Abstract
Background
Taenia multiceps is a harmful tapeworm and its larval form (coenurus cerebralis) is the causative agent of coenurosis, a disease affecting the health of herbivores, resulting in great economic loss to animal husbandry. Heat-shock proteins (HSPs), expressed in all prokaryotes and eukaryotes, act as molecular chaperones and can affect pathogenicity.
Methods
Herein, cDNAs of T. multiceps genes Tm-HSP60 and Tm-p36 were cloned and molecularly characterised by bioinformatics analyses. The immunogenicity and immunoreactivity of recombinant rTm-HSP60 and rTm-p36 proteins were investigated by immunoblotting and indirect ELISA was established to evaluate their serodiagnostic potential. Tissue localisation and transcriptional level at different life stages of T. multiceps were determined by immunohistochemical and quantitative real-time PCR analyses.
Result
The 533 residue rTm-HSP60 and the 314 residue rTm-p36 proteins share typical highly conserved features of HSPs. Tm-p36 shares structural characteristics with metazoan small HSPs, with two N-terminal α-crystallin domains. Compared with Tm-p36, Tm-HSP60 displayed stronger immunogenicity, and the indirect ELISA based on rTm-HSP60 exhibited a sensitivity of 83.3% and a specificity of 87.5%, while rTm-p36 was not suitable to develop indirect ELISA. Tm-HSP60 was widely distributed in all stages of T. multiceps, albeit at relatively low levels, while Tm-p36 was specifically distributed in the protoscolex and oncosphere.
Conclusions
The sequence, structural and functional analyses of these two HSPs indicates that they may play important roles in the life-cycle of T. multiceps as molecular chaperones. Tm-HSP60 displayed stronger immunogenicity compare to Tm-p36, and has the potential for antibody detection. Tm-p36 was strongly associated with the activation of oncospheres and has potential interest for vaccination.
Electronic supplementary material
The online version of this article (10.1186/s13071-019-3352-8) contains supplementary material, which is available to authorized users.
Keywords: Taenia multiceps, Coenurus cerebralis, Metacestode, Heat-shock protein, Immunohistochemistry, Quantitative real-time PCR, Indirect ELISA
Background
Taenia multiceps is a common taeniid cestode and multi-host parasite. Adult worms adhere to the small intestine of canids, while the larval stage (coenurus cerebralis) causes coenurosis, a disease affecting herbivores, resulting in great economic loss to animal husbandry in Europe, the USA, Africa and Asia [1–4]. The larval parasites are localized in the central nervous system, as well as subcutaneous and muscle tissue of the intermediate host, most of which are herbivorous animals [5–7], but humans can also act as intermediate hosts if eggs are eaten by mistake [8].
Taenia multiceps has a complex life-cycle that involves different phases of development and migration within the host [9, 10]. To overcome possible obstacles, parasites have developed tolerance mechanisms to assist survival and proliferation. One mechanism counteracts stress via the expression of heat-shock proteins (HSPs) that act as important molecular chaperones [11]. HSPs ensure the correct folding, processing and functionality of their protein substrates. In addition to facilitating cytoprotection against stress, HSPs also participate in the differentiation and development of parasites, and may even serve as diagnostic or vaccine candidates [12].
HSPs in some cestodes have been characterised, such as HSP60 and HSP70 that are immunodominant antigens in Echinococcus granulosus and T. multiceps [13, 14], and p36, a unique type of small HSP (sHSP) in metazoans such as Taenia saginata, Taenia solium and E. granulosus [15–18]. However, previous research on HSPs in cestodes is limited to exploring immunogenicity, and the relevance to biological functions throughout other life-cycle stages is unknown.
Herein, we investigated HSP60 and p36 from T. multiceps, identified previously from transcriptomic analyses [19, 20]. We expressed the recombinant proteins using a prokaryotic system, and performed bioinformatics analyses, tissue localisation studies, and analysed their transcriptional level by quantitative real-time PCR (qPCR) to probe their possible biological functions. This is a preliminary exploration of the roles of these two proteins in T. multiceps, and the findings lay the foundation for further understanding of their functions.
Methods
Parasites and animals
Cysts of T. multiceps were obtained from naturally infected goats in Sichuan Province, China. Adult worms were obtained from intestine samples from four 2-month-old dogs at 30 days after infection with 20,000 protoscolices. Mature eggs were obtained from fresh gravid proglottids, and oncospheres were released from the proglottids using trypsin and used for RNA extraction. Nine-week-old female New Zealand white rabbits were obtained from Dashuo Experimental Animal Co., Ltd (Chendu, China).
Primers
The cDNA sequences of Tm-HSP60 and Tm-p36 were amplified using primers designed from Unigene 5021 and 18510 of the assembled T. multiceps transcriptome dataset, which is homologous to the genome sequences of Echinococcus multilocularis (GenBank: CDS35950.1) and T. saginata (GenBank: Q7YZT0.1). All primers (Table 1) were synthesised by Sangon (Shanghai, China).
Table 1.
Primers used for amplification and qPCR. All primers used for amplification included BamHI or EcoRI restriction enzyme sites (underlined)
| Primer | Sequence (5′–3′) |
|---|---|
| Tm-HSP60Fa | CGGGATCCATGCTTGTTGGTGTCGAT |
| Tm-HSP60Ra | CGGAATTCTCACATCATACCGCCC |
| Tm-p36Fa | CGGGATCCATGTCCATCTTTCCG |
| Tm-p36Ra | CGGAATTCTCATTTAAAGAGAGGCG |
| Tm-HSP60Fb | TGCGTGATATGGCTATTGCGTCTG |
| Tm-HSP60Rb | GAGCGTGTCGTCCTTGGTGATG |
| Tm-p36Fb | CGAGAGTGTGATGAAGGAGATGAGTG |
| Tm-p36Rb | ACTTGTTCTTGTCCGCCTTGATGG |
| actinF | CTAAGGCGAACCGTGAGAAGATGAC |
| actinR | GGCATGAGGCAAGGCGTAACC |
aFor amplification
bFor qPCR
Bioinformatics analyses
Bioinformatics analyses were performed using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) to predict open reading frames (ORFs), the TMHMM Sever 2.0 (http://www.cbs.dtu.dk/services/TMHMM-2.0) to identify transmembrane regions, and half-life and instability indices were predicted with the ExPASy Proteomics Server (http://web.Expasy.org/protparam/). Signal peptides were predicted using the SignalP server (http://www.cbs.dtu.dk/Services/SignalP/), subcellular localisation and B-cell epitopes were predicted by BaCelLo (http://gpcr.biocomp.unibo.it/bacello/pred.htm) and Antibody Epitope Prediction (http://tools.immuneepitope.org/bcell/), and protein tertiary structures were predicted using SWISS-MODEL (http://swissmodel.expasy.org/). Multiple sequence alignment was performed with Clustal X software version 1.83.
Cloning, expression and purification of recombinant proteins
TRIzol reagent (Tiangen, Beijing, China) was used to extract total RNA from adult worms, protoscolices and oncospheres. cDNA was reverse-transcribed using a RevertAid First Strand cDNA Synthesis Kit following the manufacturer’s instructions (Thermo Fisher Scientific, Vilnius, Lithuania). Target fragments were amplified, ligated into the pET32a(+) vector (TaKaRa, Dalian, China) and transformed into BL21 (DE3) competent cells. Expression of the recombinant proteins was induced by 1 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) and purification was achieved using Ni2+ affinity chromatography (Bio-Rad, Hercules, CA, USA).
Sera
Corresponding sera of T. multiceps (24 samples), Taenia hydatigena (12 samples), Fasciola hepatica (12 samples) and Haemonchus contortus (12 samples) were isolated from naturally infected goats in Sichuan Province and sera of E. granulosus (12 samples), Moniezia expansa (12 samples) were isolated from naturally infected sheep. Serum samples from cestode-free goats at autopsy were used as negative control.
Four rabbits were used to prepare polyclonal antibodies of Tm-HSP60 and Tm-p36, and rabbit serum samples were obtained before immunisation as a negative control. The first immunisation was a subcutaneous injection with 100 μg recombinant protein mixed with same volume of Freund’s complete adjuvant (Sigma-Aldrich, St Louis, MO, USA). The second and third immunisations were injections with 100 μg recombinant protein mixed with same volume of Freund’s incomplete adjuvant. The immunisation interval was 1 week. Two weeks after the final immunisation, serum samples were collected and the serum titre was determined by enzyme-linked immunosorbent assay (ELISA). Immunoglobulin G (IgG) was further isolated from the serum using a Protein G-Sepharose column (Bio-Rad, Richmond, USA).
Western blotting analysis
A Mammalian Protein Extraction Kit (Solarbio, Beijing, China) was used to extract crude proteins from adult worms. Proteins were separated by 12% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a nitrocellulose membrane using an electrophoretic transfer cell (Bio-Rad, Hercules) for 30 min. After washing with TRIS-buffered saline containing Tween-20 (TBST), membranes were incubated with 5% (w/v) skimmed milk at 37 °C for 2 h and incubated at 4 °C with polyclonal antibodies (1:200 v/v dilution) or serum from infected goats (1:200 v/v dilution) for 12 h, then with a 1:1,000 dilution of horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG or rabbit anti-goat IgG (Boster, Wuhan, China) for 2 h. Signals were measured using an Enhanced HRP-DAB Chromogenic Substrate Kit (Tiangen).
Immunolocalisation of Tm-HSP60 and Tm-p36 at different life stages of T. multiceps
Samples (adult worms and protoscolices) were washed with phosphate-buffered saline (PBS), fixed in 4% (w/v) paraformaldehyde, embedded, and sliced into 5 μm thick sections. After dewaxing and dehydration, sections were treated with 0.01 M citrate buffer and incubated at 37 °C with 5% (w/v) skimmed milk for 4 h, then incubated with polyclonal antibodies or negative control rabbit serum (1:200 v/v) overnight at 4 °C. After washing, sections were incubated at 37 °C with fluorescein isothiocyanate-conjugated goat anti-rabbit IgG (1:200 v/v) for 1 h in the dark and signals were monitored using a fluorescence microscope (Nikon, Tokyo, Japan).
Transcriptional profiles of Tm-HSP60 and Tm-p36 at different life stages of T. multiceps
For qPCR, 20 μl reactions were performed following the manual accompanying SsoAdvanced Universal SYBR Green (Bio-Rad, Hercules) with 2 μl of cDNA obtained from different proglottid and life-cycle stages (adult worms, protoscolices and oncospheres) as templates. The program involved an initial denaturation at 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s, 56 °C for 31 s and 95 °C for 15 s, and a final extension step at 65 °C for 1 min and 95 °C for 15 s. Transcriptional levels of Tm-HSP60 and Tm-p36 were estimated by the 2−∆∆Ct method and a housekeeping gene actin was used as an internal control for normalization (Table 1).
ELISA
To evaluate the serodiagnostic potential of recombinant proteins, an indirect ELISA was performed following the standard checkerboard titration procedures [21]. Briefly, proteins were diluted into six concentration gradients (ranging from 75 to 2 μg/ml) in 0.1 M carbonate buffer (pH 9.6) and coated with 100 μl per well in polystyrene 96-well microtiter plates. After incubation at 4 °C for 12 h, plates were washed three times using phosphate-buffered saline-Tween-20 (PBST) then blocked with 5 % (w/v) skim milk at 37 °C for 1.5 h. After washing three times, plates were incubated with 100 μl serum samples diluted in PBS (concentration ranging from 1:20 to 1:640) at 37 °C for 1 h. Following washing, 100 μl of HRP-labeled rabbit anti-goat or sheep IgG (Boster) diluted 1:2000 by PBS were added and incubated at 37 °C for 1 h. The substrate TMB (Tiangen) was used to react and stopped with 2 M H2SO4. The optical density at 450 nm (OD450) was recorded using a microplate reader (Thermo Scientific, Pittsburgh, PA, USA). We chose the optimal working conditions which gave the highest P/N value, and the cut-off value was determined by 24 negative goat serum samples, which was calculated as the mean OD450 plus three standard deviations (SD).
To further investigate the feasibility of the indirect ELISA, 24 serum samples from goats infected with T. multiceps were evaluated and the sensitivity was calculated as ELISA positive × 100/true T. multiceps-positive. Meanwhile, a total of 60 serum samples (12 samples for each parasite) derived from sheep infected with E. granulosus and M. expansa, and goats infected with T. hydatigena, F. hepatica and H. contortus were used to evaluate the cross-reactivity. Furthermore, an additional 24 negative serum samples were evaluated to determine the specificity of the indirect ELISA: ELISA negative × 100/true T. multiceps-negative.
Statistical analyses
All data are presented as the mean ± SD. Statistical analyses were performed using Student’s t-tests for comparison between life stages, and Mann-Whitney U-tests for different serum groups. All statistical tests were performed using SPSS version 20.0 (SPSS Inc., Chicago, IL, USA). P-values < 0.05 were considered to be significant.
Results
Bioinformatics analyses
The 1602 nucleotide ORF in the cDNA sequence of Tm-HSP60 (GenBank: MH595536) encodes a 533 amino acid (aa) polypeptide, while the 945 nucleotide ORF in the cDNA sequence of Tm-p36 (GenBank: MH595535) encodes a 314 residue protein. No signal peptide was predicted for either protein, and neither appears to possess transmembrane regions. The predicted subcellular localisation of Tm-HSP60 is mitochondria, compared with nuclei for Tm-p36.
Tm-HSP60 is highly conserved, sharing 99.44, 96.62 and 80% sequence identity with orthologs in T. solium (geneDB ID: TsM_000546800), E. granulosus (GenBank: CDS 22737.1) and Schistosoma mansoni (GenBank: XP 018645622.1; Fig. 1a). Tm-HSP60 shares the structural and functional characteristics of the molecular chaperone superfamily and is similar to HSP60 in other organisms. The structure includes typical ATP/Mg2+ binding sites, protein hinge regions, and oligomerisation shared with homologous chaperone proteins (Fig. 1b).
Fig. 1.
Multiple sequence alignment of Tm-HSP60 and three-dimensional structural model of Tm-HSP60. a Multiple sequence alignment of the deduced amino acid sequence of Tm-HSP60 with homologous sequences of related proteins from other parasites: Taenia solium (geneDB ID: TsM_000546800), Echinococcus granulosus (GenBank: CDS 22737.1), Schistosoma mansoni (GenBank: XP 018645622.1) and Capra hircus (GenBank: XP 017916760.1). Conserved residues are highlighted by a black background. B-cell epitopes are marked with a blue box. ATP/Mg2+ binding site of Tm-HSP60 are marked with red boxes. b Three-dimensional structural model of Tm-HSP60 and details of the ATP/Mg2+ binding site. The structure of Tm-HSP60 was modelled based on the crystal structure of Chlorobium tepidum HSP60 (Ct-HSP60, SMTL ID 5da8)
The Tm-p36 sequence is most similar to orthologs in T. saginata (GenBank: CAD80255.1), T. solium (GenBank: CAD36617.1), E. granulosus (GenBank: EUB62057.1) and S. mansoni (GenBank: XP 018649073.1), sharing 97.45, 96.18, 86.94 and 27.09% sequence identity, respectively (Fig. 2a). The tertiary structure of Tm-p36 was predicted to include two N-terminal α-crystallin domains composed of 12 β-sheets (Fig. 2b).
Fig. 2.
Multiple sequence alignment of Tm-p36 and three-dimensional structural model of Tm-p36. a Multiple sequence alignment of the deduced amino acid sequence of Tm-p36 with homologous sequences of related proteins from other parasites: Taenia saginata (GenBank: CAD80255.1), T. solium (GenBank: CAD36617.1), E. granulosus (GenBank: EUB62057.1) and S. mansoni (GenBank: XP 018649073.1). Conserved regions are highlighted by a black background. B-cell epitopes are marked with a blue box. Functional sites of Tm-p36 are marked with red boxes. β-sheets are marked with arrows. b Three-dimensional structural model of Tm-p36 and details of the N-terminal α-crystallin domain. The blue arrow indicates the C-terminus. The model of Tm-p36 was based on the crystal structure of T. solium p36 (Ts-p36, SMTL ID 2bol)
Cloning, expression and purification of rTm-HSP60 and rTm-p36
Tm-HSP60 and Tm-p36 genes were amplified from adult worms, expressed in a prokaryotic expression system, and the resulting fusion proteins yielded single bands of ~76 kDa and ~54 kDa (including the ~18 kDa epitope tag fusion peptide from pET-32a) following separation by 12% SDS-PAGE (Fig. 3).
Fig. 3.

SDS-PAGE and western blot analysis of Tm-HSP60 (a) and Tm-p36 (b). Lane M: protein molecular weight markers; Lane A: crude extracts of Escherichia coli expressing pET32a(+) induced by IPTG; Lane B: crude extracts of E. coli expressing pET32a(+)-Tm-HSP60/Tm-p36 induced by IPTG; Lane C: purified recombinant proteins (10 µg); Lane D: western blot of recombinant proteins (10 µg) incubated with polyclonal antibodies; Lane E: western blot of total T. multiceps adult worm extract (30 µg) probed with polyclonal antibodies (arrow indicates the location of specific band); Lane F: western blot of purified recombinant proteins (10 µg) incubated with coenurus cerebralis-infected goat serum (arrow indicates the location of specific band); Lane G: negative control goat serum
Western blotting
The rTm-HSP60 protein was reacted with polyclonal antibodies against rTm-HSP60 and subjected to reaction with sera from goats infected with coenurus cerebralis; the results indicated it has some immunogenicity. The rTm-p36 protein was recognised by polyclonal antibodies against rTm-p36, but reaction with sera from infected goats was weak (see Additional file 1: Figure S1), and none in the negative controls. The native Tm-HSP60 and Tm-p36 proteins in adult worms were identified using polyclonal antibodies, yielding single bands of ~60 kDa and ~36 kDa (Fig. 3).
Immunolocalisation of Tm-HSP60 and Tm-p36 at different life stages of T. multiceps
Localisation of Tm-HSP60 and Tm-p36 in different stages of proglottid development was performed by immunofluorescence analysis using rabbit antibodies. A small amount of Tm-Hsp60 was found to be present in all stages of development of adult T. multiceps, mainly in the parenchymatous zone of the scolex, immature and mature proglottids, and also on the small hooks of the protoscolex, but there was no signal in gravid proglottids. Tm-p36 was found to be mainly distributed in the parenchyma and tegument of proglottids, with a small amount in the eggs of gravid proglottids, but much larger amounts in the body cavity of the protoscolex (Fig. 4).
Fig. 4.

Immunohistochemical localisation of Tm-HSP60 and Tm-p36 in different proglottid tissues and different life stages of T. multiceps. Images of scolex, protoscolex, immature of Tm-HSP60 and gravid proglottid of Tm-p36; images of control in mature proglottids are magnified at ×400, and other images are magnified at ×200. Tissues and organs are marked with arrows. Scale-bars: 200 μm. Abbreviations: SD, sucking disc; PZ, parenchymatous zone; E, egg; TZ, tegument zone; BC, body cavity
Transcriptional profiles of Tm-HSP60 and Tm-p36 at different stages of proglottid development and life stages of T. multiceps
Transcriptional levels of Tm-HSP60 in different proglottid tissues were ordered immature proglottid > scolex > mature proglottid > gravid proglottid. Transcriptional profiles of Tm-HSP60 at different life stages were ordered oncosphere > protoscolex (Fig. 5a). By comparison, the levels of Tm-p36 in different proglottid tissues were ordered scolex > gravid proglottid > mature proglottid > immature proglottid, and at different life stages the order was oncosphere > protoscolex. Interestingly, the relative transcriptional level of Tm-p36 in oncosphere was consistently higher than in other life stages (Fig. 5b).
Fig. 5.
Relative expression patterns of Tm-HSP60 (a) and Tm-p36 (b). Data are presented as the mean and standard deviation (SD) of triplicate experiments. Statistically significant differences between scolex (controls) and other samples were determined using Student’s t-tests (*P < 0.05, **P < 0.01)
Serodiagnostic potential of rTm-HSP60
The rTm-HSP60 has definite potential for serological diagnosis through the established indirect ELISA. From standard checkerboard titration procedures, the optimum coating concentration of rTm-HSP60 was found to be 0.2 μg/well and the optimum dilution ratio of serum was 1:160, with the highest P/N value of 2.255 (see Additional file 2: Table S1). Under optimal conditions, the average OD450 value of 24 negative serum samples was 0.211 with a SD of 0.035. Thus, the cut-off value was determined to be 0.316. However, as the highest P/N value of rTm-p36 was only 1.5 (see Additional file 3: Table S2), we stopped the further exploration of the serodiagnostic potential of Tm-p36.
The sensitivity of indirect ELISA identified by positive serum samples was 83.3% (20/24), and the specificity by negative serum samples was 87.5% (21/24). No cross-reaction between rTm-HSP60 and antibodies of T. hydatigena (n = 12), F. hepatica (n = 12) and H. contortus (n = 12) was obvious, but cross-reactivity was observed with five serum samples of E. granulosus (n = 12) and five of M. expansa (n = 12) (Fig. 6).
Fig. 6.

Sensitivity, specificity and cross-reactivity of indirect ELISA based on rTm-HSP60. The bold horizontal line represents the cut-off value (0.316). Statistically significant differences were observed between T. multiceps-positive sera and the other serum samples, including E. granulosus, M. expansa, T. hydatigena, F. hepatica, H. contortus-positive and T. multiceps-negative serum samples (Mann-Whitney U-test, Z = -5.261, P < 0.001). No difference was noted between the T. multiceps-negative and other parasites-positive serum samples (Mann-Whitney U-test, Z = 0.699, P = 0.484)
Discussion
HSPs are a family of proteins expressed in all prokaryotes and eukaryotes during growth and development, and expression is stimulated by various physical, chemical and pathological factors. These non-secretory proteins are among the most highly conserved among development-related proteins and are also the most important molecular chaperones [22]. The main biological function of HSPs is to facilitate the folding, translocation, renaturation and degradation of their protein substrates in order to protect cells from harmful factors, both internally and externally in all organisms, ranging from mammals to microbes, consistent with their important roles in all species [23].
Traditionally, HSPs can be divided into eight groups according to their molecular weight, including sHSPs that have a molecular weight ranging between 12–43 kDa [24]. Like other HSPs, sHSPs are involved in many cellular processes, and most are characterised by a conserved C-terminal α-crystallin domain of 80–100 residues [25]. They usually form large homo- or heteromeric complexes to achieve chaperone-like and other activities [26].
In parasites, HSPs play an extremely important role in life processes, many of which pass through multiple life-cycle stages, during which parasites must face a variety of environmental challenges such as severe hypoxia, high redox conditions, and temperature changes [27]. Adult worms of T. multiceps adhere to the small intestine of their hosts, while metacestodes are present in the central nervous system and subcutaneous or muscular tissues of the intermediate hosts and oncospheres invade intermediate hosts through the intestine; all these processes occur in harsh conditions [28, 29]. In response to these harsh living conditions, parasite HSPs may play an important role. In addition to their molecular chaperone activities, HSPs are also involved in the growth and development of parasites and can be recognised by the host immune system as an important antigen during invasion [30–33].
Tm-HSP60 shares high homology with the GroEL molecular chaperone in Escherichia coli. The ATP/Mg2+ binding site is highly similar to that in HSPs in mammals and bacteria, and these sites are known to be important for molecular chaperone activity [34, 35]. The expression of Tm-HSP60 at all life stages indicates that Tm-HSP60 possibly plays an important role throughout the growth and development of T. multiceps. However, subtle differences were apparent, since Tm-HSP60 was mainly distributed in immature stages (scolex, immature proglottid and oncosphere). It may be involved in the processing of target proteins to protect the body at all stages of growth in response to environmental changes. In a previous study, Tm-HSP70 was used as an important diagnostic antigen in goats with coenurosis [14]. Similarly, Tm-HSP60 also displayed immunogenicity in the present work. Corresponding antibodies were detected from the serum of infected goats, indicated that this protein was recognised by the host as an important antigen during invasion. Therefore, we established an indirect ELISA to assess the serological diagnostic potential of rTm-HSP60. A definite sensitivity (83.3%) and specificity (87.5%) was observed. There was no cross-reaction with other species except for cestodes which is most likely due to high affinity. Non-homologous short fragments containing more antigenic epitopes may improve this situation. Feasible results suggested that Tm-HSP60 can be used as a diagnostic tool for coenurosis in the future.
Like metazoan α-crystallin-type sHSPs, Tm-p36 has two N-terminal α-crystallin domains, which is essential for sHSPs to perform their chaperone-related functions [36, 37]. As the name suggests, sHSPs have a relatively low molecular weight, but multiple proteins can be assembled into large homo- or heteromeric complexes, consisting of 9–50 subunits with overall molecular weights of 800 kDa or more to form a functional unit [38–40]. The transcriptional level of Tm-p36 in adults was low, but higher in protoscolices and oncospheres, especially in the latter, which is consistent with findings in other cestodes [15–18]. The protoscolex is the larval stage of T. multiceps (coenurus cerebralis), and the oncosphere is the stage that invades the intermediate host [41]. The specific distribution also indicates that Tm-p36 plays an important role in the life-cycle of T. multiceps, especially in growth and development of the protoscolices and oncospheres which face harsh living conditions such as extremely high acidity and an anoxic environment in the host immune system. In adult cestodes, oncospheres are also present in the eggs of gravid proglottids, but the results of immunohistochemistry and qPCR analyses revealed low Tm-p36 expression level in the gravid proglottids. These results indicate that Tm-p36 is closely related to the activation of oncospheres during host invasion. However, Tm-p36 does not have good immunoreactivity from the results of western blotting and indirect ELISA. It may reveal that the short-term high expression of Tm-p36 is not recognized by the host immune system to produce the corresponding antibody for detection.
Some studies have shown that sHSPs of the parasite is overexpressed at a certain life-cycle stage or under stress, and most of them act as immune system stimulator antigen in host-parasite relationship [42–44]. Previous studies have also suggested that the major egg antigen of S. mansoni, also known as Sm-p40, is an immune system stimulator associated with granuloma formation inhibition and has been widely studied as a vaccine candidate in schistosomiasis [45–47]. Considering the similar situation, Tm-p36 could also serve as an important vaccine or therapeutic target for inhibiting activation or preventing invasion of oncospheres.
Conclusions
In conclusion, we performed sequence, structure, tissue distribution and transcriptional profile analyses of two HSPs in T. multiceps and found that Tm-HSP60 is widely distributed in all life-cycle stages, and compared with Tm-p36, Tm-HSP60 displayed stronger immunogenicity. Thus, Tm-HSP60 is of interest for antibody detection, while Tm-p36 was most strongly associated with oncospheres and protoscolices, and is of potential interest for vaccination for controlling coenurus cerebralis in the future.
Additional files
Additional file 1: Figure S1. Western blot of rTm-p36 with six coenurus cerebralis-positive sera. Lane M, protein molecular weight markers; Lane C, western blot of rTm-p36 (10 µg) with negative control goat serum.
Additional file 2: Table S1. Determination of the optimal rTm-HSP60 coating concentration and serum dilution for indirect ELISA.
Additional file 3: Table S2. Determination of the optimal rTm-p36 coating concentration and serum dilution for indirect ELISA.
Acknowledgements
We would like to thank Ning Wang, Yuqing Liang and Nengxing Sheng (Sichuan Agricultural University) for their help and advice. We also thank the native English speaking scientists of Elixigen Company (Huntington Beach, California) for editing our manuscript.
Funding
This work was supported by a grant from the Key Technology R&D Program of Sichuan Province, China (No. 2015NZ0041; http://www.scst.gov.cn/). The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Availability of data and materials
The datasets supporting the conclusions of this article are included within the article and its additional files.
Authors’ contributions
YCL and GYY conceived and designed the study. YCL and CG performed the experiments. YCL and XWD analysed the data and drafted the manuscript. XBG and WML conceived the study and collected experimental materials. YX and XRP collected and analysed the raw data. GYY assumed overall responsibility for this study, participated in its design and coordination, and helped draft the manuscript. All authors read and approved the final manuscript.
Ethics approval and consent to participate
All animals involved in this work were purchased from Dashuo Experimental Animal Co., Ltd (Chendu). All animals were maintained in accordance with the guidance of the Animal Protection Law of the People’s Republic of China, issued on 18 September 2009. All procedures were approved by the Institute of Health Animal Care and Use Committee of Sichuan Agricultural University of China (approval no. 2013-028).
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abbreviations
- HSPs
heat-shock proteins
- sHSPs
small heat-shock proteins
- qPCR
quantitative real-time PCR
- IPTG
1 mM isopropyl β-d-1-thiogalactopyranoside
- ELISA
enzyme-linked immunosorbent assay
- IgG
immunoglobulin G
- SDS-PAGE
sodium dodecyl sulphate-polyacrylamide gel electrophoresis
- TBST
TRIS-buffered saline containing Tween-20
- PBS
phosphate-buffered saline
- rTm-HSP60
recombinant T. multiceps HSP60
- rTm-p36
recombinant T. multiceps p36
Contributor Information
Yuchen Liu, Email: liuyuchen1229@163.com.
Cheng Guo, Email: chengguo92@hotmail.com.
Xiaowei Dong, Email: dongxiaowei1226@outlook.com.
Xiaobin Gu, Email: guxiaobin198225@126.com.
Yue Xie, Email: zhandegaokandey123@163.com.
Weimin Lai, Email: litsnapped2333@126.com.
Xuerong Peng, Email: pxuerong@aliyun.com.
Guangyou Yang, Email: guangyou1963@aliyun.com.
References
- 1.Xing H, Lin C, Yang Y, Gu X, Yu W, Lai W, et al. Expression, tissue localization and serodiagnostic potential of Taenia multiceps acidic ribosomal protein P2. Parasit Vectors. 2015;8:613. doi: 10.1186/s13071-015-1220-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Li WH, Qu ZG, Zhang NZ, Yue L, Jia WZ, Luo JX, et al. Molecular characterization of enolase gene from Taenia multiceps. Res Vet Sci. 2015;102:53–58. doi: 10.1016/j.rvsc.2015.06.013. [DOI] [PubMed] [Google Scholar]
- 3.Merbl Y, Shilobenjamini Y, Chai O, Chamisha Y, Anglister N, King R, et al. Taenia multiceps brain cyst removal in two wild nubian ibex (Capra nubianas) J Zoo Wildl Med. 2014;45:193–196. doi: 10.1638/2013-0175R.1. [DOI] [PubMed] [Google Scholar]
- 4.Wang N, Wang Y, Ye Q, Yang Y, Wan J, Guo C, et al. Development of a direct PCR assay to detect Taenia multiceps eggs isolated from dog feces. Vet Parasitol. 2018;251:7–11. doi: 10.1016/j.vetpar.2017.12.017. [DOI] [PubMed] [Google Scholar]
- 5.Xing H, Jing X, Yu W, Cheng G, Lin C, Gu X, et al. GP50 as a promising early diagnostic antigen for Taenia multiceps infection in goats by indirect ELISA. Parasit Vectors. 2016;9:618. doi: 10.1186/s13071-016-1915-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Dehghani M, Mohammadi MA, Rostami S, Shamsaddini S, Mirbadie SR, Harandi MF. High-resolution melting analysis (HRM) for differentiation of four major Taeniidae species in dogs Taenia hydatigena, Taenia multiceps, Taenia ovis, and Echinococcus granulosussensu stricto. Parasitol Res. 2016;115:2715–2720. doi: 10.1007/s00436-016-5018-1. [DOI] [PubMed] [Google Scholar]
- 7.Cheng G, Yu W, Xing H, Ning W, Ming Y, Ran H, et al. Molecular cloing and bioinformatics analysis of lactate dehydrogenase from Taenia multiceps. Parasitol Res. 2017;116:2845–2852. doi: 10.1007/s00436-017-5568-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Hermos JA, Healy GR, Schultz MG, Barlow J, Church WG. Fatal human cerebral coenurosis. JAMA. 1970;213:1461–1464. doi: 10.1001/jama.1970.03170350029006. [DOI] [PubMed] [Google Scholar]
- 9.Nie HM, Xie Y, Fu Y, Yang YD, Gu XB, Wang SX, et al. Cloning and characterization of the fatty acid-binding protein gene from the protoscolex of Taenia multiceps. Parasitol Res. 2013;112:1833–1839. doi: 10.1007/s00436-013-3328-0. [DOI] [PubMed] [Google Scholar]
- 10.Li W, Liu B, Yang Y, Ren Y, Wang S, Liu C, et al. The genome of tapeworm Taenia multiceps sheds light on understanding parasitic mechanism and control of coenurosis disease. DNA Res. 2018;25:499–510. doi: 10.1093/dnares/dsy020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Maresca B, Carratù L. The biology of the heat shock response in parasites. Parasitol Today. 1992;8:260–266. doi: 10.1016/0169-4758(92)90137-Q. [DOI] [PubMed] [Google Scholar]
- 12.Vonlaufen N, Kanzok SM, Wek RC, Sullivan SW., Jr Stress response pathways in protozoan parasites. Cell Microbiol. 2008;10:2387–2399. doi: 10.1111/j.1462-5822.2008.01210.x. [DOI] [PubMed] [Google Scholar]
- 13.Martinez J, Perezserrano J, Bernadina WE, Rodriguezcaabeiro F. Echinococcus granulosus: in vitro effects of ivermectin and praziquantel on hsp60 and hsp70 levels. Exp Parasitol. 1999;93:171–180. doi: 10.1006/expr.1999.4449. [DOI] [PubMed] [Google Scholar]
- 14.Wang Y, Nie H, Gu X, Wang T, Huang X, Chen L, et al. An ELISA using recombinant TmHSP70 for the diagnosis of Taenia multiceps infections in goats. Vet Parasitol. 2015;212:469–472. doi: 10.1016/j.vetpar.2015.06.020. [DOI] [PubMed] [Google Scholar]
- 15.Kappé G, Aquilina JA, Wunderink L, Kamps B, Robinson CV, Garate T, et al. Tsp36, a tapeworm small heat-shock protein with a duplicated alpha-crystallin domain, forms dimers and tetramers with good chaperone-like activity. Proteins. 2004;57:109–117. doi: 10.1002/prot.20220. [DOI] [PubMed] [Google Scholar]
- 16.Santivañez SJ, Hernández-González A, Chile N, Oleaga A, Arana Y, Palma S, et al. Proteomic study of activated Taenia solium oncospheres. Mol Biochem Parasitol. 2016;171:32–39. doi: 10.1016/j.molbiopara.2010.01.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Wang Y, Xiao D, Shen Y, Han X, Zhao F, Li X, et al. Proteomic analysis of the excretory/secretory products and antigenic proteins of Echinococcus granulosus adult worms from infected dogs. BMC Vet Res. 2015;11:119. doi: 10.1186/s12917-015-0423-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Benitez L, Harrison LJS, Parkhouse RME, Garate T. Sequence and preliminary characterisation of a Taenia saginata oncosphere gene homologue of the small heat-shock protein family. Parasitol Res. 1998;84:423–425. doi: 10.1007/s004360050422. [DOI] [PubMed] [Google Scholar]
- 19.Wu X, Fu Y, Yang D, Zhang R, Zheng W, Nie H, et al. Detailed transcriptome description of the neglected cestode Taenia multiceps. PLoS One. 2012;7:e45830. doi: 10.1371/journal.pone.0045830. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Huang X, Xu J, Chen L, Wang Y, Gu X, Peng X, et al. Analysis of transcriptome data reveals multifactor constraint on codon usage in Taenia multiceps. BMC Genomics. 2017;18:308. doi: 10.1186/s12864-017-3704-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Crowther JR, Walker JM. The ELISA Guidebook. 2. New Jersey: Humana Press; 2009. [Google Scholar]
- 22.De MA. Heat shock proteins: facts, thoughts, and dreams. Shock. 1999;11:1–12. doi: 10.1097/00024382-199901000-00001. [DOI] [PubMed] [Google Scholar]
- 23.Granel B, Swiader L, Serratrice J, Disdier P, Weiller PJ. Heat shock or “stress proteins”. Rev Med Interne. 2000;21:421–427. doi: 10.1016/S0248-8663(00)88952-3. [DOI] [PubMed] [Google Scholar]
- 24.Feder ME, Hofmann GE. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu Rev Physiol. 1999;61:243–282. doi: 10.1146/annurev.physiol.61.1.243. [DOI] [PubMed] [Google Scholar]
- 25.de Jong WW, Caspers GJ, Leunissen JA. Genealogy of the alpha-crystallin–small heat-shock protein superfamily. Int J Biol Macromol. 1998;22:151–162. doi: 10.1016/S0141-8130(98)00013-0. [DOI] [PubMed] [Google Scholar]
- 26.Pérez-Morales D, Espinoza B. The role of small heat shock proteins in parasites. Cell Stress Chaperon. 2015;20:1–14. doi: 10.1007/s12192-015-0607-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Polla BS. Heat shock proteins in host-parasite interactions. Immunol Today. 1991;12:A38. doi: 10.1016/S0167-5699(05)80011-8. [DOI] [PubMed] [Google Scholar]
- 28.Sun Y, Wang Y, Huang X, Gu X, Lai W, Peng X, et al. Characterization of glutathione S-transferase and its immunodiagnostic potential for detecting Taenia multiceps. Vet Parasitol. 2017;242:31–37. doi: 10.1016/j.vetpar.2017.05.013. [DOI] [PubMed] [Google Scholar]
- 29.Wu X, Fu Y, Yang D, Xie Y, Zhang R, Zheng W, et al. Identification of neglected cestode Taenia multiceps microRNAs by illumina sequencing and bioinformatic analysis. BMC Vet Res. 2013;9:162. doi: 10.1186/1746-6148-9-162. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Stewart GR, Young DB. Heat-shock proteins and the host-pathogen interaction during bacterial infection. Curr Opin Immunol. 2004;16:506–510. doi: 10.1016/j.coi.2004.05.007. [DOI] [PubMed] [Google Scholar]
- 31.Van EW, Van DZR, Prakken B. Heat-shock proteins induce T-cell regulation of chronic inflammation. Nat Rev Immunol. 2005;5:318–330. doi: 10.1038/nri1593. [DOI] [PubMed] [Google Scholar]
- 32.Engman DM, Dragon EA, Donelson JE. Human humoral immunity to hsp70 during Trypanosoma cruzi infection. J Immunol. 1990;144:3987–3991. [PubMed] [Google Scholar]
- 33.Hedstrom R, Culpepper J, Schinski V, Agabian N, Newport G. Schistosome heat-shock proteins are immunologically distinct host-like antigens. Mol Biochem Parasitol. 1988;29:275–282. doi: 10.1016/0166-6851(88)90082-5. [DOI] [PubMed] [Google Scholar]
- 34.Brocchieri L, Karlin S. Conservation among HSP60 sequences in relation to structure, function, and evolution. Protein Sci. 2000;9:476–486. doi: 10.1110/ps.9.3.476. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Goloubinoff P, Gatenby AA, Lorimer GH. GroEL heat-shock proteins promote assembly of foreign prokaryotic ribulose bisphosphate carboxylase oligomers in Escherichia coli. Nature. 1989;337:44–47. doi: 10.1038/337044a0. [DOI] [PubMed] [Google Scholar]
- 36.Montfort RV, Slingsby C, Vierlingt E. Structure and function of the small heat shock protein/alpha-crystallin family of molecular chaperones. Adv Protein Chem. 2001;59:105–156. doi: 10.1016/S0065-3233(01)59004-X. [DOI] [PubMed] [Google Scholar]
- 37.James M, Crabbe C, Hepburne-Scott HW. Small heat shock proteins (sHSPs) as potential drug targets. Curr Pharm Biotechnol. 2001;2:77–111. doi: 10.2174/1389201013378833. [DOI] [PubMed] [Google Scholar]
- 38.Macrae TH. Structure and function of small heat shock/alpha-crystallin proteins: established concepts and emerging ideas. Cell Mol Life Sci. 2000;57:899–913. doi: 10.1007/PL00000733. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Haslbeck M. sHsps and their role in the chaperone network. Cell Mol Life Sci. 2002;59:1649–1657. doi: 10.1007/PL00012492. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Sun Y, Macrae TH. Small heat shock proteins: molecular structure and chaperone function. Cell Mol Life Sci. 2005;62:2460–2476. doi: 10.1007/s00018-005-5190-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Oryan A, Moazeni M, Amrabadi O, Akbari M, Sharifiyazdi H. Comparison of distribution pattern, pathogenesis and molecular characteristics of larval stages of Taenia multiceps in sheep and goats. Small Ruminant Res. 2015;132:44–49. doi: 10.1016/j.smallrumres.2015.10.008. [DOI] [Google Scholar]
- 42.Ferrer E, González LM, Foster-Cuevas M, Cortéz MM, Dávila I, Rodríguez M, et al. Taenia solium: characterization of a small heat shock protein (Tsol-sHSP35.6) and its possible relevance to the diagnosis and pathogenesis of neurocysticercosis. Exp Parasitol. 2005;110:1–11. doi: 10.1016/j.exppara.2004.11.014. [DOI] [PubMed] [Google Scholar]
- 43.Moxon JV, Lacourse EJ, Wright HA, Perally S, Prescott MC, Gillard JL, et al. Proteomic analysis of embryonic Fasciola hepatica: characterization and antigenic potential of a developmentally regulated heat shock protein. Vet Parasitol. 2010;169:62–75. doi: 10.1016/j.vetpar.2009.12.031. [DOI] [PubMed] [Google Scholar]
- 44.Younis AE, Geisinger F, AjoninaEkoti I, Soblik H, Steen H, Mitreva M, et al. Stage-specific excretory/secretory small heat shock proteins from the parasitic nematode Strongyloides ratti: putative links to host’ s intestinal mucosal defense system. FEBS J. 2011;278:3319–3336. doi: 10.1111/j.1742-4658.2011.08248.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Cai Y, Langley JG, Smith DI, Boros DL. A cloned major Schistosoma mansoni egg antigen with homologies to small heat shock proteins elicits Th1 responsiveness. Infect Immun. 1996;64:1750–1755. doi: 10.1128/iai.64.5.1750-1755.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Abouel-Nour MF, Lotfy M, Attallah AM, Doughty BL. Schistosoma mansoni major egg antigen Smp40: molecular modeling and potential immunoreactivity for anti-pathology vaccine development. Mem Inst Oswaldo Cruz. 2006;101:365–372. doi: 10.1590/S0074-02762006000400004. [DOI] [PubMed] [Google Scholar]
- 47.Stadecker MJ, Hernandez HJ. The immune response and immunopathology in infection with Schistosoma mansoni: a key role of major egg antigen Sm-p40. Parasite Immunol. 2010;20:217–221. doi: 10.1046/j.1365-3024.1998.00150.x. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Additional file 1: Figure S1. Western blot of rTm-p36 with six coenurus cerebralis-positive sera. Lane M, protein molecular weight markers; Lane C, western blot of rTm-p36 (10 µg) with negative control goat serum.
Additional file 2: Table S1. Determination of the optimal rTm-HSP60 coating concentration and serum dilution for indirect ELISA.
Additional file 3: Table S2. Determination of the optimal rTm-p36 coating concentration and serum dilution for indirect ELISA.
Data Availability Statement
The datasets supporting the conclusions of this article are included within the article and its additional files.



