	Abies alba	KR-M-0018624	B1861	MH908462
	Abies alba	KR-M-0049062	B1902	MH908468
	Abies alba	KR-M-0049038	B1903	MH908469
	Abies alba	KR-M-0049065	B1905	MH908470		MK302174
	Abies alba	KR-M-0049068	B1906	MH908471		MK302175
	Abies alba	KR-M-0049063	B1907	MH908472
	Abies alba	KR-M-0048773	B1911	MH908473
	Abies alba	KR-M-0050303	B2209	MH908480	MK302215	MK302184
M. vogesiaca	Polystichum aculeatum	KR-M-0003937	GBOL_1_f10	MH908490
	Polystichum aculeatum	KR-M-0043175	B1453	MH908432		MK302157
	Polystichum aculeatum	KR-M-0043160	B1454	MH908433		MK302158
	Polystichum aculeatum	KR-M-0043187	B1467	MH908440	MK302202	MK302165
M. whitei	Polystichum aculeatum	KR-M-0049177	B1965	MH908477
M. whitei	Polystichum aculeatum	KR-M-0050248	B2207	MH908479	MK302212
M.woodwardiana sp. nov.	Woodwardia radicans	KR-M-0049033	B1912	MH908474		MK302176
M.woodwardiana sp. nov.	Woodwardia radicans	KR-M-0048787	B1914	MH908475

Open in a new tab

Table 3.

ITS barcodes specimens of Pucciniastraceae other than Milesina: herbarium, lab and accession numbers.

Species	host plant species	voucher (all herbarium KR)	lab no.	ITS	28S	nad6
Chrysomyxa empetri	Empetrum hermaphroditum	KR-M-0040758	B1252	MH908481
Chrysomyxa pyrolata	Pyrola minor	KR-M-0048660	B1688	MH908484
Chrysomyxa pyrolata	Pyrola rotundifolia	KR-M-0048741	B1689	MH908485
Melampsoridium betulinum	Betula pendula	KR-M-0035533	B1412	MH908482	MK302186
	Betula pubescens	KR-M-0048135	B1416	MH908483	MK302187
	Betula pubescens	KR-M-0048557	B1835	MH908487
Melampsoridium carpini	Carpinus betulus	KR-M-0048587	B1774	MH908486
Melampsoridium hiratsukanum	Alnus incana	KR-M-0049100	B2033			MK302178
Melampsoridium hiratsukanum	Alnus glutinosa	KR-M-0048149	B1420		MK302188
Pucciniastrum circaeae	Circaea intermedia	KR-M-0039060	B2038			MK302179
Pucciniastrum epilobii	Epilobium ciliatum	KR-M-0004576	B2039			MK302180
Pucciniastrum epilobii	Epilobium palustre	KR-M-0043058	B2040		MK302210	MK302181
Uredinopsis filicina	Phegopteris connectilis	KR-M-0050249	B2208	MH908488	MK302213	MK302183
	Phegopteris connectilis	KR-M-0012195	B2011			MK302177
	Phegopteris connectilis	KR-M-0050313	B2212	MH908489	MK302215	MK302185

Open in a new tab

All 72 specimens with ITS sequences were sequenced for the loci nad6 and 28S. Twenty nine specimens yielded barcode sequences at the locus nad6 (sequencing success 40%), while 24 specimens were successfully sequenced at the locus 28S (sequencing success 33%, Table 2). Since no nad6 or 28S sequences could be generated for specimens of the genus Chrysomyxa, specimens of the genus Pucciniastrum were sequenced as replacements in nad6 and 28S phylograms (three sequences for nad6, one sequence for 28S, Table 3).

Phylogenetic analysis of the ITS barcode

Phylogenetic analysis of the ITS barcode revealed four clades for clades within Milesina species. The nodes for the first, second and fourth clade have maximum support values of 100/1/100 for the three phylogenetic reconstruction methods ML, BI and NJ (Figure 1). In clade 1, the ITS sequences of the pairs M.whitei/kriegeriana and M.blechni/woodwardiana sp. nov. are almost identical within the pairs but differ between the pairs by one nucleotide (Figure 3). At position 381, the nucleotide T (M.whiteikriegeriana) is replaced by C (M.blechni/M.woodwardiana sp. nov.). Position 1 is the first nucleotide after the signature TCATTA for the 3´end of the 18S rDNA. This difference is also reflected in the ITS phylogram by a node with weak support of 67/0.69/54 (Figure 1).

Figure 1. — ITS Phylogram of *11 *Milesina* species* (excluding *M.magnusiana*). The phylogram is based on a 733-bp alignment. A Maximum Likelihood (ML) tree is shown with support values for ML, Bayesian Inference (BI) and Neighbour Joining (NJ), in the order ML/BI/NJ. Support values are presented when they are above 50 (ML, NJ) or 0.5 (BI). The host is indicated in brackets. *Milesina* specimens without species designation (host *Abiesalba*) are not colour-coded. For comparison, several sequences were included from closely related genera. They were all newly generated within the GBOL project, except the GenBank sequences for *Cronartium* spp. The drawings on the right side present the typical arrangement of spines and germ pores (grey dots) on the *Milesina* urediniospores.

Figure 3. — Deviations from the consensus ITS sequence of section *Milesina*. The first line indicates the nucleotide positions in base pairs, the second line the consensus sequence. The order of specimens is as shown in Figure 1. “*Milesina* sp” denotes specimens from *Abiesalba*. Deviations for single specimens can be found at 5 positions. All specimens of *M.blechni* and *M.woodwardiana* deviate at position 381 from *M.whitei* and *kriegeriana*.

In clade 2, M.scolopendrii, M.polypodii and M.murariae cannot be distinguished by ITS sequences. Apart from single nucleotides at unspecific positions, the ITS sequences are identical. The sequence of M.feurichii differs from the other three species by two nucleotides with specific positions (Figure 4). This difference, however, is not reflected by bootstrap or posterior probability support (Figure 1). Clade 3 with M.vogesiaca and M.exigua has only weak support in the BI and NJ analysis (0.73 and 63) while the bootstrap support was below 50 for the ML analysis (Figure 1). In a version of the ITS phylogram with Pucciniagraminis as outgroup (Online Suppl. material 1: Figure S1), the support values for clade 3, including M.exigua are 100/1/100. The only member of the fourth clade is M.carpatica with two identical sequences. The ITS sequence is clearly different from all other Milesina species investigated. In summary, amongst the 11 Milesina species, only four species (M.feurichii, M.vogesiaca, M.exigua and M.carpatica) can be unambiguously assigned by their ITS sequences.

Figure 4. — Deviations from the consensus ITS sequence of section *Scolopendriorum*. Description as for Figure 3. *Milesinafeurichii* deviates from the other three species in positions 288 (A) and 521 (G).

Amongst the specimens on the aecial host Abiesalba, nine grouped into clade 1 and two into clade 2 (Figure 1). Following the distinction at position 381, six Abies-dwelling specimens of clade 1 belong to the pair M.whitei/kriegeriana and three to the pair M.blechni/woodwardiana sp. nov.

The ITS phylogeny (Figure 1) does not confirm monophyly of Milesina species. High support values are available only for a clade containing all Milesina species and Uredinopsisfilicina (node support (100/1/99, Figure 1). This indicates that the genus Milesina may be paraphyletic. The specimens of the three genera Melampsoridium, Cronartium and Chrysomyxa form a clade with a node support of 81/-/0.9, indicating that probably none of them is a sister group of Milesina. When the branch lengths from the clade defining node to the next deeper node are compared, it its apparent that the branch lengths for the Milesina clades are as long or even longer when compared to the branch lengths between the different genera Melampsoridium, Cronartium and Chrysomyxa. This indicates a relatively large genetic distance between the clades within the genus Milesina.

Phylogenetic analysis of nad6 and 28S barcodes

Due to the low sequencing success of these two markers, only seven (nad6) and eight (28S) Milesina species could be included in the analysis. Although no sequences are available for clade 4 (M.carpatica), the general pattern of the clades is the same as for the ITS phylogeny. Clade 1 and clade 2 consist of the same species (Figure 2) as in the ITS analysis and cannot be distinguished. In addition and in contrast to the ITS data, the distinction between the species pairs M.whitei/kriegeriana and M.blechni/woodwardiana sp. nov. is not possible. In confirmation of the ITS data, the support for a clade that contains all Milesina species and Uredinopsisfilicina is high (99/1/100 for nad6, 96/0.96/64 for 28S, Figure 2). This again indicates that the genus Milesina is not monophyletic. The branch lengths from the clade defining node to the next deeper node are shorter between the Milesina clades as compared to the branch length between related species. This is in contrast to ITS data.

Figure 2. — Phylograms of supplementary barcodes. The nad6 phylogram is based on a 550 bp alignment, the 28S phylogram on a 680 bp alignment. The technical description is the same as for Figure 1. All *Milesina* specimens from Figure 1 were attempted to sequence for the supplementary barcodes. Only the shown specimens resulted in sequences. The non-*Milesina* species were altered depending on availability. No GenBank sequences were included and the genus *Chrysomyxa* was replaced by *Pucciniastrum*.

The ambiguity in ITS data to determine a clade 3, consisting of both M.vogesiaca and M.exigua, is also found in the nad6 and 28S data. In the nad6 phylogram, M.exigua has an unsupported position next to Uredinopsisfilicina. In the 28S phylogram, M.exigua is only in the same clade with M.vogesiaca if Uredinopsisfilicina is included. Even then, the support values of 70/0.8/52 are relatively low.

Morphology of urediniospores

Germ pores

The number and position of the germ pores of all species were visualised. Germ pores provided three important features, namely (i) the number, (ii) the position and, finally, (iii) the size of pores. The four species with the highest number of germ pores per spore all belong to the section Milesina (Figure 5). All other species had similar germ pore numbers.

Figure 5. — Boxplot of germ pore numbers of urediniospores of 12 *Milesina* spp. and four sections. For each species 120 spores from two (*M.magnusiana*), three (*M.feurichii*) or four (all other species) specimens were evaluated. Median, whisker, quantile and outliers (dots) are shown.

Specimens examined, urediniospore descriptions and taxonomic novelties

Comparative data of the main morphological spore characters are listed in Table 4.

Table 4.

Comparative overview of morphological features of urediniospores and host range in Milesina.

Species	Host plant genus (family)	Frequent spine length [µm]	Smooth spine-free areas	Frequent wall thickness [µm]	Frequent germ pore number	Ø germ pore diam. [µm]	Germ pore distri-bution	Frequent spore size [µm]	Other
Milesina blechni	Struthiopterisspicant (Blechnaceae)	1.5–2.0	no	0.8–1.0	10–11	2.4	scattered	30.0–37.5 × 15.0–19.0	distance between spines mostly 1.5–4.0 µm, spines typically perpendicular to the wall
Milesina carpatica	Dryopterisfilix-mas (Dryopteridaceae)	1.0–1.8	no	0.5–1.2	5–7	2.2	scattered	20.0–30.0 × 12.5–19.0	distance between spines mostly 0.5–3.0 µm, spines typically erect
Milesina exigua	Polystichumaculeatum, P.braunii, (Dryopteridaceae)	no spines	no spines	0.5–0.8	4–6	2.7	bizonate	22.5–30.0 × 12.5–17.5	Germ pores concentrated apically or nearly bizonate
Milesina feurichii	Aspleniumseptentrionale (Aspleniaceae)	±2.0	yes	0.5–1.0	6–7	2.4	scattered	30.0–37.5 × 20.0–22.5	distance between spines mostly 1.0–5.0 µm, spines typically erect
Milesina kriegeriana	Dryopterisborreri, D.carthusiana, D.dilatata, D.filix-mas (Dryopteridaceae)	±2.0	no	0.8–1.0	10–11	2.3	scattered	27.5–37.5 × 15.0–20.0	distance between spines mostly 1.0–4.0 µm, spines typically erect
Milesina magnusiana	Aspleniumadiantum-nigrum (Aspleniaceae)	±2.0–2.2	yes	1.0–1.5	5–6	2.9	scattered	30.0–35.0 × 17.5–20.0	distance between spines mostly 3.0–5.5 µm
Milesina murariae	Aspleniumruta-muraria (Aspleniaceae)	±2.0	yes	2.0	5–6	2.4	scattered	27.5–35.0 × 17.5–22.5	distance between spines 2.0–3.5 µm, spines typically erect, curved near base
Milesina polypodii	Polypodiuminterjectum, P.×mantoniae, P.vulgare (Polypodiaceae)	±2.0	yes	0.5–1.0	5–6	2.3	scattered	30.0–40.0 × 17.5–22.5	distance between spines 1.0–4.0 µm, spines typically erect
Milesina scolopendrii	Aspleniumscolopendrium (Aspleniaceae)	±2.0	yes	0.5–1.2	6–7	2.4	scattered	27.5-42.5 × 17.5-22.5	distance between spines 2.0-5.0 µm, spines typically erect
Milesina vogesiaca	Polystichumaculeatum, P. lonchites (Dryopteridaceae)	no spines	no spines	0.5-0.8	5-6	2.8	± bizonate	30.0-40.0 × 17.5-20.0	spores with very inconspicuous flat verrucae (visibly with SEM only)
Milesina whitei	Polystichumaculeatum, P.setiferum (Dryopteridaceae)	1.8-2.5	no	0.8-1.0	9-13	2.3	scattered	27.5-37.5 × 17.5-22.5	distance between spines mostly around 2.0 µm, spines typically perpendicular to the wall
Milesinawoodwardiana sp. nov.	Woodwardiaradicans (Blechnaceae)	±3.0	no	0.5-1.0	10-14	2.4	scattered	30.0-37.5 × 17.5-22.5	distance between spines mostly 2.0-4.0 µm, spines irregularly directed

Open in a new tab

Milesina blechni

(Syd. & P. Syd.) Syd. & P. Syd., Annales Mycologici 8(5): 491 (1910)

Figure 6a, b

Struthiopteris spicant (L.) Weiss (Blechnumspicant (L.) Sm.), Czech Republic, Mähren: Hochgesenke, Großer Kessel (Velká kotlina), 19 Mar 1923, F. Petrak, II (W, 1970-25718); Hochgesenke, Großer Kessel (Velká kotlina), 3 Sep 1923, F. Petrak, II (W, 1992-14461); Denmark: 26 Nov 1926, J. Lind, II (W, 1975-19656); 26 Nov 1926, J. Lind, II (W, 1931-7888); France, Alsace: Frankental, Hohneck, 16 Jul 1910, H. Sydow, II (Sydow, Mycoth. Germ. 877; W, 1910-6976, 1973-30378; S, F310830); Germany, Bayern: Aschau, 25 Aug 1934, E. Eichhorn & H. Poeverlein, II (W, 1975-15534); Dreisessel, 12 Oct 1940, E. Eichhorn, II (Sydow, Mycoth. germ. 3449; W, 1942-2122m 1972-17207); Baden-Württemberg, Schwarzwald, St. Georgen, Aug 1913, P. Sydow (Sydow, Uredineen 2739; GLM, GLM-53029; W, 1916-4273; S, F310826); Schwarzwald, path between Bad Wildbad and Kaltenbronn, 13 Aug 1910, P. Sydow, II (S, F310827); Freudenstadt, Baiersbronn, NSG “Wilder See- Hornisgrinde”, coniferous wood, 1 Mar 2014, M. Scholler, II (KR, KR-M-0038516); Schwarzwald, Ortenau, Durbach, Tiefenspring, Großer Langenbach, 15 Sep 2017, R. Buchheit (KR, KR-M-0049039); Schwarzwald, Ortenau, Seebach, coniferous forest, 1 Mar 2014, M. Scholler (KR, KR-M-0038517); Schwarzwald, Rastatt, Forbach, Herrenwieser See, wayside, 15 May 2014, M. Scholler (KR, KR-M-0038519); Schwarzwald, Rastatt, Forbach, Herrenwies, spruce-fir forest, 15 May 2014, M. Scholler, II (KR, KR-M-0038523); Hamburg: Harburg, Klecker Wald, 12 May 1915, O. Jaap (Jaap, Fungi sel. exs. 774; W, 1916-4246); Niedersachsen: Harz, Rehberger Graben, between Oderteich and St. Andreasberg, 24 Aug 1904, P. Sydow, II (Sydow, Mycoth. Germ. 311; S, F310828; W, 1905-4478); Sachsen: Schmilka, Großer Winterberg, 28 Aug 1903, H. and P. Sydow, II (Sydow, Uredineen 1841; B, B 700016503; S, F29283, F310855; W, 1904-006026, type); Schmilka, 28 Aug 1903, H. & P. Sydow, II (H. & P. Sydow, Mycoth. Germ. 61; W, 1903-0013406; S, F29284, type); Schmilka, Großer Winterberg, 28 Aug 1903, P. Sydow, II (S, F29285, type); Thüringen, Stützerbach near Ilmenau, 20 Jul 1911, O. Jaap, II (W, 1911-7479); Eichsfeld, Fretterode Schierbachtal, spruce forest, 14 Nov 2013, H. Thiel, II (KR, KR-M-0043148); Nordrhein-Westfalen, Lennestadt, Forsthaus Einsiedelei, forest, 5 Sep 1919, A. Ludwig, II (W, 1975-12517); Nordrhein-Westfalen: Lennestadt, Forsthaus Einsiedelei, forest, 31 Aug 1921, A. Ludwig, II (W, 1973-16286); Olpe, Forsthaus Einsiedelei, forest, 31 Aug 1921, A. Ludwig, II (W, 1926-23840); Olpe, Silberg, 12 Aug 1931, A. Ludwig, II (W, 1973-17007); Olpe, Silberg, 6 Sep 1940, A. Ludwig, II (W, 1975-20448); Poland, Riesengebirge (Karkonosze): Karpacz (formerly Krummhübel), 29 Aug 1908, H. Sydow, II (S, F310856); Karpacz (formerly Krummhübel), Hoserweg, 29 Aug 1908, H. Sydow, II (S, F310829); Romania: Brasov, mountain chain Fagaras, Valea Sâmbetei, northern Cabana Valea Sâmbetei, Piceetum, 17 Aug 1983, G. Negrean, II (W, 1997-00694); Switzerland, Berner Oberland: Längenbalm, Hasleberg, 3 Sep 1906, E. Fischer, II (B, B 700016504, W, 1907-17136); Bern, Wälde, northern side of the Schwendelberg, next to Guggisberg, 27 Aug 1923, E. Fischer, II (W, 1971-30213).

Description.

Urediniospores hyaline, ellipsoidal to obovoidal, clavate, 27.5–42.5 × 15.0–20.0 µm, mostly 30.0–37.5 × 15.0–19.0 µm; wall 0.5–1.5 µm, mostly 0.8–1.0 µm thick; echinulate without spine-free areas, spines 1.2–2.2 µm, mostly 1.5–2.0 µm long, irregularly distributed, sometimes also in rows, spines typically straight and perpendicular to the wall, distance between spine bases 1.0–5.0 µm, mostly 1.5–4.0 µm, spine base 0.7–1.3 µm, mostly 0.9–1.1 µm diam.; germ pores scattered, 6–13, mostly 10–11, 2.0–3.0 µm diam., Ø 2.4 µm diam.

Comment.

Urediniospore features are very similar to those of M.kriegeriana. Average urediniospore length measurements are somewhat higher (30.0–37.5 vs. 27.5–35.0 in M.kriegeriana).

Milesina carpatica

Wróbl., Sprawozdanie Komisji Fizjograficznej 47(II): 166 (1913)

Figure 6c

Dryopteris filix-mas (L.) Schott. Austria Steiermark: Graz, basilica Maria Trost, Rettenbachklamm, 11 Jun 1991, J. Poelt, II (GZU, GZU 000335631, GZU 000335632,); Koralpe, Wildbachgraben, ravine forest, 25 Apr 1988, J. Poelt, (M, M-0205477, M-0205478); Koralpe, Wildbachgraben, WNW Wildbach, NW Deutschlandberg, ravine forest, 25 Apr 1988, J. Poelt, II (GZU, GZU 000335634, GZU 000335635); Sausal-Gebirge, rift between Mitteregg and Voregg respectively Annaberg, 12 Apr 1981, J. Poelt, II (GZU, GZU 000335633); Germany, Bayern: Oberbayern, Murnau, Staffelsee, mixed forest, 15 Sep 2017, M. Scholler, II (KR, KR-M-0048589); Niedersachsen: Osterode, Bad Lauterberg, Barbis, forest, scarp, 30 Mar 2014, H. Thiel, II, III (KR, KR-M-0043192); Ukraine, Kolomyja: Knyazhdvir (formerly Galicia, Kniazdwor-Bania, Kolomea), Aug 1913, A. Wróblewski, II (M, M-0290298, type).

Description.

Urediniospores hyaline, ellipsoidal, obovoidal to subglobose, 16.5–32.5 × 10.0–20.0 µm, mostly 20.0–30.0 × 12.5–19.0 µm; wall 0.5–1.8 µm, mostly 0.5–1.0 µm thick; soft (in microscopic mounts they often crack without pressure), very densely echinulate without spine-free areas, spines 1.0–2.0 µm, mostly 1.0–1.8 µm long, irregularly distributed, spines typically straight and perpendicular to the wall, distance between spine bases 0.5–4.0 µm, mostly 0.5–3.0 µm, spine base 0.4–0.7 µm, mostly 0.5–0.6 µm; germ pores scattered, 4–10, mostly 5–7, 1.3–2.5 µm, mostly 1.3–2.5 µm diam., Ø 2.2 µm diam.

Comment.

Germ pores are more difficult to visualise and need more time to evaluate.

Milesina exigua

Faull, Contributions from the Arnold Arboretum of Harvard University 12: 218‒219 (1931)

Figure 6d, e

Polystichum aculeatum (L.) Roth (P.lobatum L., Aspidiumlobatum Sw.). Ukraine, Kolomyja: Knyazhdvir, Aug 1913, A. Wróblewski (as M.vogesiaca: Sydow, Uredineen 2742; GLM, GLM-53030; W, 1916-4289); Knyazhdvir, Sep 1913, A. Wróblewski (as M.vogesiaca: W, 1975-18645).
Polystichum braunii (Spenn.) Fée. Austria, Steiermark: Buchgraben NE Oberschöckl, canyon slope, 26 Apr 1983, J. Poelt, (GZU, GZU 000313869; M, M-0205472); Deutschlandsberg, Freiland, Wildbachklamm, south of the stream, scarp, 31 Jul 2018, M. Scholler & C. Scheuer (KR, KR-M-0050247); Höllgraben, ravine forest, 29 Sep 1988, J. Poelt & P. Zwetko (M, M-0205473). Koralpe, Mausegger-Graben next Sauerbrunn, NW Stainz, district Deutschlandsberg, ravine forest, silicate rock, 17 Apr 1995, J. Poelt (GZU, GZU 000313870); NW Stainz, Höllgraben WNW Marhof, ravine forest, 29 Sep 1988, J. Poelt & P. Zwetko (GZU, GZU 000313867).

Description.

Urediniospores hyaline, ellipsoidal to obovoidal, clavate, 22.5–32.5 × 12.5–17.5 µm, mostly 22.5–30.0 × 12.5–17.5 µm; wall 0.5–0.8 µm; spores smooth, germ pores low in number, probably around 4–6, 2.0–3.8 µm, mostly 2.0–3.0 µm diam., Ø 2.7 µm diam.; germ pores mostly apically, or both, basally and apically (bizonate).

Comment.

Klenke and Scholler (2015: 649) list this species (as M.neoexigua Berndt) on Polystichumbraunii for Germany (Baden-Württemberg), based on a specimen from the Black Forest, SW Germany (KR-M-0019138). P.braunii is a rare member of the southern Black Forest flora. We revised host and fungus and found that it is M.vogesiaca on P.aculeatum. Thus, the presence of M.exigua in Germany has not been confirmed. Germ pores are more difficult to visualise and need more time to evaluate.

Milesina feurichii

(Magnus) Grove, Journal of Botany 59: 311 (1921)

Figure 6f, g

Asplenium septentrionale (L.) Hoffm. Germany, Hessen: Werra-Meißner, Eschwege, Albungen, rock, 13 Apr 2013, H. Thiel, II (KR, KR-M-0043159); Sachsen: Vogtland, NNW Jocketa, NSG Steinicht, 9 May 1999, H. Jage & F. Klenke, II (GLM, GLM-F103536); Switzerland, Ticino: Locarno, Sciarana, Cugnasco, vineyard, dry stone wall, 9 Dec 2017, L. Beenken (KR, KR-M-0044955).

Description.

Urediniospores hyaline, ellipsoidal, obovoidal to subglobose, 27.5–42.5 × 17.5–25.0 µm, mostly 30.0–37.5 × 20.0–22.5 µm; wall 0.5–1.8 µm, mostly 0.5–1.0 µm thick; spores densely echinulate with 1–2, mostly 1 round to ovoidal smooth area, typically located centrally, smooth area 7.5–17.5 × 6.5–10.0 µm, mostly 10.0–15.0 × 7.5–10.0 µm, spines 1.5–2.5 µm, mostly 1.8-2.2 µm long, irregularly distributed, spines typically straight and perpendicular to the wall, distance between spine bases 1.0–9.0 µm, mostly 1.0–5.0 µm, spine base mostly around 1 µm; germ pores scattered, 5–11, mostly 6–7, 1.3–3.0 µm, mostly 2.0–2.5 µm diam., Ø 2.4 µm diam.

Milesina kriegeriana

(Magnus) Magnus, Bulletin de l’Institute et de jardin botanique de L’Université de Beograd 27: 325 (1909)

Figure 6h

Dryopteris borreri (Newman) Oberholzer & Tavel. Germany, Thüringen: Eichsfeld, Hundeshagen, forest stream canyon, 20 May 2014, H. Thiel (KR, KR-M-0043164).
D. carthusiana (Vill.) H.P. Fuchs. (= Aspidiumspinulosum Sw.). Germany, Sachsen: Bad Schandau, Schrammsteine, Sep 1893, Wegener, II (B, B 700016500); Sächsische Schweiz, 2 Nov 1901, W. Krieger, II (B, B 700016501); Uttewalder Grund, Oct and Nov 1901, W. Krieger (Krieger, Fungi Sax. Exs. 1711; HBG, 1/2338, 2/2338, 3/2338, type); Uttewalder Grund, Nov 1901, P. Magnus (B, B 700016499); Uttewalder Grund, Nov 1901, W. Krieger, II (B, B 700016498); Polenzthal (Polenztal), Königstein (Elbe), Sep 1901, W. Krieger, II (B, B 700016497); Sachsen-Anhalt: Burgenland, Wischroda, Braunsroda, 8 Okt 2013, H. Jage, II (KR, KR-M-0048086); Stendal, Gollensdorf, pine forest, 19 Oct 2014, H. Zimmermann (KR, KR-M-0048085); Wittenberg, Kemberg, Graditz, pine forest, 22 Feb 2014, H. Jage, II (KR, KR-M-0048087); Lüchow-Dannenberg, Dannenberg (Elbe), pine forest, 18 Mar 2014, H. Thiel (KR, KR-M-0043170).
D. dilatata (Hoffm.) A. Gray. Germany, Baden-Württemberg: Schwarzwald, Seebach, wayside, 4 Apr 2017, M. Scholler & M. Wieners (KR, KR-M-0048477); Ortenau, Seebach, NSG “Wilder See-Hornisgrinde”, spruce-fir forest, wayside, 4 Apr 2017, M. Scholler & M. Wieners (KR, KR-M-0048480); Hessen, Werra-Meißner, Lichtenau Hoher Meißner, broadleaved forest, 13 Mar 2014, H. Thiel (KR, KR-M-0043162); Mecklenburg-Vorpommern, Rügen, Putbus, Vilm, forest, 20 Aug 2014, H. Thiel (KR, KR-M-0039321); Rügen, Putbus, Vilm, 20 Aug 2014, S. Hoeflich, H. Jage, II (KR, KR-M-0048357); Niedersachsen, Göttingen, Landolfshausen, Potzwenden, douglas fir-spruce forest, 18 Jan 2014, H. Thiel (KR, KR-M-0043182); Lüchow-Dannenberg, Küsten, Sallahn, pine forest, 10 Nov 2013, H. Thiel (KR, KR-M-0043151); Northeim, Hardegsen, Ertinghausen Meinheitsberg, spruce forest, 21 Jun 2014, H. Thiel (KR, KR-M-0043165); Harz, Osterode, Herzberg, Lonau, spruce forest, 9 Aug 2012, H. Thiel (KR, KR-M-0043184); Sachsen-Anhalt, Wittenberg, Schköna, pine forest, 27 Feb 2014, H. Jage, II (KR, KR-M-0048088).
D. filix-mas (L.) Schott. Germany, Niedersachsen: Northeim, beech forest, 16 Jan 2014, H. Thiel (KR, KR-M-0043178); Sachsen (?): Bad Schandau?, 1895, G. Wagner, II (HBG, 4/2338).

Description.

Urediniospores hyaline, ellipsoidal, obovoidal to oval, clavate, 25.0–47.5 × 12.5–25.0 µm, mostly 27.5–37.5 × 15.0–20.0 µm; wall 0.5–1.2 µm, mostly 0.8–1.0 µm thick; spores echinulate without spine-free areas, spines 1.2–3.0 µm, mostly 1.8–2.2 µm long, irregularly distributed, sometimes in rows, spines typically straight and perpendicular to the wall, distance between spine bases 1.0–6.0 µm, mostly 1.0–4.0 µm, mostly around 1 µm; germ pores scattered, 6–14, mostly 10–11, 1.3–3.0 µm, mostly 2.0–2.5 µm, Ø 2.3 µm diam.

Comment.

See annotation under M.blechni.

Milesina magnusiana

Jaap, Verhandlungen des Botanischen Vereins für die Provinz Brandenburg 57: 16 (1915)

Figure 6i, j

Asplenium adiantum-nigrum L. France, La Corse: Ajaccio, 5 Mar 1933, O. Jaap, II (M, M-0290299, type); Ireland: Kerry, Dingle peninsula, drywall, 30 Aug 1964, Leuze & Doppelbaur (M, M-0205474).

Description.

Urediniospores hyaline, ellipsoidal to obovoidal, 21.3–38.8 × 15.0–22.5 µm, mostly 30.0–35.0 × 17.5–20.0 µm; wall 1.0–2.0 µm, mostly 1.0–1.5 µm thick; spores echinulate with 1–2 ovoidal smooth areas, typically located centrally, smooth area 11.5–17.5 × 6,3–10.0 µm, mostly 15.0–17.5 × 7.5–10.0 µm, spines 1.2–2.8 µm, mostly 2.0–2.2 µm long, irregularly distributed, spines often erect, distance between spines 0.5–9.0 µm, mostly 3.0–5.5 µm; germ pores scattered, 4–9, mostly 5–6, 2.0–4.5 µm, mostly 2.5–3.0 µm diam., Ø 2.9 µm diam.

Milesina murariae

(Magnus) Grove, Journal of Botany, London 59: 311 (1921)

Figure 6k, l

Asplenium ruta-muraria L. Austria, Tirol: Landeck, 22 Feb 1900, O. Jaap, II (HBG, 7/2338); Bad Ratzen, 23 Aug 1908, P. Magnus, II (HBG, 13/2338); Innsbruck, near Klausen, 21 Aug 1902, P. Magnus, II (HBG, 14/2338); Vorarlberg: Bludenz, 21 Aug 1909, P. Magnus, II (HBG, 8/2338); Salzburg: Zell am See, 1 Sep 1890, P. Magnus, II (HBG, 6/2338); France, Alsace: Forbach, Melponte, 12 Jul 1912, A. Ludwig, II (GLM, GLM-53031); Germany, Baden-Württemberg: Freiburg/Breisgau, St. Peter, wall of monastery, 22 Aug 1999, H. Jage (KR, KR-M-0025191); Bodensee, Konstanz, Stockach, “Am Stadtwall”, wall, 29 Aug 2000, H. Jage (KR, KR-M-0025185); Bodensee, Konstanz, Stockach, Oberstadt “Am Stadtwall”, wall, 27 Aug 2001, H. Jage (KR, KR-M-0025768); Tübingen, downtown, wall, 3 Jul 2008, H. Jage (KR, KR-M-0036224); Tübingen, Bebenhausen monastery, 2 Jul 2008, H. Jage (KR, KR-M-0036225); Sigmaringen, Beuron, monastery wall, 29 Jul 2000, H. Jage (KR, KR-M-0025184); Niedersachsen: Hildesheim, town wall, W women’s prison, 1 Mar 2013, H. Thiel (KR, KR-M-0043149); Osterode, Bad Grund, chalk rocks, 16 Jan 2014, H. Thiel (KR, KR-M-0043154); Sachsen: Erzgebirge, Zschopautal, Apr 1902, G. Wagner, (HBG, 5/2338); Sachsen-Anhalt: Spielberg, Burgenlandkreis, Benndorf, wall of churchyard, 2 Jun 2014, H. Jage (KR, KR-M-0048134); Wittenberg, Kemberg, city wall, 13 Jul 2014, H. Jage (KR, KR-M-0048133); Thüringen: Saale-Holzland, Dornburg/Saale, cemetery wall, 21 Oct 2012, H. Jage & G. Vogel (KR, KR-M-0035461); Weimarer Land, Apolda, wall, 9 Oct 2013, H. Jage & G. Vogel, (KR, KR-M-0048132); Sachsen: Wehlen, 12 May 1911, W. Krieger (HBG, 21/2338); Italy, Alto Adige: Voldertal, next to Kreuz Häusle, 8 Sep 1910, P. Magnus, II (HBG, 9/2338); Bolcano, vineyard wall, 4 Sep 1890, P. Magnus, II (HBG, 10/2338); Bolcano, Waidbruck between Tergolerbrücke and Kollmann, 15 Jul 1907, A. Heimerl (HBG, 12/2338); Bolcano, Seis am Schlern, 20 Aug 1908, P. Magnus, II (HBG, 16/2338); Seis am Schlern, 26 Aug 1908, P. Magnus, II (HBG, 18/2338); garden wall in Vahrn, 6 Jul 1905, A. Heimerl, II (HBG, 15/2338 Merano, 14 Sep 1890, P. Magnus, II (HBG, 11/2338); Intra, Lago Maggiore, 18 Sep 1892, P. Magnus, II (HBG, 19/2338); Trentino: St. Cristoforo, Val Lugano, 27 Aug 1910, P. Magnus, II (HBG, 17/2338); Switzerland, Bern: Twann, at Bielersee, 12 Mai 1909, E. Fischer, II (HBG, 20/2338).

Description.

Urediniospores hyaline, ellipsoidal, obovoidal to subglobose, 25.0–42.5 × 15.0–22.5 µm, mostly 27.5–35.0 × 17.5–22.5 µm; wall 1.2–2.2 µm, mostly around 2.0 µm thick; spores echinulate with 1–2, mostly 2 ovoidal smooth areas, typically located centrally, smooth area 11.5–20.0 × 7.5–12.5 µm, mostly 12.5–15.0 × 7.5–10.0 µm, spines 1.5–2.5 µm, mostly 1.8–2.2 µm long, erect, spines curved toward base, denser toward both spore poles, distance between spine bases 0.5–7.0 µm, mostly 2.0–3.5 µm, spine base 0.7–1.4 µm, mostly around 1 µm; germ pores scattered, 3–9, mostly 5–6, 2.0–3.8 µm, mostly 2.0–2.5 µm diam., Ø 2.4 µm diam.

Milesina polypodii

(F.B. White) Aime & Rossman, in Aime, Castlebury, Abbasi, Begerow, Berndt, Kirschner, Marvanova, Ono, Padamsee, Scholler, Thines & Rossman, IMA Fungus 9(1): 83 (2018)

Figure 6m

Polypodium interjectum Shivas. France, Alsace: Wasselnheim, Wangenberg, 23 Oct 1914, A. Ludwig, II (W, 1916-3467); way Fischboedle to Hohneck, 3 Jul 1910, H. Sydow, II (S, F310825); Potigny (Calvados), Bréche-au-Diable, 14 Apr 1911, R. Maire, II (W, 1912-3055; B, B 700016502); Germany, Nordrhein-Westfalen: Märkischer Kreis, Balve, Volkringhausen, moist forest, 16 Aug 2012, H. Thiel, II (KR, KR-M-0043189).
P. × mantoniae Rothm. & U. Schneid. (P.vulgare L. × P.interjectum Shivas). Germany, Niedersachsen: Northeim, SO Vorwerk Levershausen, Langfast Kopf, broadleaved forest, sandstone, 16 Jan 2014, H. Thiel, II (KR, KR-M-0043177).
P. vulgare L. Germany, Baden-Württemberg: Schwarzwald, Ortenau, Lautenbach, Lautenfelsen, 5 Jun 2017, M. Scholler & A. Rubner, II (KR, KR-M-0048694); Schwarzwald, Ortenau, Ottenhöfen, slope near creek, next to Abiesalba, 13 Nov 2017, M. Scholler & R. Buchheit (KR, KR-M-0049181); Schwarzwald, Ortenau, Ottenhöfen, scarp near stream, coniferous forest next to Abiesalba, 13 Nov 2017, M. Scholler & R. Buchheit (KR, KR-M-0049179); Hessen: Hessisch Lichtenau, Hoher Meißner, border area of an open “Basaltblockhalde”, 13 Mar 2014, H. Thiel (KR, KR-M-0043161); Niedersachsen: Ammerland, Bad Zwischenahn, Ofen, mixed forest, 11 Apr 2017, R. Jarling, II (KR, KR-M-0048818); Lüchow-Dannenberg, Höbeck, beech-oak forest, 22 Dec 2013, H. Thiel, II (KR, KR-M-0043146); Rheinland-Pfalz: Bad Kreuznach, Hochstetten-Dhaun, Simmerbachtal near Dhaun castle of Dhaun, 30 Oct 2013, H. Thiel (KR, KR-M-0043152); Schleswig-Holstein: Nordfriesland, Nebel, pine forest, 15 Oct 2014, H. Thiel (KR, KR-M-0043173); Sachsen: Schmilka, Großer Winterberg, 26 Aug 1903, H. & P. Sydow (Sydow & Sydow, Mycoth. germ. 62; W, 1903-13407; S, F29305, type); Schmilka, Großer Winterberg, Aug 1903, H. & P. Sydow (S, F29306, F29307, type); Sachsen-Anhalt, Quedlinburg, Thale, unteres Bodetal, beneath Hexenplatz, 17 Jul 2014, H. Thiel (KR, KR-M-0043157); Thüringen, Eisenach, SSW Wartburg, NNW Eisenacher Burg, 25 May 2012, H. Thiel (KR, KR-M-0043190); Great Britain, Wales: Harlech, 4 Jan 1927, P.G.M. Rhodes (W, 1975-15143, 1973-22169, 1973-22320); Romania, Vîlcea: Muntele Cozia, Omu, 1 Jul 1976, G. Negrean, II (W, 1980-00055); Switzerland, Neuenburg: Gorgier, Creux du Van, 19 Oct 1913, E. Mayor, II (W, 1914-9288); Neuchâtel, Bois, Tête-Plumée, 5 Nov 1909, E. Mayor, (Vestergren, Micromyc. rar. sel. praec. Scand. 1702, W, 1914-9287, 1973-17308,); Neuchâtel, Tête-Plumée, 20 Oct 1913, E. Mayor, II (W, 1915-5830).

Description.

Urediniospores hyaline, ellipsoidal, obovoidal to subglobose, 26.5–42.5 × 15.0–25.0 µm, mostly 30.0–40.0 × 17.5–22.5 µm; wall 0.5–2.5 µm, mostly 0.5–1.0 µm thick; spores echinulate with 1–2, mostly 1 ovoidal smooth area, typically located centrally, smooth area 15.0–22.5 × 6.3–11.3 µm, mostly 15.0–17.5 × 7.5–10.0 µm, spines 1.8–2.8 µm, mostly 1.8–2.2 µm long, irregularly distributed, erect, spines denser toward spore base, distances 0.5–7.0 µm, mostly 1.0–4.0 µm, spine base 0.7–1.6 µm, mostly 0.9–1.2 µm diam.; germ pores scattered, 4–10, mostly 5–6, 1.3–3.8 µm, mostly 2.0–2.5 µm diam., Ø 2.3 µm diam.

Milesina scolopendrii

(Fuckel) Jaap, Fungi selecti exsiccati no. 571 (1912)

Figure 6n

Asplenium scolopendrium L. (Phyllitisscolopendrium (L.) Newman). Germany, Baden-Württemberg: Bodensee, Konstanz, N Langenrain, Überlinger-See, NW part of Blisenhalde, 9 May 1999, H. Jage (KR, KR-M-0025400); Reutlingen, Bad Urach, 12 Sep 2017, M. Scholler & R. Buchheit (KR, KR-M-0049049, KR-M-0049050); Reutlingen, Bad Urach, Gütersteiner Wasserfall, 18 Sep 2017, R. Buchheit (KR, KR-M-0049066); Reutlingen, Bad Urach, Uracher Wasserfälle, 12 Sep 2017, M. Scholler & R. Buchheit (KR, KR-M-0049037, KR-M-0049051); Nordrhein-Westfalen, Märkischer Kreis, Balve, Volkringhausen, moist forest, limestone rocks, 16 Aug 2012, H. Thiel (KR, KR-M-0043186); Rheinland-Pfalz, Bad Kreuznach, Hochstetten-Dhaun, forested slope below Dhaun castle, 30 Oct 2013, H. Thiel, II (KR, KR-M-0043153); Switzerland, Graubünden: 1871-1873, L. Fuckel (G, G 00550757, type).

Description.

Urediniospores hyaline, ellipsoidal to obovoidal, clavate, 27.5–49.0 × 17.5–25.0 µm, mostly 27.5–42.5 × 17.5–22.5 µm; wall 0.5–1.8 µm, mostly 0.5–1.2 µm thick; spores echinulate with 1 mostly ovoidal smooth area, located centrally to apically, smooth area 12.5–20.0 × 7.5–11.3 µm, mostly 15.0–17.5 × 7.5/10.0 µm, spines 1.5–2.8 long, irregularly distributed, erect, distances between spine bases 1.0–9.0 µm, mostly 2.0–5.0 µm, sometimes denser toward spore base, spine base 0.8–1.6 µm, mostly 0.9–1.2 µm diam.; germ pores scattered, 4–9, mostly 6–7, 1.25–3.0 µm, mostly 2.0–3.0 µm diam., Ø 2.4 µm diam.

Milesina vogesiaca

Syd. & P. Syd., Annales Mycologici 8(5): 491 (1910)

Figure 6o, p

Polystichum aculeatum (L.) Roth. (P.lobatum L, Aspidiumlobatum Sw.). Austria, Kärnten: Hermagor, between upper and lower Valentin Alpe next to Mauthen, 26 Aug 1940, H. Poeverlein (W, 1973-28256); Tirol: Alps, western Elbigenalp, Bernhardstal toward Bernhardseck, ravine forest, 28 Aug 1992, H. Jage, II (GLM, GLM-50893); France, Alsace: Lützelhausen, 5 Dec 1914, A. Ludwig, II (GLM, GLM-53028; W, 1916-4290); between Fischboedle and Kerbholz, Hohneck, 12 Jul 1910, H. Sydow (Sydow & Sydow, Mycoth. germ. 878; W, 1973-30304, 1910-006973; S, F29337, F29338, 29339, type); Vosges, between Fischboedle and Kerbholz, Hohneck, 16 Jul 1910, H. Sydow (Sydow, Uredineen 2345; B, B 700016496; W, 1973-07263, 1911-3905, type); between Fischboedle and Kerbholz, Hohneck, 16 Jul 1910, H. Sydow (S, F310782; B, B 700016495, type); Germany, Baden-Württemberg: Todtmoos, Au, Wehratal, Hagenmattgraben, 23 Aug 2001, H. Jage (sub M.neoexigua), corr. M. Scholler (KR, KR-M-0019138); Bayern: Oberallgäu, Oberjoch, Iseler, spruce-fir forest, 24 Jun 2008, M. Scholler (KR, KR-M-0003907); Hessen: Werra-Meißner, Eschwege, Albungen, Trenkgraben, broadleaved forest, 13 Apr 2013, H. Thiel (KR, KR-M-0043160); Niedersachsen, Osterode, Herzberg, Scharzfeld, Rottsteine, beech forest, limestone rocks, 29 Mar 2014, H. Thiel (KR, KR-M-0043175); Nordrhein-Westfalen: Märkischer Kreis, Balve, Volkringhausen, moist forest, 16 Aug 2012, H. Thiel, II (KR, KR-M-0043187).
P. lonchitis (L.) Roth. Austria, Tirol: Alps, Lechtal, south east Holzgau, Sulzltal, 1 km south of Ronig-Alm, “Hochstaudenbergflur” 17 Aug 1991, H. Jage, II (GLM, GLM-50866).

Description.

Urediniospores hyaline, ellipsoidal to obovoidal, clavate, 27.5–45.0 × 15.0–25.0 µm, mostly 30.0–40.0 × 17.5–20.0 µm; wall 0.5–1.0 µm, mostly 0.5–0.8 µm thick; spores with flat verrucae verrucae 0.3–0.6 µm, mostly 0.4–0.5 µm in diam., mainly at the upper part of the spore (visible with SEM only); germ pores often bizonate, sometimes scattered, 3–8 mostly 5–6, 2.0–4.5 µm, mostly 2.5–3.0 µm diam., Ø2.8 µm diam.

Comment.

See commentary under M.exigua.

Milesina whitei

(Faull) Hirats., Memoirs of the Tottori Agricultural College 4: 123 (1936)

Figure 6q, r

Polystichum aculeatum (L.) Roth (syn. P.lobatum L, Aspidiumlobatum Sw.). Croatia, Dalmatia: Castelnuovo, 25 Apr 1914, O. Jaap (FH, FH 01146298, type).
Polystichum setiferum (Forsk.) Moore ex Woynar., Austria, Steiermark: Deutschlandberg, Klause, Laßnitz, northern bank of the river, rock, 31 Jul 2018, M. Scholler & C. Scheuer (KR, KR-M-0050248); Switzerland, Ticino: Locarno, Cugnasco, Valle di Cugnasco, ravine, 9 Dec 2017, L. Beenken (KR, KR-M-0044953); Vaud, Montreux, Gorges du Chadron, 30 Apr 2011, T. Brodtbeck, II (KR, KR-M-0049177).
Polystichum sp. Austria, Steiermark: Possruck, ravine, 19 Nov 1972, J. Poelt (KR, KR-M-0039378).

Description.

Urediniospores hyaline, ellipsoidal, obovoidal to oval, 27.5–40.0 × 16.5–25.0 µm, mostly 27.5–37.5 × 17.5–22.5 µm; wall 0.5–1.0 µm, mostly 0.8–1.0 µm thick; echinulate without spine-free areas, spines 1.8–2.8 µm, mostly around 1.8–2.5 µm long, irregularly distributed, straight and perpendicular to the wall, distance between spine bases 1.0–8.0 µm, mostly 1.5–5.0 µm, spine base 0.5–1.2 µm, mostly 0.8–1.1 µm diam.; germ pores scattered, 8–15 (17), mostly 9–13, 1.3–3.0 µm, mostly 2.0–2.5 µm diam., Ø2.3 µm diam.

Comment.

The North American Milesinapolystichi (Wineland) Grove (= Milesiapolystichi Wineland) on Polystichummunitum (Kaufl.) Presl. is considered conspecific with M.whitei by several authors (e.g. Gäumann 1959). We were able to study isotype material (USA, Oregon, Granite Pass, 5 Sep 1916, leg. R.J. Weir, PUR 004047) and found urediniospores with mostly 5 to 6 germ pores, i.e. many fewer than in M.whitei. Due to this striking difference, they are possibly different species.

Milesina woodwardiana

Buchheit & M. Scholler sp. nov.

829596

Figure 7a–f

Holotype.

Woodwardiaradicans (L.) Sm., Spain, Islas Canarias, La Palma, Cubo de la Galga, ca. 2.5 km SW parking place at coastal highway W San Bartolomé, wayside in Laurosilva, 11 Aug 2017, V. Kummer (KR-M-0049033).

Further specimens examined (paratypes)Spain, Islas Canarias: La Palma, Cubo de la Galga, ca. 1.2 km SW of parking lot at coastal highway W San Bartolomé, wayside in Laurosilva, 16 Aug 2015, V. Kummer, II (KR, KR-M-0048787); La Palma, Cubo de la Galga, ca. 1.2 km SW parking lot at coastal highway W San Bartolomé, near waypoint 6, wayside in Laurosilva, 11 Aug 2017, V. Kummer, II (KR, KR-M-0049036); La Palma, Cubo de la Galga, ca. 1.25 km SW parking lot at coastal highway W San Bartolomé, between waypoint 6 and 7, wayside in Laurosilva, 11 Aug 2017, V. Kummer, II (KR, KR-M-0049034).

Description.

Spermogonia (0), aecia (I), telia (III) and basidia (IV) unknown. Uredinia hypophyllous, subepidermal, statistically distributed; sori round, wart-like elevations, 0.1–0.3 mm in diam., covered by brownish or yellow-brownish epidermis, on dark necrotic plant tissue margined by nerves, never on nerves directly, sori opening pore-like; peridium hemispheric, peridial cells colourless, about 7.5–25.0 × 7.5–10 µm, upper peridial cells more or less isodiametrical and lateral peridial cells elongated; urediniospores hyaline, ellipsoidal to obovoidal, sometimes subglobose to irregular, 25.5–46.5 × 15.0–25.0 µm, mostly 30.0–37.5 × 17.5–22.5 µm; cell wall thin, 0.5–1.2 µm, mostly 0.5–1.0 µm thick, densely echinulate without spine-free areas, densest at spore base, spines 2.0–3.2 µm long, mostly 3.0 µm long, slightly irregularly distributed, spines orientated in different directions, dense basal spines typically directed toward spore pedicel, distance between spines bases 0.5–5.0 µm, mostly 2.0–4.0 µm, spine base 0.6–1.3 µm, mostly around 1 µm; spore pedicel often laterally or semilaterally inserted, short and wide, 5.5–14 × 12.5–15.5 µm; germ pores scattered, 8–19 (21), mostly 10–14, 1.3–3.0 µm, mostly 2.0–3.0 µm diam., Ø 2.4 µm diam.; germ tubes septate, may develop simultaneously in one spore.

Distribution.

The species is only known north-eastern La Palma, Islas Canarias, Spain.

Etymology.

Referring to the English botanist Thomas Jenkinson Woodward (1745 – 1820) and the host plant Woodwardiaradicans named after him.

Comment.

This species differs from M.blechni by the telial host plant genus (Woodwardia), by a higher number of germ pores/spore, longer spines and irregular spine orientation. Milesinawoodwardiana is the first Milesina species known on Woodwardia (Berndt 2008; Faull 1932). The absence of potential aecial hosts (Abies spp.) in La Palma and all other Canary Islands (Hohenester and Welss 1993, Ginovés et al. 2009) and the non-formation of telia indicate that the species is not host-alternating in La Palma. The Woodwardiaradicans area (Hohenester and Welss 1993), however, overlaps with those of Abies×borisii-regis, A.cephalonica and A.pinsapo in south-western Europe (Liu 1971). If the rust is present in this area, it may be possible to observe the spore stages 0 and I on Abies spp. Woodwardiaradicans is the only species of Woodwardia in Europe. There are numerous other species in SE Asia and N America (Li et al. 2016). These areas may also coincide with the distribution area of M.woodwardiana.

Milesina spp.

Abies alba Mill. Austria, Steiermark: Trog, Mausegg, Höllental, Klamm, N river bank, 31 Jul 2018, M. Scholler & C. Scheuer, 0, I (KR, KR-M-0050303); Germany, Baden-Württemberg: Esslingen, Kirchheim unter Teck, NW Owen, 18 Sep 2017, R. Buchheit, I (KR, KR-M-0049065); Freudenstadt, Baiersbronn, NSG “Wilder See-Hornisgrinde”, Karwand, mixed spruce-fir forest, 12 Sep 2015, M. Scholler, I (KR, KR-M-0043687); Ortenaukreis, Friesenheim, E Oberweier near Schnaiggraben, mixed forest, 17 Aug 2005, M. Scholler (KR, KR-M-0018587); Ortenaukreis, SSW Oppenau, “Ibacher Holzplatz“ mixed spruce-fir forest, 18 Aug 2005, M. Scholler (KR, KR-M-0018624); Ottenhöfen, “Edelfrauengrab Wasserfälle”, creek bank, 26 Jun 2017, M. Scholler (KR, KR-M-0048773); Rastatt, Gernsbach, Lauterbach, NSG “Lautenfelsen“, eastern crosscut, beyond “Aussichtfelsen”, 11 Sep 2014, M. Scholler (KR, KR-M-0042052); Rastatt, Loffenau, “Großes Loch“ near Loffenau, 15 Sep 2017, R. Buchheit (KR, KR-M-0049038); Reutlingen, W Bad Urach, “Tannenverjüngung“, 18 Sep 2017, R. Buchheit, I (KR, KR-M-0049068); Bayern: Garmisch-Partenkirchen, Grainau, S Eibsee, spruce-fir forest, 8 Aug 2017, M. Scholler (KR, KR-M-0049063); Miesbach, Schliersee, S Spitzingsee, E Roßkopf, spruce-fir forest close to Struthiopterisspicant, 8 Aug 2017, M. Scholler (KR, KR-M-0049062).

Comment.

In this study, Milesina spp. on Abiesalba were only sequenced but not morphologically analysed.

Subgeneric classification

Four morphological groups can be distinguished within Milesina with respect to germ pore number, germ pore size, germ pore position and distribution of spines on the spore surface (Figures 6a–r, 7d–f, Table. 4). The morphological differentiation corresponds with the differentiation in four clades found by molecular data (Figure. 1, right panel).

Milesina sect. Milesina

Type species.

M.kriegeriana (Magnus) Magnus 1909.

This type section is characterised by urediniospores having numerous scattered germ pores and an echinulate wall without smooth areas. Milesinablechni, M.whitei and M.woodwardiana are additional members of this section.

Milesina sect. Vogesiacae

M. Scholler & Bubner sect. nov.

829594

Type species.

M.vogesiaca Syd. & P. Syd. 1912.

This section is characterised by urediniospores having few bipolarly distributed germ pores and a smooth or almost smooth wall. Milesinaexigua is included in this section. Urediniospore features of European Uredinopsis spp. resemble those of Vogesiacae species. However, Uredinopsis spores have a terminal mucro.

Milesina sect. Scolopendriorum

M. Scholler & Bubner sect. nov.

829597

Type species.

M.scolopendrii (Fuckel) Jaap 1912.

This section is characterised by urediniospores having few scattered germ pores and an echinulate wall with smooth areas. Milesinafeurichii, M.polypodii, M.magnusiana and M.murariae are in this section. M.magnusiana agrees well with the other species with respect to morphology. Therefore, we placed it in section Scolopendriorum, although no ITS data are available.

Milesina sect. Carpaticae

M. Scholler & Bubner sect. nov.

829595

Type species.

M.carpatica Wróbl. 1913

This section is characterised by urediniospores having few scattered germ pores and an echinulate wall without smooth areas. It is similar to section Milesina in having an echinulate cell wall, but the number of germ pores is lower (only 5-7). The ITS sequences of the two sections are separated by a large genetic distance. So far, this section is represented only by the type species. Possibly, the North American M.polystichi belongs to this section as well (see commentary to M.whitei).

Key to European Milesina species

The following key to European Milesina sections and species is based on urediniospore (abbreviated Us) features listed in Table 4. It requires light-microscopical equipment and methods described in the Methods section. The lengths of the urediniospores refer to the main values.

1	Us with terminal mucro	*Uredinopsis*
–	Us without terminal mucro (Milesina)	2
2	Surface of Us smooth or almost smooth, germ pores often formed apically (sect. Vogesiacae)	3
–	Surface of Us echinulate, sometimes with particularly smooth areas, germ pores scattered	4
3	Us mostly 30.0–40.0 × 17.5–20.0 µm, germ pores up to 4.5 µm diam. (Polystichumaculeatum)	M. vogesiaca
–	Us smaller, mostly 22.5–30.0 × 12.5–17.5 µm, germ pores smaller, up to 3.8 µm diam. (germ pores are often not visible, check numerous Us) (Polystichumbraunii, P.aculeatum)	M. exigua
4	Surface of Us with smooth spine-free areas, germ pores ± 6 (Sect. Scolopendriorum)	5
–	Surface of Us without smooth spine-free areas, germ pores either ± 6 (M.carpatica, sect. Carpaticae) or ± 11 (species of sect. Milesina)	9
5	Us mostly 27.5–35.0 µm long, wall mostly 2.0 µm thick (Aspleniumruta-muraria)	M. murariae
–	Us mostly more than 30.0 µm long, wall mostly thinner (< 2 µm)	6
6	Us mostly 30.0–40.0 µm long (Polypodium spp.)	M. polypodii
–	Us shorter, mostly 30.0‒37.5 µm	7
7	Spine distance mostly 1.0‒4.0 µm (Aspleniumseptentrionale)	M. feurichii
–	Spine distance 2.0‒5.5 µm	7
8	Spine distance mostly 3.0‒5.5 µm, Us 30.0–35.0 × 17.5‒20.0 µm, germ pore 2.9 µm diam. (Aspleniumadiantum-nigrum)	M. magnusiana
–	Spine distance 2.0‒5.0 µm, Us 27.5–42.5 × 17.5–22.5 µm, germ pore < 2.5 diam. (Aspleniumscolopendrium)	M. scolopendrii
9	Us mostly 20.0‒30.0 × 12.5‒19.0 µm, wall 0.5‒1.0 µm thick, spines mostly 1.0‒1.8 µm long, germ pores usually 6, mostly 1.3‒2.0 µm diam., pores hardly visible (check numerous Us) (Dryopterisfilix-mas) (sect. Carpaticae)	M. carpatica
–	Us larger, mostly 27.0 ‒ 37.5 × 17.5 ‒ 22.5 µm, germ pores ± 11	9
10	Spines ± 3.0 µm long, orientated in different directions, Us mostly 30.0‒37.5 × 17.5‒22.5 µm (Woodwardiaradicans)	M. woodwardiana
–	Spines shorter, < 3.0 µm long, typically perpendicular to the wall	11
11	Us mostly ≥ 17.5 µm wide, 27.5‒40.0 × 16.5–25.0 µm, spines erect (Polystichumaculeatum, P.setiferum)	M. whitei
–	Us ± 17.5 µm wide, sometimes spines arranged in rows, typically erect (the following two species are morphologically barely distinguishable)	12
12	Us mostly 27.5–37.5 µm long (Dryopterisborreri, D.carthusiana, D.dilatata, D.filix-mas	M. kriegeriana
–	Very similar, Us somewhat longer on average, mostly 30.0–37.5 µm (Struthiopterisspicant)	M. blechni

Open in a new tab

Discussion

Species resolution by urediniospore features

In previous studies of the genus Milesina (e.g. Wróblewski 1913; Faull 1932; Kuprevič and Tranzschel 1957; Berndt 2008), size and shape of urediniospores, wall thickness, spine length and density were the main features used to characterise their morphology. In this study, additional morphological features and criteria are provided to distinguish species (Figure 5, Table 4).

The number, position and size of germ pores have not been documented even in more recent studies of Milesina (Berndt 2008). Additionally, in Chrysomyxa, another genus of Pucciniastraceae (Cao et al. 2017), no germ pores were shown. Germ pores in Milesina are documented in Cummins and Hiratsuka (2003). The authors report “bizonate, obscure” germ pores for species of the genus. We found this character only in the two species of the section Vogesiacae. A further observation of germ pores is reported for two North American species Milesinapolypodophila (Bell) Faull and Milesinamarginalis Faull & Watson (Moss 1926) where germ pores showed a scattered distribution. With our light microscopic method, detection of germ pores was easy and could be realised within short time. In two species, M.carpatica and M.exigua, germ pores were more difficult to visualise and need more time to evaluate. In general, however, this method is suitable to document an important morphological and taxonomically relevant feature. It may also help to characterise other genera in the Pucciniastraceae. Another feature, smooth areas on the surface of urediniospores has not been documented so far. It is a special character of species of section Scolopendriorum. All of these features in combination allow identification of Milesina species in Europe by urediniospore features alone, using a light microscope even without knowledge of the host plant species. Only one pair of species, the common M.blechni and M.kriegeriana, is difficult to distinguish morphologically. We only found differences in spore length measurements.

In general, identification using only the host is unreliable, since the range of telial hosts in Milesina has been only scarcely studied. This holds true even for common species like M.kriegeriana, a species which has obviously a much wider host range with species in different host families (Berndt 2008) than listed in European compilatory literature (e.g. Gäumann 1959; Majewski 1977; Klenke and Scholler 2015). Polystichumaculeatum is known for hosting M.carpatica and M.vogesiaca (e.g. Gäumann 1959; Majewski 1977; Klenke and Scholler 2015). In the present study, M.exigua was also found on P.aculeatum, demonstrating again that the host range may be wider for several Milesina species and that host identification is not sufficient to identify Milesina spp.

Species resolution by barcoding

We were able to classify four sections by phylogenetic analysis of ITS sequences (Fig. 1) but we were only able to differentiate 4 of 11 species. This low differentiation is in contrast to another genus in the suborder Melampsorineae sensu Aime (2006). In the genus Chrysomyxa, almost all species could be resolved on the basis of ITS barcodes (Cao et al. 2017). Still, amongst the three tested barcodes ITS, nad6 and 28S in the present study, ITS showed the highest species resolution because it could resolve the pairs M.whitei/kriegeriana and M.blechni/woodwardiana.

The alternative barcode nad6 has been tested on different rust species (Vialle et al. 2009, Feau et al. 2011, Vialle et al. 2013). It was chosen for the present study because, in a study on Melampsora spp., it was the only barcode amongst six tested barcodes (ITS, 28S; CO1, nad6, MS277, MS208) that could distinguish the species Melampsoralaricis-tremulae and Melampsorapinitorqua (Vialle et al. 2013) on the basis of a Single Nucleotide Polymorphism. As seen from the branch lengths in Figure 1 and Figure 2 (compare also the scale bars), nad6 sequences show the lowest variation between the sections Milesina, Scolopendriorum, and Vogesiacae as compared to the other two markers. Within the sections Milesina and Scolopendriorum, the sequences were completely identical amongst the species. This low variation makes this marker more suitable for studies on infrafamiliar level than for species distinction on the infrageneric level.

The fungal barcode 28S rDNA is the second most widely used, following ITS (Schoch et al. 2012). It it used for phylogenetic analysis of rusts on the infrafamiliar or higher taxonomic level (Maier et al. 2003, Aime et al. 2006, Yun et al. 2011), but also the identification of closely related species (V, Beenken 2014, Maier et al. 2016, Beenken et al. 2017, Demers et al. 2017, Zhao et al. 2017). In the studies that directly compare ITS with 28S data, species resolution of ITS and 28S are comparable (Ali et al 2016, Beenken et al. 2012, Beenken et al. 2017, Feau et al. 2011) or ITS (namely the sub region ITS2) shows a slightly better resolution (Kenaley et al 2018, McTaggart and Aime 2018). However, when species could not be distinguished with ITS data, distinction was also not possible with 28S data. For instance, European specimens of Coleosporium species C.euphrasiae (Schumach.) G. Winter, C.campanulae (Pers.) Lév. and C.senecionis (Pers.) Fr., each occurring on telial hosts in different plant families, could neither be distinguished by ITS nor by 28S sequences. This is also clearly the case in the present study for the Milesina species in the sections Milesina and Scolopendriorum that colonise different fern species, but have almost identical ITS and 28S sequences.

One possible solution to lacking species resolution is to declare all specimens with the same ITS sequence data as one species, which was the original concept of ITS barcoding (Schoch et al. 2012). However, it is not only the telial host that differs between the Milesina species in the section Scolopendriorum, but also the features of the urediniospores (see identification key and Table 4). In the case of contradicting results, it is not advisable to weight the ITS data as more reliable than the morphological/host data. In the ascomycete genus Fusarium, several species complexes could not be resolved by ITS data, but with newly developed barcodes TOPI (Topoisomerase I) and PGK (phosphoglycerate kinase, Al-Hatmi et al. 2016). It is also possible that, for the rust fungi, new barcodes can be developed on the basis of genomic data (Aime et al. 2018b) that finally allow morphologically determined species to be resolved.

Success of sequencing

Not all specimens studied morphologically were used for sequencing (i.e. old specimens, type specimens, specimens with little spore material) and not all of those specimens, where DNA was extracted, were successfully sequenced. The rate of successful ITS sequencing (63%) is relatively low. In a previous study on Melampsora rust fungi on Salix, the rate of ITS sequencing success (93%) was much higher (Bubner et al. 2014). The Melampsora study comprised exclusively freshly collected specimens not older than half a year, whereas we also analysed herbarium material that was several years old. However, freshly collected specimens (from 2017) also failed, while the two oldest successful specimens are from 1999. Therefore, it is not only the age of the samples that explains the low success of sequencing. It is possible that the small and fragile sori of Milesina species (in comparison, for instance, to Melampsora sori on Salix) are more prone to DNA decay on the herbarium specimens.

Even more surprising is the low success rate for the 28S sequencing. The 28S sequencing was performed only on samples with successful ITS sequencing. Template DNA should be present because both loci belong to the same multicopy rDNA region on the nuclear DNA. Despite this linkage, 28S is reported to have a PCR success rate of only 80% as compared to ITS in a large scale study on Basidiomycota including Pucciniomycotina (Schoch et al. 2012). Nevertheless, in recent phylogenetic studies on rusts, often concatenated alignments of ITS and 28S are used (e.g. Beenken 2017, Demers et al. 2017, McTaggart and Aime 2018, Vialle et al. 2013) which requires that both ITS and 28S can be sequenced. Although phylogenetic studies rarely report a success rate, it can be assumed that routine sequencing of both loci is possible. The low sequencing success in Milesina could be a genus-specific problem. We used 28S primers (ITS4BRF, LR5) which Vialle et al. (2013) successfully used for sequencing Melampsora spp. on poplars for Milesina spp., however, with much less success. Possibly 28S rDNA of Milesina is more difficult to sequence than in other rust genera. Other primer combinations for sequencing 28S rDNA are available and could be tested. The requirements of further testing demonstrate that, in the genus Milesina, species identification by barcode sequencing is still far from being routine.

Section Vogesiacae

The support values for section Vogesiacae are smaller than for the other three Milesina sections when M.exigua is included. Interestingly, the support values are 100/1/100 for an ITS tree with Pucciniagraminis as outgroup. The decision to place both M.vogesiaca and M.exigua into one section is more strongly supported by morphological than by molecular data. Milesinavogesiaca and M.exigua are the only two species that have urediniospores without ornamentation and a bizonate position of germ pores. Further support for a molecularly and morphologically defined clade is given through Uredinopsisfilicina. In the ITS phylogram, it groups behind a node with high support values that includes both M.vogesiaca and M.exigua. The inclusion of U.filicina within a clade, that comprises all Milesina species (also M.carpatica), indicates that the genus Milesina is paraphyletic. The paraphyly is also indicated in the nad6 and 28S phylograms. Furthermore, M.vogesiaca, M.exigua and U.filicina form a group with high support values in 28S phylogram.

By morphology of urediniospores, U.filicina (the type species of Uredinopsis) is similar to the two Milesina species in the section Vogesiacae because it also has smooth urediniospores (Gäumann 1959). Germ pores have not been analysed so far. Germ pores are reported for two North American species, U.osmundae Magnus and U.atkinsonii Magnus (Moss 1926). Urediniospores are smooth and show the same bizonate position of germ pores as documented for M.vogesiaca and M.exigua. A recent study on molecular age estimates in Pucciniales presents 28S data of Melampsorineae that also comprises a limited selection of Uredinopsis and Milesina specimens (Figure 3 in Aime et al. 2018a). The species U.osmundae, U.filicina and M.vogesiaca group together, while M.scolopendrii and an undetermined Milesina species form a sister clade. This confirms the topology of the trees in the present study. The molecular and the morphological data indicate that at least U.filicina is actually a Milesina species in the clade Vogesiaceae. To place U.filicina (and possible other species of Uredinopis) in the genus Milesina, however, requires a more comprehensive sampling of Uredinopsis species and sequencing of both ITS and 28S rDNA (study in preparation).

Host alternation in section Milesina

Amongst the 11 sequences of specimens found on the aecial host Abiesalba, nine could be assigned to the section Milesina. Although this section contains four species, the question which species is able to form aeciospores on Abiesalba can be narrowed down to three species. Only telial hosts of M.blechni, M.kriegeriana and M.whitei grow in the distribution area of Abiesalba in Europe. Therefore, M.woodwardiana can be excluded, because the host Woodwardiaradicans is restricted to Macaronesia and the Mediterranean (Hohenester and Welss 1993, Li et al. 2016) from where no Milesina sequences from the aecial host (Abies spp.) are available. In addition, M.woodwardiana obviously does not form telia and, consequently, no basidia and basidiospores. Basidiospores, however, are necessary to infect Abies.

The answer to the question which of the two species M.whitei / M.kriegeriana has an alternate host needs further field observation and experimental studies (inoculation experiments). Our specimens most probably belong to M.kriegeriana, because they were all collected in the Black Forest area (SW Germany) where we found M.kriegeriana many times on the telial host but not M.carpatica. Inoculation experiments should not only include the hosts of M.whitei (Polystichum spp.) and M.kriegeriana (Dryopteris spp.), but also Struthiopterisspicant, the host of M.blechni. This would further help to answer the question whether M.blechni and M.kriegeriana are distinct species or not. Despite the SNP at position 381, both species are very similar in urediniospore morphology. Inoculation experiments would provide further arguments to clarify the status of the two species. Another approach to analyse both host alternation and species distinction in the section Milesina would be to measure gene flow between the aecial (Abies) and the different telial hosts (ferns) by population genetics. Gene flow measurements in rust fungi have been applied to Melampsoralarici-populina (Barres et al. 2012; Elefsen et al. 2014).

Conclusion

Both morphological features of the urediniospores and ITS sequences provide data to distinguish subgeneric groups (sections) in the genus Milesina. Apart from the two related species, M.blechni and M.kriegeriana in the section Milesina, morphological characteristics of urediniospores are sufficient to distinguish all European species in the genus Milesina. In contrast, ITS, nad6 and 28S barcodes worked only for the sections Carpaticae and Vogesiacae and failed to resolve species in the sections Milesina and Scolopendriorum. Therefore, morphology of urediniospores, in conjunction with host determination, is still a more secure and faster tool to identify species in Milesina on the telial host. Other markers have to be developed for quicker and more secure identification with barcodes.

Supplementary Material

XML Treatment for Milesina blechni

mycokeys.48.30350-treatment1.xml^{(18.5KB, xml)}

XML Treatment for Milesina carpatica

mycokeys.48.30350-treatment2.xml^{(15.1KB, xml)}

XML Treatment for Milesina exigua

mycokeys.48.30350-treatment3.xml^{(18.2KB, xml)}

XML Treatment for Milesina feurichii

mycokeys.48.30350-treatment4.xml^{(14.4KB, xml)}

XML Treatment for Milesina kriegeriana

mycokeys.48.30350-treatment5.xml^{(19.9KB, xml)}

XML Treatment for Milesina magnusiana

mycokeys.48.30350-treatment6.xml^{(13.9KB, xml)}

XML Treatment for Milesina murariae

mycokeys.48.30350-treatment7.xml^{(17.7KB, xml)}

XML Treatment for Milesina polypodii

mycokeys.48.30350-treatment8.xml^{(19.6KB, xml)}

XML Treatment for Milesina scolopendrii

mycokeys.48.30350-treatment9.xml^{(15.6KB, xml)}

XML Treatment for Milesina vogesiaca

mycokeys.48.30350-treatment10.xml^{(17.1KB, xml)}

XML Treatment for Milesina whitei

mycokeys.48.30350-treatment11.xml^{(17.9KB, xml)}

XML Treatment for Milesina woodwardiana

mycokeys.48.30350-treatment12.xml^{(16.9KB, xml)}

XML Treatment for Milesina

mycokeys.48.30350-treatment13.xml^{(18.6KB, xml)}

XML Treatment for Milesina sect. Milesina

mycokeys.48.30350-treatment14.xml^{(3.5KB, xml)}

XML Treatment for Milesina sect. Vogesiacae

mycokeys.48.30350-treatment15.xml^{(3.9KB, xml)}

XML Treatment for Milesina sect. Scolopendriorum

mycokeys.48.30350-treatment16.xml^{(4.5KB, xml)}

XML Treatment for Milesina sect. Carpaticae

mycokeys.48.30350-treatment17.xml^{(4KB, xml)}

Acknowledgements

Curators of the herbaria B, FH, G, GLM, HBG, KR, M, PUR, S and W provided loans for Milesina specimens. Numerous collectors provided additional specimens: Ludwig Beenken, Thomas Brodtbeck, Horst Jage, René Jarling, Christian Scheuer and Hjalmar Thiel. Uwe Braun delivered taxonomic expertise, Matthias Lutz and Larry Dunkle reviewed earlier drafts of the manuscript and Wolfgang Mayer provided literature on Milesina. Special thanks are due to Sascha Hentschel and Petra Knauer for technical assistance and Max Wieners, student assistant, who managed the database input and part of the herbarium preparation work. Barcoding and field studies were supported by the German Federal Ministry of Education and Research (BMBF FKZ 01LI1501l) (grant to B. Bubner, M. Scholler). Field studies in the Black Forest National Park were supported by institutions (Regierungspräsidium Karlsruhe, Black Forest National Park) of the state of Baden-Württemberg, Germany (project “Pilzflora Wilder See”, grant to M. Scholler).

Citation

Bubner B, Buchheit R, Friedrich F, Kummer V, Scholler M (2019) Species identification of European forest pathogens of the genus Milesina (Pucciniales) using urediniospore morphology and molecular barcoding including M. woodwardiana sp. nov. MycoKeys 48: 1–40. https://doi.org/10.3897/mycokeys.48.30350

Supplementary materials

Supplementary material 1

This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Ben Bubner, Ramona Buchheit, Frank Friedrich, Volker Kummer, Markus Scholler

Milesina ITS

Data type: multimedia

Explanation note: Fig. S1.

mycokeys-48-001-s003.nex^{(70.5KB, nex)}

Supplementary material 2

Ben Bubner, Ramona Buchheit, Frank Friedrich, Volker Kummer, Markus Scholler

Milesina Nad6

Data type: multimedia

Explanation note: Fig. S2.

mycokeys-48-001-s003.nex^{(70.5KB, nex)}

Supplementary material 3

Ben Bubner, Ramona Buchheit, Frank Friedrich, Volker Kummer, Markus Scholler

Milesina 28S

Data type: multimedia

Explanation note: Fig. S2.

mycokeys-48-001-s003.nex^{(70.5KB, nex)}

References

Abbasi M, Goodwin SB, Scholler M. (2005) Taxonomy, phylogeny, and distribution of Pucciniagraminis, the black stem rust: new insights based on rDNA sequence data. Mycoscience 46: 241–247. 10.1007/s10267-005-0244-x [DOI] [Google Scholar]
Aime MC. (2006) Towards resolving family-level relationships in rust fungi (Uredinales). Mycoscience 47: 112–122. 10.1007/s10267-006-0281-0 [DOI] [Google Scholar]
Aime MC, Matheny PB, Henk DA, Frieders EM, Nilsson RH, Piepenbring M, McLaughlin DJ, Szabo LJ, Begerow D, Sampaio JP, Bauer R, Weiss M, Oberwinkler F, Hibbett D. (2006) An overview of the higher level classification of Pucciniomycotina based on combined analyses of nuclear large and small subunit rDNA sequences. Mycologia 98: 896–905. 10.3852/mycologia.98.6.896 [DOI] [PubMed] [Google Scholar]
Aime MC, Bell CD, Wilson AW. (2018a) Deconstructing the evolutionary complexity between rust fungi (Pucciniales) and their plant hosts. Studies in Mycology 89: 143–152. 10.1016/j.simyco.2018.02.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
Aime MC, Castlebury LM, Abbasi M, Begerow D, Berndt R, Kirschner R, Marvanova L, Ono Y, Padarnsee M, Scholler M, Thines M, Rossmann A. (2018b) Competing sexual and asexual generic names in Pucciniomycotina and Ustilaginomycotina (Basidiomycota) and recommendations for use. IMA Fungus 9: 75–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
Al-Hatmi AMS, Van Den Ende AHGG, Stielow JB, Van Diepeningen AD, Seifert KA, McCormick W, Assabgui R, Graefenhan T, De Hoog GS, Levesque CA. (2016) Evaluation of two novel barcodes for species recognition of opportunistic pathogens in Fusarium. Fungal Biology 120: 231–245. 10.1016/j.funbio.2015.08.006 [DOI] [PubMed] [Google Scholar]
Ali B, Sohail Y, Toome-Heller M, Mumtaz AS. (2016) Melampsorapakistanica sp. nov., a new rust fungus on Euphorbiahelioscopia (Sun spurge) from Pakistan. Mycological Progress 15: 1285–1292. 10.1007/s11557-016-1244-2 [DOI] [Google Scholar]
Barres B, Dutech C, Andrieux A, Halkett F, Frey P. (2012) Exploring the role of asexual multiplication in poplar rust epidemics: impact on diversity and genetic structure. Molecular Ecology 21: 4996–5008. 10.1111/mec.12008 [DOI] [PubMed] [Google Scholar]
Beenken L. (2014) Pucciniales on Annona (Annonaceae) with special focus on the genus Phakopsora. Mycological Progress 13: 791–809. 10.1007/s11557-014-0963-5 [DOI] [Google Scholar]
Beenken L. (2017) Austropuccinia: a new genus name for the myrtle rust Pucciniapsidii placed within the redefined family Sphaerophragmiaceae (Pucciniales). Phytotaxa 297: 53–61. 10.11646/phytotaxa.297.1.5 [DOI] [Google Scholar]
Beenken L, Lutz M, Scholler M. (2017) DNA barcoding and phylogenetic analyses of the genus Coleosporium (Pucciniales) reveal that the North American goldenrod rust C.solidaginis is a neomycete on introduced and native Solidago species in Europe. Mycological Progress 16: 1073–1085. 10.1007/s11557-017-1357-2 [DOI] [Google Scholar]
Beenken L, Zoller S, Berndt R. (2012) Rust fungi on Annonaceae II: the genus Dasyspora Berk. and M.A. Curtis. Mycologia 104: 659–681. 10.3852/11-068 [DOI] [PubMed] [Google Scholar]
Berndt R. (2008) The rust fungi (Uredinales) on ferns in South Africa. Mycological Progress 7: 7–19. 10.1007/s11557-007-0548-7 [DOI] [Google Scholar]
Bubner B, Wunder S, Zaspel I, Zander M, Gloger J, Fehrenz S, Ulrichs C. (2014) Melampsora rust species on biomass willows in central and northeastern Germany. Fungal Biology 118: 910–923. [DOI] [PubMed] [Google Scholar]
Cao J, Tian C-M, Liang Y-M, You C-J. (2017) Two new Chrysomyxa rust species on the endemic plant, Piceaasperata in western China, and expanded description of C.succinea. Phytotaxa 292: 218–230. 10.11646/phytotaxa.292.3.2 [DOI] [Google Scholar]
Cummins JB. (1971) The rust fungi of cereals, grasses and bamboos. Springer, Berlin, Heidelberg, New York, 570 pp 10.1007/978-3-642-88451-1 [DOI] [Google Scholar]
Cummins JB, Hiratsuka Y. (2003) Illustrated genera of rust fungi. Third edition. American Phytopathological Society, APS Press, Minnesota, 225 pp. [Google Scholar]
Cunningham JL. (1972) A miracle mounting fluid for permanent whole-mounts of microfungi. Mycologia 64: 906–911. 10.2307/3757946 [DOI] [Google Scholar]
Demers JE, Liu M, Hambleton S, Castlebury LA. (2017) Rust fungi on Panicum. Mycologia 109: 1–17. 10.1080/00275514.2016.1262656 [DOI] [PubMed] [Google Scholar]
Elefsen SE, Frey P, Sverrisson H, Hallsson JH. (2014) Microsatellite analysis of Icelandic populations of the poplar fungal pathogen Melampsoralarici-populina shows evidence of repeated colonization events. European Journal of Plant Pathology 139: 597–608. 10.1007/s10658-014-0416-7 [DOI] [Google Scholar]
Faull JH. (1932) Taxonomy and geographical distribution of the genus Milesia. Contributions from the Arnold Arboretum of Harvard University 2: 1–138. 10.5962/bhl.title.152906 [DOI] [Google Scholar]
Feau N, Vialle A, Allaire M, Maier W, Hamelin RC. (2011) DNA barcoding in the rust genus Chrysomyxa and its implications for the phylogeny of the genus. Mycologia 103: 1250–1266. 10.3852/10-426 [DOI] [PubMed] [Google Scholar]
Gäumann E. (1959) Die Rostpilze Mitteleuropas. Beiträge zur Kryptogamenflora der Schweiz 12. Büchler & Co, Bern, 1407 pp. [Google Scholar]
Gardes M, Bruns TD. (1993) ITS primers with enhanced specificity for basidiomycetes - application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113–118. 10.1111/j.1365-294X.1993.tb00005.x [DOI] [PubMed] [Google Scholar]
Geiger MF, Astrin JJ, Borsch T, Burkhardt U, Grobe P, Hand R, Hausmann A, Hohberg K, Krogmann L, Lutz M, Monje C, Misof B, Moriniere J, Mueller K, Pietsch S, Quandt D, Rulik B, Scholler M, Traunspurger W, Haszprunar G, Waegele W. (2016) How to tackle the molecular species inventory for an industrialized nation-lessons from the first phase of the German Barcode of Life initiative GBOL (2012–2015). Genome 59: 661–670. 10.1139/gen-2015-0185 [DOI] [PubMed] [Google Scholar]
Ginovés JRA, León Arencibia MC, Navarro MLR, del Arco Aguilar M, Gallo AG, Pérez de Paz PL, Delgado OR, Osorio VEM, Wildpret de la Torre W. (2009) Pteridophyta, Spermatophyta. In: Arechavaleta M, Rodríguez S, Zurita N, García A. (Eds) Lista de especies silvestres de Canarias.Hongos, plantas y animales terrestres – 2009. Gobierno de Canarias, 119–172.
Hall TA. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. [Google Scholar]
Hietala AM, Solheim H, Fossdal CG. (2008) Real-time PCR-based monitoring of DNA pools in the tri-trophic interaction between Norway spruce, the rust Thekopsoraareolata, and an opportunistic ascomycetous Phomopsis sp. Phytopathology 98: 51–58. 10.1094/phyto-98-1-0051 [DOI] [PubMed] [Google Scholar]
Hohenester A, Welss W. (1993) Exkursionsflora für die Kanarischen Inseln. Mit Ausblicken auf ganz Makaronesien. Eugen Ulmer, Stuttgart, 374 pp. [Google Scholar]
Holmgren PK, Holmgren NH, Barnett C. (1990) Index Herbariorum. Part 1, The Herbaria of the World (8^th edn). New York Botanical Garden, New York, 693 pp. [Google Scholar]
Hunter LM. (1935) A preliminary note on life history studies of European species of Milesia. Journal of the Arnold Arboretum 16: 143–143. [Google Scholar]
Hunter LM. (1936) The life histories of Milesiascolopendrii, M.polypodii, M.vogesiaca and M.kriegeriana. Journal of the Arnold Arboretum 17: 26–37. [Google Scholar]
Kamei S. (1940) Studies on the cultural experiments of the fern rusts of Abies in Japan. II. Journal of the Faculty of Agriculture, Hokkaido Imperial University 47: 93–191. [Google Scholar]
Kenaley SC, Quan M, Aime MC, Bergstrom GC. (2018) New insight into the species diversity and life cycles of rust fungi (Pucciniales) affecting bioenergy switchgrass (Panicumvirgatum) in the Eastern and Central United States. Mycological Progress 17: 1251–1267. 10.1007/s11557-018-1434-1 [DOI] [Google Scholar]
Kirk PM, Cannon PF, David JC, Stalper JA. (2001) Dictionary of the Fungi (9^th edn). CABI Bioscience, Wallingford, 655 pp. [Google Scholar]
Klebahn H. (1916) Kulturversuche mit Rostpilzen XVI. Zeitschrift für Pflanzenkrankheiten 26: 257–277. [Google Scholar]
Klenke F, Scholler M. (2015) Pflanzenparasitische Kleinpilze. Springer, Berlin, Heidelberg, 1172 pp 10.1007/978-3-662-46162-4 [DOI] [Google Scholar]
Kuprevič VF, Tranzschel VA. (1957) Sem. Melampsorovye (4) Flora sporovych rastenij SSSR Akademija Nauk. SSSR, Moscow, 419 pp. [Google Scholar]
Li C-X, Lu S-G, Ma J-Y, Gai Y-H, Yang Q. (2016) Phylogeographic history of the woodwardioid ferns, including species from the Himalayas. Palaeoworld 25: 318–324. 10.1016/j.palwor.2014.10.004 [DOI] [Google Scholar]
Liu TS. (1971) A Monograph of the Genus Abies. Department of Forestry, National Taiwan University, Taipeh, 608 pp. [Google Scholar]
Maier W, Begerow D, Weiss M, Oberwinkler F. (2003) Phylogeny of the rust fungi: an approach using nuclear large subunit ribosomal DNA sequences. Canadian Journal of Botany-Revue Canadienne De Botanique 81: 12–23. 10.1139/b02-113 [DOI] [Google Scholar]
Maier W, Wingfield BD, Mennicken M, Wingfield MJ. (2007) Polyphyly and two emerging lineages in the rust genera Puccinia and Uromyces. Mycological Research 111: 176–185. 10.1016/j.mycres.2006.11.005 [DOI] [PubMed] [Google Scholar]
Maier W, McTaggart AR, Roux J, Wingfield MJ. (2016) Phakopsoramyrtacearum sp. nov., a newly described rust (Pucciniales) on eucalypts in eastern and southern Africa. Plant Pathology 65: 189–195. 10.1111/ppa.12406 [DOI] [Google Scholar]
McTaggart AR, Aime MC. (2018) The species of Coleosporium (Pucciniales) on Solidago in North America. Fungal Biology 122: 800–809. 10.1016/j.funbio.2018.04.007 [DOI] [PubMed] [Google Scholar]
Majewski T. (1977) Flora Polska. Grzyby (Mycota): 9 Basidiomycetes, Uredinales I. Warszawa, Kraków, 396 pp. [Google Scholar]
Mayor E. (1944) Mélanges mycologiques. Bulletin de la Société Botanique Suisse 54: 5–18. [Google Scholar]
Moss EH. (1926) The Uredo Stage of the Pucciniastraceae. Annals of Botany os- 40: 813–847. 10.1093/oxfordjournals.aob.a090052 [DOI] [Google Scholar]
Mulvey RL, Hansen EM. (2011) Castilleja and Pedicularis confirmed as telial hosts for Cronartiumribicola in whitebark pine ecosystems of Oregon and Washington. Forest Pathology 41: 453–463. 10.1111/j.1439-0329.2010.00702.x [DOI] [Google Scholar]
O´Donnell K. (1993) Fusarium and its near relatives. In: Reynold DR, Taylor JW. (Eds) The Fungal Holomorph: Mitotic, Meiotic and Pleomorphic Speciation in Fungal Systematics.CAB International, Washington, 225–233.
Pfunder M, Schurch S, Roy BA. (2001) Sequence variation and geographic distribution of pseudoflower-forming rust fungi (Uromycespisi s. lat.) on Euphorbiacyparissias. Mycological Research 105: 57–66. 10.1017/s0953756200003208 [DOI] [Google Scholar]
R Core Team (2017) R: A Language and Environment for Statistical Computing. https://www.R-project.org/
Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Hohna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed] [Google Scholar]
Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W. (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences of the United States of America 109: 6241–6246. 10.1073/pnas.1117018109 [DOI] [PMC free article] [PubMed] [Google Scholar]
Scholler M, Abbasi M, Friedrich F. (2014) Tranzschelia in the Americas revisited: two new species and notes on the Tranzscheliathalictri complex. Mycologia 106: 448–455. 10.3852/12-260 [DOI] [PubMed] [Google Scholar]
Sinclair WA, Lyon HH. (2005) Diseases of Trees and Shrubs (2^nd edn). Cornell University Press, Ithaca, 680 pp. [Google Scholar]
Stamatakis A, Hoover P, Rougemont J. (2008) A rapid bootstrap algorithm for the RAxML web servers. Systematic Biology 57: 758–771. 10.1080/10635150802429642 [DOI] [PubMed] [Google Scholar]
Stöver BC, Müller KF. (2010) Treegraph 2: Combining and visualizing evidence from different phylogenetic analyses. BMC Bioinformatics 11: 7. 10.1186/1471-2105-11-7 [DOI] [PMC free article] [PubMed]
Vialle A, Feau N, Allaire M, Didukh M, Martin F, Moncalvo JM, Hamelin RC. (2009) Evaluation of mitochondrial genes as DNA barcode for Basidiomycota. Molecular Ecology Resources 9: 99–113. 10.1111/j.1755-0998.2009.02637.x [DOI] [PubMed] [Google Scholar]
Vialle A, Feau N, Frey P, Bernier L, Hamelin RC. (2013) Phylogenetic species recognition reveals host-specific lineages among poplar rust fungi. Molecular Phylogenetics and Evolution 66: 628–644. 10.1016/j.ympev.2012.10.021 [DOI] [PubMed] [Google Scholar]
Vilgalys R, Hester M. (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238–4246. 10.1128/jb.172.8.4238-4246.1990 [DOI] [PMC free article] [PubMed] [Google Scholar]
Vogler DR, Maloney PE, Burt T, Snelling J. (2017) First Report of the White Pine Blister Rust Fungus, Cronartiumribicola, infecting Pinusflexilis on Pine Mountain, Humboldt National Forest, Elko County, Northeastern Nevada. Plant Disease 101: 839. 10.1094/PDIS-10-16-1502-PDN [DOI]
Wróblewski A. (1913) Przyczynek do znajomosci grzybów Pokucia. Czesc I. [Contribution à la connaissance des champignons de Pokucie. Premiére partie]. Sprawozdanie Komisji Fizjograficznej Akademia Umijętności Krakowie 47: 147–178. [Google Scholar]
Yun HY, Minnis AM, Kim YH, Castlebury LA, Aime MC. (2011) The rust genus Frommeella revisited: a later synonym of Phragmidium after all. Mycologia 103: 1451–1463. 10.3852/11-120 [DOI] [PubMed] [Google Scholar]
Zhao P, Kakishima M, Wang Q, Cai L. (2017) Resolving the Melampsoraepitea complex. Mycologia 109: 391–407. 10.1080/00275514.2017.1326791 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

XML Treatment for Milesina blechni

mycokeys.48.30350-treatment1.xml^{(18.5KB, xml)}

XML Treatment for Milesina carpatica

mycokeys.48.30350-treatment2.xml^{(15.1KB, xml)}

XML Treatment for Milesina exigua

mycokeys.48.30350-treatment3.xml^{(18.2KB, xml)}

XML Treatment for Milesina feurichii

mycokeys.48.30350-treatment4.xml^{(14.4KB, xml)}

XML Treatment for Milesina kriegeriana

mycokeys.48.30350-treatment5.xml^{(19.9KB, xml)}

XML Treatment for Milesina magnusiana

mycokeys.48.30350-treatment6.xml^{(13.9KB, xml)}

XML Treatment for Milesina murariae

mycokeys.48.30350-treatment7.xml^{(17.7KB, xml)}

XML Treatment for Milesina polypodii

mycokeys.48.30350-treatment8.xml^{(19.6KB, xml)}

XML Treatment for Milesina scolopendrii

mycokeys.48.30350-treatment9.xml^{(15.6KB, xml)}

XML Treatment for Milesina vogesiaca

mycokeys.48.30350-treatment10.xml^{(17.1KB, xml)}

XML Treatment for Milesina whitei

mycokeys.48.30350-treatment11.xml^{(17.9KB, xml)}

XML Treatment for Milesina woodwardiana

mycokeys.48.30350-treatment12.xml^{(16.9KB, xml)}

XML Treatment for Milesina

mycokeys.48.30350-treatment13.xml^{(18.6KB, xml)}

XML Treatment for Milesina sect. Milesina

mycokeys.48.30350-treatment14.xml^{(3.5KB, xml)}

XML Treatment for Milesina sect. Vogesiacae

mycokeys.48.30350-treatment15.xml^{(3.9KB, xml)}

XML Treatment for Milesina sect. Scolopendriorum

mycokeys.48.30350-treatment16.xml^{(4.5KB, xml)}

XML Treatment for Milesina sect. Carpaticae

mycokeys.48.30350-treatment17.xml^{(4KB, xml)}

Supplementary material 1

Ben Bubner, Ramona Buchheit, Frank Friedrich, Volker Kummer, Markus Scholler

Milesina ITS

Data type: multimedia

Explanation note: Fig. S1.

mycokeys-48-001-s003.nex^{(70.5KB, nex)}

Supplementary material 2

Ben Bubner, Ramona Buchheit, Frank Friedrich, Volker Kummer, Markus Scholler

Milesina Nad6

Data type: multimedia

Explanation note: Fig. S2.

mycokeys-48-001-s003.nex^{(70.5KB, nex)}

Supplementary material 3

Ben Bubner, Ramona Buchheit, Frank Friedrich, Volker Kummer, Markus Scholler

Milesina 28S

Data type: multimedia

Explanation note: Fig. S2.

mycokeys-48-001-s003.nex^{(70.5KB, nex)}

[B1] Abbasi M, Goodwin SB, Scholler M. (2005) Taxonomy, phylogeny, and distribution of Pucciniagraminis, the black stem rust: new insights based on rDNA sequence data. Mycoscience 46: 241–247. 10.1007/s10267-005-0244-x [DOI] [Google Scholar]

[B2] Aime MC. (2006) Towards resolving family-level relationships in rust fungi (Uredinales). Mycoscience 47: 112–122. 10.1007/s10267-006-0281-0 [DOI] [Google Scholar]

[B3] Aime MC, Matheny PB, Henk DA, Frieders EM, Nilsson RH, Piepenbring M, McLaughlin DJ, Szabo LJ, Begerow D, Sampaio JP, Bauer R, Weiss M, Oberwinkler F, Hibbett D. (2006) An overview of the higher level classification of Pucciniomycotina based on combined analyses of nuclear large and small subunit rDNA sequences. Mycologia 98: 896–905. 10.3852/mycologia.98.6.896 [DOI] [PubMed] [Google Scholar]

[B4] Aime MC, Bell CD, Wilson AW. (2018a) Deconstructing the evolutionary complexity between rust fungi (Pucciniales) and their plant hosts. Studies in Mycology 89: 143–152. 10.1016/j.simyco.2018.02.002 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B5] Aime MC, Castlebury LM, Abbasi M, Begerow D, Berndt R, Kirschner R, Marvanova L, Ono Y, Padarnsee M, Scholler M, Thines M, Rossmann A. (2018b) Competing sexual and asexual generic names in Pucciniomycotina and Ustilaginomycotina (Basidiomycota) and recommendations for use. IMA Fungus 9: 75–90. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B6] Al-Hatmi AMS, Van Den Ende AHGG, Stielow JB, Van Diepeningen AD, Seifert KA, McCormick W, Assabgui R, Graefenhan T, De Hoog GS, Levesque CA. (2016) Evaluation of two novel barcodes for species recognition of opportunistic pathogens in Fusarium. Fungal Biology 120: 231–245. 10.1016/j.funbio.2015.08.006 [DOI] [PubMed] [Google Scholar]

[B7] Ali B, Sohail Y, Toome-Heller M, Mumtaz AS. (2016) Melampsorapakistanica sp. nov., a new rust fungus on Euphorbiahelioscopia (Sun spurge) from Pakistan. Mycological Progress 15: 1285–1292. 10.1007/s11557-016-1244-2 [DOI] [Google Scholar]

[B8] Barres B, Dutech C, Andrieux A, Halkett F, Frey P. (2012) Exploring the role of asexual multiplication in poplar rust epidemics: impact on diversity and genetic structure. Molecular Ecology 21: 4996–5008. 10.1111/mec.12008 [DOI] [PubMed] [Google Scholar]

[B9] Beenken L. (2014) Pucciniales on Annona (Annonaceae) with special focus on the genus Phakopsora. Mycological Progress 13: 791–809. 10.1007/s11557-014-0963-5 [DOI] [Google Scholar]

[B10] Beenken L. (2017) Austropuccinia: a new genus name for the myrtle rust Pucciniapsidii placed within the redefined family Sphaerophragmiaceae (Pucciniales). Phytotaxa 297: 53–61. 10.11646/phytotaxa.297.1.5 [DOI] [Google Scholar]

[B11] Beenken L, Lutz M, Scholler M. (2017) DNA barcoding and phylogenetic analyses of the genus Coleosporium (Pucciniales) reveal that the North American goldenrod rust C.solidaginis is a neomycete on introduced and native Solidago species in Europe. Mycological Progress 16: 1073–1085. 10.1007/s11557-017-1357-2 [DOI] [Google Scholar]

[B12] Beenken L, Zoller S, Berndt R. (2012) Rust fungi on Annonaceae II: the genus Dasyspora Berk. and M.A. Curtis. Mycologia 104: 659–681. 10.3852/11-068 [DOI] [PubMed] [Google Scholar]

[B13] Berndt R. (2008) The rust fungi (Uredinales) on ferns in South Africa. Mycological Progress 7: 7–19. 10.1007/s11557-007-0548-7 [DOI] [Google Scholar]

[B14] Bubner B, Wunder S, Zaspel I, Zander M, Gloger J, Fehrenz S, Ulrichs C. (2014) Melampsora rust species on biomass willows in central and northeastern Germany. Fungal Biology 118: 910–923. [DOI] [PubMed] [Google Scholar]

[B15] Cao J, Tian C-M, Liang Y-M, You C-J. (2017) Two new Chrysomyxa rust species on the endemic plant, Piceaasperata in western China, and expanded description of C.succinea. Phytotaxa 292: 218–230. 10.11646/phytotaxa.292.3.2 [DOI] [Google Scholar]

[B16] Cummins JB. (1971) The rust fungi of cereals, grasses and bamboos. Springer, Berlin, Heidelberg, New York, 570 pp 10.1007/978-3-642-88451-1 [DOI] [Google Scholar]

[B17] Cummins JB, Hiratsuka Y. (2003) Illustrated genera of rust fungi. Third edition. American Phytopathological Society, APS Press, Minnesota, 225 pp. [Google Scholar]

[B18] Cunningham JL. (1972) A miracle mounting fluid for permanent whole-mounts of microfungi. Mycologia 64: 906–911. 10.2307/3757946 [DOI] [Google Scholar]

[B19] Demers JE, Liu M, Hambleton S, Castlebury LA. (2017) Rust fungi on Panicum. Mycologia 109: 1–17. 10.1080/00275514.2016.1262656 [DOI] [PubMed] [Google Scholar]

[B20] Elefsen SE, Frey P, Sverrisson H, Hallsson JH. (2014) Microsatellite analysis of Icelandic populations of the poplar fungal pathogen Melampsoralarici-populina shows evidence of repeated colonization events. European Journal of Plant Pathology 139: 597–608. 10.1007/s10658-014-0416-7 [DOI] [Google Scholar]

[B21] Faull JH. (1932) Taxonomy and geographical distribution of the genus Milesia. Contributions from the Arnold Arboretum of Harvard University 2: 1–138. 10.5962/bhl.title.152906 [DOI] [Google Scholar]

[B22] Feau N, Vialle A, Allaire M, Maier W, Hamelin RC. (2011) DNA barcoding in the rust genus Chrysomyxa and its implications for the phylogeny of the genus. Mycologia 103: 1250–1266. 10.3852/10-426 [DOI] [PubMed] [Google Scholar]

[B23] Gäumann E. (1959) Die Rostpilze Mitteleuropas. Beiträge zur Kryptogamenflora der Schweiz 12. Büchler & Co, Bern, 1407 pp. [Google Scholar]

[B24] Gardes M, Bruns TD. (1993) ITS primers with enhanced specificity for basidiomycetes - application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113–118. 10.1111/j.1365-294X.1993.tb00005.x [DOI] [PubMed] [Google Scholar]

[B25] Geiger MF, Astrin JJ, Borsch T, Burkhardt U, Grobe P, Hand R, Hausmann A, Hohberg K, Krogmann L, Lutz M, Monje C, Misof B, Moriniere J, Mueller K, Pietsch S, Quandt D, Rulik B, Scholler M, Traunspurger W, Haszprunar G, Waegele W. (2016) How to tackle the molecular species inventory for an industrialized nation-lessons from the first phase of the German Barcode of Life initiative GBOL (2012–2015). Genome 59: 661–670. 10.1139/gen-2015-0185 [DOI] [PubMed] [Google Scholar]

[B26] Ginovés JRA, León Arencibia MC, Navarro MLR, del Arco Aguilar M, Gallo AG, Pérez de Paz PL, Delgado OR, Osorio VEM, Wildpret de la Torre W. (2009) Pteridophyta, Spermatophyta. In: Arechavaleta M, Rodríguez S, Zurita N, García A. (Eds) Lista de especies silvestres de Canarias.Hongos, plantas y animales terrestres – 2009. Gobierno de Canarias, 119–172.

[B27] Hall TA. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. [Google Scholar]

[B28] Hietala AM, Solheim H, Fossdal CG. (2008) Real-time PCR-based monitoring of DNA pools in the tri-trophic interaction between Norway spruce, the rust Thekopsoraareolata, and an opportunistic ascomycetous Phomopsis sp. Phytopathology 98: 51–58. 10.1094/phyto-98-1-0051 [DOI] [PubMed] [Google Scholar]

[B29] Hohenester A, Welss W. (1993) Exkursionsflora für die Kanarischen Inseln. Mit Ausblicken auf ganz Makaronesien. Eugen Ulmer, Stuttgart, 374 pp. [Google Scholar]

[B30] Holmgren PK, Holmgren NH, Barnett C. (1990) Index Herbariorum. Part 1, The Herbaria of the World (8^th edn). New York Botanical Garden, New York, 693 pp. [Google Scholar]

[B31] Hunter LM. (1935) A preliminary note on life history studies of European species of Milesia. Journal of the Arnold Arboretum 16: 143–143. [Google Scholar]

[B32] Hunter LM. (1936) The life histories of Milesiascolopendrii, M.polypodii, M.vogesiaca and M.kriegeriana. Journal of the Arnold Arboretum 17: 26–37. [Google Scholar]

[B33] Kamei S. (1940) Studies on the cultural experiments of the fern rusts of Abies in Japan. II. Journal of the Faculty of Agriculture, Hokkaido Imperial University 47: 93–191. [Google Scholar]

[B34] Kenaley SC, Quan M, Aime MC, Bergstrom GC. (2018) New insight into the species diversity and life cycles of rust fungi (Pucciniales) affecting bioenergy switchgrass (Panicumvirgatum) in the Eastern and Central United States. Mycological Progress 17: 1251–1267. 10.1007/s11557-018-1434-1 [DOI] [Google Scholar]

[B35] Kirk PM, Cannon PF, David JC, Stalper JA. (2001) Dictionary of the Fungi (9^th edn). CABI Bioscience, Wallingford, 655 pp. [Google Scholar]

[B36] Klebahn H. (1916) Kulturversuche mit Rostpilzen XVI. Zeitschrift für Pflanzenkrankheiten 26: 257–277. [Google Scholar]

[B37] Klenke F, Scholler M. (2015) Pflanzenparasitische Kleinpilze. Springer, Berlin, Heidelberg, 1172 pp 10.1007/978-3-662-46162-4 [DOI] [Google Scholar]

[B38] Kuprevič VF, Tranzschel VA. (1957) Sem. Melampsorovye (4) Flora sporovych rastenij SSSR Akademija Nauk. SSSR, Moscow, 419 pp. [Google Scholar]

[B39] Li C-X, Lu S-G, Ma J-Y, Gai Y-H, Yang Q. (2016) Phylogeographic history of the woodwardioid ferns, including species from the Himalayas. Palaeoworld 25: 318–324. 10.1016/j.palwor.2014.10.004 [DOI] [Google Scholar]

[B40] Liu TS. (1971) A Monograph of the Genus Abies. Department of Forestry, National Taiwan University, Taipeh, 608 pp. [Google Scholar]

[B41] Maier W, Begerow D, Weiss M, Oberwinkler F. (2003) Phylogeny of the rust fungi: an approach using nuclear large subunit ribosomal DNA sequences. Canadian Journal of Botany-Revue Canadienne De Botanique 81: 12–23. 10.1139/b02-113 [DOI] [Google Scholar]

[B42] Maier W, Wingfield BD, Mennicken M, Wingfield MJ. (2007) Polyphyly and two emerging lineages in the rust genera Puccinia and Uromyces. Mycological Research 111: 176–185. 10.1016/j.mycres.2006.11.005 [DOI] [PubMed] [Google Scholar]

[B43] Maier W, McTaggart AR, Roux J, Wingfield MJ. (2016) Phakopsoramyrtacearum sp. nov., a newly described rust (Pucciniales) on eucalypts in eastern and southern Africa. Plant Pathology 65: 189–195. 10.1111/ppa.12406 [DOI] [Google Scholar]

[B44] McTaggart AR, Aime MC. (2018) The species of Coleosporium (Pucciniales) on Solidago in North America. Fungal Biology 122: 800–809. 10.1016/j.funbio.2018.04.007 [DOI] [PubMed] [Google Scholar]

[B45] Majewski T. (1977) Flora Polska. Grzyby (Mycota): 9 Basidiomycetes, Uredinales I. Warszawa, Kraków, 396 pp. [Google Scholar]

[B46] Mayor E. (1944) Mélanges mycologiques. Bulletin de la Société Botanique Suisse 54: 5–18. [Google Scholar]

[B47] Moss EH. (1926) The Uredo Stage of the Pucciniastraceae. Annals of Botany os- 40: 813–847. 10.1093/oxfordjournals.aob.a090052 [DOI] [Google Scholar]

[B48] Mulvey RL, Hansen EM. (2011) Castilleja and Pedicularis confirmed as telial hosts for Cronartiumribicola in whitebark pine ecosystems of Oregon and Washington. Forest Pathology 41: 453–463. 10.1111/j.1439-0329.2010.00702.x [DOI] [Google Scholar]

[B49] O´Donnell K. (1993) Fusarium and its near relatives. In: Reynold DR, Taylor JW. (Eds) The Fungal Holomorph: Mitotic, Meiotic and Pleomorphic Speciation in Fungal Systematics.CAB International, Washington, 225–233.

[B50] Pfunder M, Schurch S, Roy BA. (2001) Sequence variation and geographic distribution of pseudoflower-forming rust fungi (Uromycespisi s. lat.) on Euphorbiacyparissias. Mycological Research 105: 57–66. 10.1017/s0953756200003208 [DOI] [Google Scholar]

[B51] R Core Team (2017) R: A Language and Environment for Statistical Computing. https://www.R-project.org/

[B52] Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Hohna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B53] Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W. (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences of the United States of America 109: 6241–6246. 10.1073/pnas.1117018109 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B54] Scholler M, Abbasi M, Friedrich F. (2014) Tranzschelia in the Americas revisited: two new species and notes on the Tranzscheliathalictri complex. Mycologia 106: 448–455. 10.3852/12-260 [DOI] [PubMed] [Google Scholar]

[B55] Sinclair WA, Lyon HH. (2005) Diseases of Trees and Shrubs (2^nd edn). Cornell University Press, Ithaca, 680 pp. [Google Scholar]

[B56] Stamatakis A, Hoover P, Rougemont J. (2008) A rapid bootstrap algorithm for the RAxML web servers. Systematic Biology 57: 758–771. 10.1080/10635150802429642 [DOI] [PubMed] [Google Scholar]

[B57] Stöver BC, Müller KF. (2010) Treegraph 2: Combining and visualizing evidence from different phylogenetic analyses. BMC Bioinformatics 11: 7. 10.1186/1471-2105-11-7 [DOI] [PMC free article] [PubMed]

[B58] Vialle A, Feau N, Allaire M, Didukh M, Martin F, Moncalvo JM, Hamelin RC. (2009) Evaluation of mitochondrial genes as DNA barcode for Basidiomycota. Molecular Ecology Resources 9: 99–113. 10.1111/j.1755-0998.2009.02637.x [DOI] [PubMed] [Google Scholar]

[B59] Vialle A, Feau N, Frey P, Bernier L, Hamelin RC. (2013) Phylogenetic species recognition reveals host-specific lineages among poplar rust fungi. Molecular Phylogenetics and Evolution 66: 628–644. 10.1016/j.ympev.2012.10.021 [DOI] [PubMed] [Google Scholar]

[B60] Vilgalys R, Hester M. (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238–4246. 10.1128/jb.172.8.4238-4246.1990 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B61] Vogler DR, Maloney PE, Burt T, Snelling J. (2017) First Report of the White Pine Blister Rust Fungus, Cronartiumribicola, infecting Pinusflexilis on Pine Mountain, Humboldt National Forest, Elko County, Northeastern Nevada. Plant Disease 101: 839. 10.1094/PDIS-10-16-1502-PDN [DOI]

[B62] Wróblewski A. (1913) Przyczynek do znajomosci grzybów Pokucia. Czesc I. [Contribution à la connaissance des champignons de Pokucie. Premiére partie]. Sprawozdanie Komisji Fizjograficznej Akademia Umijętności Krakowie 47: 147–178. [Google Scholar]

[B63] Yun HY, Minnis AM, Kim YH, Castlebury LA, Aime MC. (2011) The rust genus Frommeella revisited: a later synonym of Phragmidium after all. Mycologia 103: 1451–1463. 10.3852/11-120 [DOI] [PubMed] [Google Scholar]

[B64] Zhao P, Kakishima M, Wang Q, Cai L. (2017) Resolving the Melampsoraepitea complex. Mycologia 109: 391–407. 10.1080/00275514.2017.1326791 [DOI] [PubMed] [Google Scholar]

PERMALINK

Species identification of European forest pathogens of the genus Milesina (Pucciniales) using urediniospore morphology and molecular barcoding including M.woodwardiana sp. nov.

Ben Bubner

Ramona Buchheit

Frank Friedrich

Volker Kummer

Markus Scholler

Abstract Abstract

Introduction

Methods

Herbaria

Light microscopy (LM)

Scanning Electron Microscopy (SEM)

Statistical Analysis

DNA extraction, PCR and sequencing

Table 1.

Phylogenetic analysis

Results

Barcoding success for ITS, nad6 and 28S

Table 2.

Table 3.

Phylogenetic analysis of the ITS barcode

Figure 1.

Figure 3.

Figure 4.

Phylogenetic analysis of nad6 and 28S barcodes

Figure 2.

Morphology of urediniospores

Figure 5.

Specimens examined, urediniospore descriptions and taxonomic novelties

Table 4.

Milesina blechni

Figure 6.

Description.

Comment.

Milesina carpatica

Description.

Comment.

Milesina exigua

Description.

Comment.

Milesina feurichii

Description.

Milesina kriegeriana

Description.

Comment.

Milesina magnusiana

Description.

Milesina murariae

Description.

Milesina polypodii

Description.

Milesina scolopendrii

Description.

Milesina vogesiaca

Description.

Comment.

Milesina whitei

Description.

Comment.

Milesina woodwardiana

Figure 7.

Holotype.

Description.

Distribution.

Etymology.

Comment.

Milesina spp.

Comment.

Subgeneric classification

Milesina sect. Milesina

Type species.

Milesina sect. Vogesiacae

Type species.

Milesina sect. Scolopendriorum

Type species.

Milesina sect. Carpaticae

Type species.

Key to European Milesina species

Discussion