Skip to main content
The Journal of Physiology logoLink to The Journal of Physiology
. 2018 Dec 25;597(6):1643–1660. doi: 10.1113/JP277367

Histone demethylase UTX is a therapeutic target for diabetic kidney disease

Hong Chen 1,†, Yixue Huang 1,†, Xiuqin Zhu 2, Chong Liu 2, Yangmian Yuan 2, Hua Su 3, Chun Zhang 3, Chengyu Liu 1, Mingrui Xiong 1, Yannan Qu 2, Peng Yun 4, Ling Zheng 2,✉, Kun Huang 1,✉
PMCID: PMC6418754  PMID: 30516825

Abstract

Key points

  • Diabetic kidney disease (DKD) is a major complication of diabetes. We found that UTX (ubiquitously transcribed tetratricopeptide repeat on chromosome X, also known as KDM6A), a histone demethylase, was upregulated in the renal mesangial and tubular cells of diabetic mice and DKD patients.

  • In cultured renal mesangial and tubular cells, UTX overexpression promoted palmitic acid‐induced elevation of inflammation and DNA damage, whereas UTX knockdown or GSK‐J4 treatment showed the opposite effects.

  • We found that UTX demethylase activity‐dependently regulated the transcription of inflammatory genes and apoptosis; moreover, UTX bound with p53 and p53‐dependently exacerbated DNA damage.

  • Administration of GSK‐J4, an H3K27 demethylase inhibitor, ameliorated the diabetes‐induced renal abnormalities in db/db mice, an animal model of type 2 diabetes.

  • These results revealed the possible mechanisms underlying the regulation of histone methylation in DKD and suggest UTX as a potential therapeutic target for DKD.

Abstract

Diabetic kidney disease (DKD) is a microvascular complication of diabetes and the leading cause of end‐stage kidney disease worldwide without effective therapy available. UTX (ubiquitously transcribed tetratricopeptide repeat on chromosome X, also known as KDM6A), a histone demethylase that removes the di‐ and tri‐methyl groups from histone H3K27, plays important biological roles in gene activation, cell fate control and life span regulation in Caenorhabditis elegans. In the present study, we report upregulated UTX in the kidneys of diabetic mice and DKD patients. Administration of GSK‐J4, an H3K27 demethylase inhibitor, ameliorated the diabetes‐induced renal dysfunction, abnormal morphology, inflammation, apoptosis and DNA damage in db/db mice, comprising an animal model of type 2 diabetes. In cultured renal mesanglial and tubular cells, UTX overexpression promoted palmitic acid induced elevation of inflammation and DNA damage, whereas UTX knockdown or GSK‐J4 treatment showed the opposite effects. Mechanistically, we found that UTX demethylase activity‐dependently regulated the transcription of inflammatory genes; moreover, UTX bound with p53 and p53‐dependently exacerbated DNA damage. Collectively, our results suggest UTX as a potential therapeutic target for DKD.

Keywords: UTX, diabetic kidney disease, DNA damage, inflammation, GSK‐J4

Key points

  • Diabetic kidney disease (DKD) is a major complication of diabetes. We found that UTX (ubiquitously transcribed tetratricopeptide repeat on chromosome X, also known as KDM6A), a histone demethylase, was upregulated in the renal mesangial and tubular cells of diabetic mice and DKD patients.

  • In cultured renal mesangial and tubular cells, UTX overexpression promoted palmitic acid‐induced elevation of inflammation and DNA damage, whereas UTX knockdown or GSK‐J4 treatment showed the opposite effects.

  • We found that UTX demethylase activity‐dependently regulated the transcription of inflammatory genes and apoptosis; moreover, UTX bound with p53 and p53‐dependently exacerbated DNA damage.

  • Administration of GSK‐J4, an H3K27 demethylase inhibitor, ameliorated the diabetes‐induced renal abnormalities in db/db mice, an animal model of type 2 diabetes.

  • These results revealed the possible mechanisms underlying the regulation of histone methylation in DKD and suggest UTX as a potential therapeutic target for DKD.

Introduction

Diabetic kidney disease (DKD) is one of microvascular complications of diabetes which causes renal dysfunction and failure (Navarro‐Gonzalez et al. 2011; Du et al. 2013). There were 415 million diagnosed diabetes in 2015, and this number will reach 642 million in 2040 (http://www.diabetesatlas.org). One‐half of diabetic patients develop DKD in their life time (Lingaraj et al. 2013; Mohamed et al. 2016), making it the major cause of chronic kidney disease and end‐stage renal disease (Reidy et al. 2014). Early lesions of DKD include glomerular mesangial expansion, extracellular matrix accumulation and proteinuria (Chen et al. 2014; Falkevall et al. 2017; Chen et al. 2018). Studies suggest DKD may result from a combinational change of genetics, metabolism, environment and life style; however, its exact underlying mechanisms remain not fully understood (Lingaraj et al. 2013).

Studies have highlighted an important role of chronic inflammation in the development of DKD (You et al. 2013; Omote et al. 2014). Infiltration of inflammatory cells and upregulated inflammatory molecules, such as tumour necrosis factor (TNF)‐α, interleukin (IL)‐1β, IL‐8 and IL‐6, in kidney, greatly promote the development and progression of DKD by inducing apoptosis and necrosis in renal cells (Navarro & Mora, 2006; Lim & Tesch, 2012). In addition, inflammatory molecules promote mesangial expansion in patients of type 2 diabetes (Suzuki et al. 1995; Donate‐Correa et al. 2015). In animal studies, drugs that inhibit inflammatory factors show beneficial effects on DKD. For example, the phosphodiesterase inhibitor pentoxifylline attenuates the development of DKD through inhibiting TNF‐α (DiPetrillo & Gesek, 2004; Navarro et al. 2006) and the anti‐inflammation drug bardoxolone methyl normalizes glomerular filtration rate (GFR) in type 2 diabetic patients via inhibition of nuclear factor‐kappa B signalling (Pergola et al. 2011; Lin et al. 2018). However, how inflammation develops in DKD remains incompletely understood.

During the lifespan, the integrity of genomes is frequently threatened by endogenous and exogenous stresses, such as DNA mismatch, oxidative stress and radiation (Jackson & Bartek, 2009; Marechal & Zou, 2013). Sustained DNA damage leads to cell cycle arrest, apoptosis, cell senescence and genome instability (Jackson & Bartek, 2009; Shimizu et al. 2014). DKD is associated with increased DNA damage (Al‐Aubaidy & Jelinek, 2011; Habib et al. 2016). For example, an elevated 8‐oxodG level, which is a marker for oxidative stress‐induced DNA damage, has been reported in the kidney of diabetic rats (Prabhakar et al. 2007). Alleviation of DNA damage may thus be beneficial for DKD.

Histone demethylase UTX (ubiquitously transcribed tetratricopeptide repeat on chromosome X, also known as KDM6A) was identified in 2007 (Hong et al. 2007). Together with JMJD3 (jumonji domain containing 3, also known as KDM6B), these two histone demethylases specifically remove di‐ and tri‐methyl groups from lysine 27 residue of histone H3 (H3K27) (Agger et al. 2007; Lan et al. 2007; Choi et al. 2015). Because di‐ and tri‐methylation of H3K27 are associated with gene silencing, upregulated UTX is usually associated with gene activation (Welstead et al. 2012; Faralli et al. 2016). Recently, an increased UTX level was reported in the podocytes of patients with DKD or focal segmental glomerulosclerosis, and UTX overexpression in cultured podocytes upregulates Jagged‐1, a ligand of Notch1 signalling, which is involved in podocyte de‐differentiation (Majumder et al. 2018). However, whether UTX plays additional roles in DKD remains unclear.

In the present study, we report that, besides podocytes, upregulated UTX was also found in the tubular and mesangial cells of the kidneys of DKD patients and diabetic rodents. In vitro studies demonstrated that, under palmitic acid (PA) or high glucose (HG) stimulation, overexpressed UTX promotes inflammatory responses and DNA damage in renal tubular and mesangial cells. Mechanistically, UTX demethylase activity‐dependently regulated the transcription of inflammatory genes; moreover, UTX bound with p53 and p53‐dependently exacerbated DNA damage. Notably, GSK‐J4, an inhibitor of H3K27 demethylase, ameliorated the early DKD lesions in db/db mice, comprising an animal model of type 2 diabetes. Our findings reveal that UTX regulates the development of DKD, whereas targeting UTX has therapeutic potentials for DKD.

Methods

Ethical approval

Mice procedures were conducted in accordance with the Guidelines of the China Animal Welfare Legislation, as approved by the Committee on Ethics in the Care and Use of Laboratory Animals of College of Life Sciences, Wuhan University. All studies were performed in accordance to the ethical principles under which The Journal of Physiology operates and the studies comply with the animal ethics checklist issued by Grundy (2015). Human renal biopsy samples were collected by the Department of Nephrology, The First People's Hospital of Jingzhou. Kidneys of non‐diabetic individuals with membranous nephropathy were regarded as non‐diabetes samples. The Institutional Review Board of The First People's Hospital of Jingzhou approved the acquisition of tissue specimens and collection of human samples. All samples were obtained in accordance with standards set by the Declaration of Helsinki (2013) and after having acquired written informed consent. The study was not registered in a database.

Animals

Animals were housed in ventilated microisolator cages with free access to water and food under a 12:12 h light/dark cycle in a temperature‐controlled room (22 ± 2°C). Male db/db (BKS.Cg‐Dock7m +/+ Leprdb/JNju) mice, an animal model of type 2 diabetes, and their age‐matched non‐diabetic controls db/m or wild‐type (WT), were obtained from the Model Animal Research Center of Nanjing University. Compared to WT, db/m mice show no phenotype (Katharine P. Hummel, 1966). Four‐month old male db/db mice, which have been in diabetic states for 2 months (Katharine P. Hummel, 1966), were used in the study. Mice were separated into four groups: DMSO‐treated WT mice (WT+DMSO), GSK‐J4‐treated WT mice (WT+GSK‐J4), DMSO‐treated db/db mice (db/db+DMSO) and GSK‐J4‐treated db/db mice (db/db+GSK‐J4). GSK‐J4 (TargetMol, Boston, USA), receiving an i.p. injection, twice per day, at a dosage of 100 mg kg−1 body weight for 8 consecutive days. None of the GSK‐J4‐treated db/db mice died or showed abnormality during this experiment. Breeding pairs of Akita (Insulin2 +/−, Ins2 +/−) mice in C57BL/6 background were obtained from the Model Animal Research Center of Nanjing University, as reported previously (Chen et al. 2011; Wang et al. 2017). Five‐month old male Akita mice (Ins2 +/−) and their non‐diabetic littermates (WT, Ins2 +/+) were used. Kidneys and serum were harvested when the mouse showed no reflexive response after the anaesthesia overdose by i.p. injection of chloral hydrate (500 mg kg−1 body weight), which resulted in subsequent death by exsanguination.

Measurements of biochemical parameters

Twenty‐four hour urine samples from WT and db/db mice treated with or without GSK‐J4 were collected in metabolic cages (Tecniplast, Castronno, Italy), 1 day before death, and the volume was measured. Serum levels of creatinine, albumin and globin were analysed on a ADVIA 2400 automatic biochemical analyser (Siemens AG, Munich, Germany) using a creatinine reagent kit, an albumin reagent kit and a globin reagent kit, respectively (all obtained from Fuxing Changzheng Medical, Shanghai, China). Urine creatinine and total protein were measured with an AU2700 automatic biochemical analyser (Olympus, Tokyo, Japan) using a creatinine reagent kit (Fuxing Changzheng Medical) and a total protein reagent kit (Great Wall Clinical Reagents, Baoding, China), respectively. The method used to detect serum/urinary creatinine level is an enzymatic measurement based on a sequence of reaction, which mainly includes creatinine degradation coupled with sarcosine oxidation, as read out by the hydrogen peroxide detection system.

Cell culture, treatments, plasmids and transfection

A mouse mesangial cell line MES13 (obtained from the Shanghai Institute of Cell Resource Center, Shanghai, China) was cultured in DMEM media (Hyclone, Palo Alto, CA, USA) containing 5.5 mM glucose plus 5% FBS. Human tubular cell line, HK‐2 (obtained from CCTCC, China Center for Type Culture Collection, Wuhan, China) was cultured in DMEM/F12 media (Hyclone) containing 17.5 mM glucose and 10% FBS.

Human full‐length UTX plasmid (pFLAG‐UTX) and shUTX were kind gifts from Dr Min Gyu Lee (University of Texas MD Anderson Cancer Center, Houston, TX, USA). A catalytic domain deleted construct (dUTX) was constructed by deleting the catalytic domain (residues 1094–1241) and a catalytic domain mutant (mUTX) was constructed by replacing His1146 and Glu1148 with Ala. Stable UTX knockdown cell lines were established by puromycin (1 μg mL−1; Amresco, Solon, OH, USA) selection after shUTX plasmid transfection. pSuper vector containing shRNA targeting p53 (5′‐GGACAGCCAAGTCTGTTAT‐3’) was used (shp53) to knockdown p53.

To evaluate the effects of UTX on cells, MES13/HK‐2 cells were transfected with different plasmids as mentioned above for 6 h, then the cells were treated with or without 300 μm PA for 48 h before collection. To evaluate the effects of GSK‐J4, for MES13/HK‐2 cells treated with 300 μm PA or MES13 cells treated with 20 mM glucose (HG) for 24 h, 4 μm GSK‐J4 or the same amount of DMSO was added to the media for another 24 h before collection. As the osmotic control for HG treatment, 20 mM mannose was added to the media of MES13 cells for the indicated experiments.

Renal histology

Paraffin‐embedded kidney samples were sectioned and stained with haematoxylin & eosin (H&E) as reported previously (Chen et al. 2015). Histology was examined in a double‐blinded manner. High resolution pictures of 35–40 glomeruli per sample were taken using an BX60 microscope (Olympus) equipped with a digital CCD. The glomerular cross‐sectional areas were measured using ImagePlus, version 6.0 (Media Cybernetics, Bethesda, MD, USA). The glomerular volume was calculated using the Weibel–Gomez formula and was further normalized to the mean volume of the WT group. Periodic acid–schiff and haematoxylin (PASH) staining and Masson's trichrome staining were performed on renal sections to examine tubuloinsterstitial lesion and fibrosis, respectively.

Immunohistochemical studies

Paraffin‐embedded sections were deparaffinized and rehydrated as reported previously (Chen et al. 2011; Ding et al. 2014). Sections were incubated with 3% H2O2 for 5 min to quench endogenous peroxidase activity. After blocking with 2% BSA in PBS‐Tween, primary antibodies for type IV collagen (catalogue no. 600‐401‐106‐0.1, RRID:AB_217574; Rockland, Limerick, PA, USA), UTX (catalogue no. sc‐79334, RRID:AB_1568669; Santa Cruz Biotechnology, Dallas, TX, USA; for db/db mice), UTX (catalogue no. ab36938, RRID:AB_883400; Abcam, Cambridge, MA, USA; for human renal biopsy), F4/80 (catalogue no. sc‐52664, RRID:AB_629466; Santa Cruz Biotechnology) and p‐H2A.X (catalogue no. 9718S, RRID:AB_2118009; Cell Signaling Technology, Danvers, MA, USA) were applied to the sections at 4 °C overnight. After washing, sections were incubated with respective biotinylated secondary antibody (Vector Laboratories, Burlingame, CA, USA) for 1 h. Positive staining was visualized using DAB substrate (Vector Laboratories) with the ABC kit (Vector Laboratories).

Immunofluorescence staining was performed on mouse renal cryosections with primary antibodies against UTX (catalogue no. ab36938, RRID:AB_883400; Abcam) or α‐SMA (catalogue no. A2547, RRID:AB_476701; Sigma‐Aldrich, St Louis, MO, USA). After washing, sections were incubated with respective Alexa Fluor secondary antibody (Thermo Fisher Scientific, Waltham, MA, USA). For renal tubular staining, cryosections were incubated with 5 μg mL−1 fluorescein‐Lotus Tetragonolobus Lectin LTL (Vector Laboratories) for 3 h. Slides were rinsed with PBS and counterstained with 4′,6‐diamidino‐2‐phenylindole (DAPI).

TUNEL and dihydroethidium (DHE) assay

Sections and cells were detected by TUNEL assay using an In Situ Cell Death Detection Kit (Roche, Mannheim, Germany) as described previously (Chen et al. 2017). DHE staining (Beyotime, Shanghai, China), a marker for oxidative stress, was performed on renal cryosections.

Quantitative PCR

RNA was extracted from cultured cells using RNAiso Plus (Takara Biotechnology, Dalian, China) as reported previously (Liu et al. 2014). cDNA synthesis was performed using the M‐MLV First Stand Kit (Invitrogen, Carlsbad, CA, USA). Primer sequences of target genes are available upon request. Quantitative PCR was performed using a CFX96 System (Bio‐Rad, Hercules, CA, USA). 18S rRNA was used as an internal control. The relative difference was expressed as the fold change calculated by the 2−ΔΔCT method (Wan et al. 2017).

Western blotting

Freshly isolated kidney tissues or cultured cells were sonicated in ice‐cold RIPA buffer (Beyotime) and protein concentrations were quantitated as described previously (Li et al. 2012; Zhang et al. 2017). Some 20–80 μg of proteins from each sample were separated by SDS‐PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes for immunodetection. Commercially available antibodies were used to detect UTX (catalogue no. 33510, RRID:AB_2721244; Cell Signaling Technology), JMJD3 (catalogue no. 55354‐1‐AP, RRID:AB_2752227; Proteintech, Wuhan, China), H3K27me2 (catalogue no. PTM‐621, RRID:AB_2752228; PTM Biolabs, Hangzhou, China), H3K27me3 (catalogue no. PTM‐622, RRID:AB_2752230; PTM Biolabs), p‐ATR (catalogue no. 2853P, RRID:AB_2290281; Cell Signaling Technology), p‐ATM (catalogue no. 5883P, RRID:AB_10835213; Cell Signaling Technology), p‐Chk1 (catalogue no. 2348P, RRID:AB_331212; Cell Signaling Technology), p‐p53 (catalogue no. 9284P, RRID:AB_331464; Cell Signaling Technology), p53 (catalogue no. sc‐6243, RRID:AB_653753; Santa Cruz Biotechnology), Bax (catalogue no. sc‐526, RRID:AB_2064668; Santa Cruz Biotechnology), Bcl‐2 (catalogue no. 610538, RRID:AB_397895; BD Biosciences, San Jose, CA, USA) and p‐H2A.X (catalogue no. 9718S, RRID:AB_2118009; Cell Signaling Technology). The expression levels of target proteins were quantified using Quantity One 1‐D Analysis Software (Bio‐Rad). The protein expression levels were quantitated relative to β‐actin (catalogue no. A5316, RRID:AB_476743; Sigma‐Aldrich) or HSP70 (catalogue no. 610607, RRID:AB_397941; BD Biosciences) or H3 (catalogue no. 9715, RRID:AB_331563; Cell Signaling Technology) in the same sample and were further normalized to the respective control group.

Chromatin immunoprecipitation (ChIP) assay

MES13 cells were cross‐linked using 1% formaldehyde and stopped by adding glycine, and the ChIP assay was performed as described previously (Wan et al. 2017). Chromatin was immunoprecipitated with H3K27me3 antibody (catalogue no. ab6002, RRID:AB_305237; Abcam). The purified DNA was detected by a quantitative PCR. The primers used for the ChIP assay were: Il1b (p1) forward: CTCCAAATCCTCCCAGACAA; reverse: AAGGGTAACTAGGGGCCTGA; Il1b (p2) forward: ATAGCTGGTCAAAGGCAGGA; reverse: GCATCTCGATTTCAGGAAGG; Il6 (p1) forward: CACACGGTGAAAGAATGGTG; reverse: AAAGCCGGTTGATTCTTGTG; Il6 (p2) forward: GGTGGACAGAAAACCAGGAA; reverse: TAACCCCTCCAATGCTCAAG. The input samples were used as the internal control for comparison between samples.

Protein identification by mass spectrometry (MS)

After SDS‐PAGE and Coomassie brilliant blue staining, gel pieces at target positions were cut, subjected to in‐gel digestion and analysed with a Q Exactive HF mass spectrometer coupled with an Easy‐nLC 1000 system (Thermo Scientific, Rockford, IL, USA). The MS data were processed using Thermo Proteome Discoverer (Thermo Scientific). MS spectra were searched by the SEQUEST algorithm against SwissProt database for humans. The mass tolerances for precursor and fragment ions were set to 10 ppm and 0.02 Da, respectively. Search results were filtered to a 1% false discovery rate using the target‐decoy strategy on both peptide and protein levels.

Co‐immunoprecipitation

293T cells were treated with or without 300 μm PA for 48 h before collection, the co‐immunoprecipitation assay was performed as described previously (Wan et al. 2017). UTX antibody (catalogue no. A302‐374A, RRID:AB_1907257; Bethyl, Montgomery, TX, USA) was used for immunoprecipitation.

3‐(4,5‐Dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide (MTT) assay

MES13 cells were plated at 5000 cells per well. Six hours after transfected with different plasmids, cells were treated with or without 300 μm PA for 48 h. Then, 10 μL of MTT (5 mg mL−1; Sigma‐Aldrich) was added to each well. After 4 h, media were removed and DMSO was added. Absorbance measured at 490 nm was normalized to the respective control group, which was arbitrarily set as one.

Statistical analysis

Data are expressed as the mean ± SEM. Data were analysed using the non‐parametric Kruskal–Wallis test followed by the Mann–Whitney test for a more than two‐group comparison, whereas the Mann–Whitney test was used for a two‐group comparison. P < 0.05 was considered statistically significant.

Results

UTX is upregulated in diabetic kidney disease

Because epigenetic modifications may play important roles in the development of DKD, the mRNA levels of several histone methyltransferases and demethylases were examined in the kidneys of db/m and db/db mice. Compared to those of db/m mice, Utx was significantly elevated, whereas the levels of other histone modification enzymes, such as Jmjd3, Uty, Phf8, Ezh1 and Ezh2, were unchanged in db/db mice (Fig. 1 A). Consistently, the protein level of UTX was upregulated, whereas the H3K27me2/3 levels were reduced in the kidneys of db/db mice (Fig. 1 B). Moreover, the immunohistochemical results demonstrated elevated UTX in the nuclei of renal cells on sections of db/db mice (Fig. 1 C). Localization of UTX in podocytes has been demonstrated previously (Majumder et al. 2018); in the present study, we showed that UTX also co‐localized with α‐SMA (a marker of mesangial cell), as well as with LTL (a renal tubular marker), which were significantly increased in the kidneys of db/db mice (Fig. 1 D).

Figure 1.

Figure 1

UTX is upregulated in diabetic kidney disease

A, mRNA levels of multiple epigenetic enzymes in the kidneys of db/m or db/db mice. B, representative western blots (left) with densitometric quantitative results (right) of UTX, β‐actin, H3K27me2, H3K27me3 and histone H3 in the kidneys of db/m or db/db mice. C, representative images of UTX staining of the renal sections of WT or db/db mice. D, representative images of UTX (red)/α‐SMA (green)/DAPI (blue) (up) and UTX/LTL (green)/DAPI (bottom) staining on the renal sections of WT or db/db mice. E, quantitative PCR results of several epigenetic enzymes in the kidneys of WT or Ins2+/− mice. F, representative western blots (left) with densitometric quantitative results (right) of UTX, β‐actin, H3K27me2, H3K27me3 and histone H3 in the kidneys of WT or Ins2+/− mice. G, representative images of UTX staining in human renal tissues. Non‐diabetes, non‐diabetic kidney disease group; DKD, diabetic kidney disease group. n = 3–6 per group. * P < 0.05. [Color figure can be viewed at wileyonlinelibrary.com]

We further measured UTX and H3K27me2/3 levels in kidneys of the Akita (Insulin2 +/−, Ins2 +/−) mice, a model of type 1 diabetes. Similar to db/db mice, elevated mRNA and protein levels of UTX were observed, in parallel with reduced H3K27me2/3 in the kidneys of 5‐month‐old Akita mice (Fig. 1 E and F). Importantly, in human kidney tissues, compared to non‐diabetics, DKD patients showed dramatic upregulation of UTX in the renal tubular cells, as well as in the glomerular cells (Fig. 1 G).

UTX promotes transcription of inflammation factors in cultured renal mesangial cells

To reveal the role of UTX in DKD, UTX was overexpressed in MES13 cells, and decreased levels of H3K27me2/3 with no effect on JMJD3 level were observed (Fig. 2 A and B). Because inflammation plays important roles in the development of DKD, we examined whether UTX is involved in the regulation of inflammation. In MES13 cells, PA‐induced inflammatory responses were suggested by elevated Il1b and Il6 (Fig. 2 C) and overexpression of UTX under hyperlipidaemia‐like conditions further aggravated these responses (Fig. 2 C); however, the mRNA levels of these inflammatory factors were unchanged after UTX overexpression per se (Fig. 2 C).

Figure 2.

Figure 2

UTX promotes transcription of inflammation factors in cultured renal mesangial cells

A, representative western blots (left) and quantitative PCR (right) results of UTX in cells transfected with control or UTX plasmids. B, representative western blots (left) with densitometric quantitative results (right) of H3K27me2, H3K27me3 and JMJD3 in cells transfected with control or UTX plasmids. C, quantitative PCR results of Il1b and Il6 in cells transfected with control or UTX plasmids with or without PA‐treatment. D, representative western blots (left) and quantitative PCR (right) results of UTX in cells transfected with control or shUTX plasmids. E, representative western blots (left) with densitometric quantitative results (right) of H3K27me2, H3K27me3 and JMJD3 in cells transfected with control or shUTX plasmids. F, quantitative PCR results of Il1b and Il6 in cells transfected with control or shUTX plasmids with or without PA‐treatment. G, representative western blots of H3K27me3 and histone H3 in the experimental groups. H, quantitative PCR results of Il1b and Il6 in the experimental groups. I and J, ChIP assay for H3K27me3 on the promoters of Il1b and Il6 in the experimental groups. n = 1–3 per group. Each experiment was repeated at least three times, with representative results being shown. * P < 0.05.

In UTX knockdown MES13 cells, increased levels of H3K27me2/3 with no effect on JMJD3 level, were observed (Fig. 2 D–E). UTX knockdown significantly inhibited the PA‐induced upregulation of Il1b and Il6, whereas it showed no effect on these transcripts under normal conditions (Fig. 2 F). On the other hand, JMJD3 knockdown showed no effect on PA‐induced upregulation of Il1b and Il6 (data not shown).

To investigate whether the demethylase activity of UTX is required for the regulation of inflammatory factors, plasmids expressing WT UTX, the catalytic domain (JmjC) deleted UTX (dUTX), or a catalytic‐domain mutated UTX (UTXH1146A/E1148A, mUTX), were, respectively, transfected into stable UTX knockdown cells. Overexpression of WT UTX but not dUTX or mUTX restored the H3K27me3 level, indicating the deficiency of demethylase activity of dUTX and mUTX (Fig. 2 G). Moreover, knockdown of UTX significantly decreased PA‐induced elevation of Il1b and Il6, whereas overexpression of WT UTX but not dUTX or mUTX reversed the UTX knockdown induced normal inflammatory levels under PA‐treatment (Fig. 2 H). These results indicated that UTX promotes inflammatory responses in vitro under hyperlipidaemia‐like conditions, and that the demethylase activity of UTX is required for such regulation.

UTX has been reported to promote gene transcription by removing H3K27me3 from the promoters (Faralli et al. 2016). Accordingly, we performed a ChIP assay to examine the enrichment of H3K27me3 on the promoters of inflammatory genes. Compared to the control group, PA stimulation decreased the enrichment of H3K27me3 on the promoters of Il1b and Il6, whereas overexpression of UTX further decreased H3K27me3 levels on their promoters (Fig. 2 I). By contrast, under PA treatment, UTX knockdown increased H3K27me3 levels on the promoters of Il1b and Il6 (Fig. 2 J). These data suggested that UTX regulates the transcription of inflammatory genes by controlling H3K27me3 enrichment on their promoters.

We next examined whether UTX also regulates inflammation in tubular cells, for which a human renal tubular epithelial cell line HK‐2 was used. PA treatment induced elevation of IL6 and IL8, which could be further promoted by overexpression of UTX or suppressed by knockdown of UTX (Fig. 3), indicating that, similar to mesangial cells, UTX also regulates inflammation in tubular cells.

Figure 3.

Figure 3

UTX promotes inflammation response in cultured renal tubular epithelial cells

A and C, quantitative PCR results of UTX in different experimental groups in HK‐2 cells. B and D, quantitative PCR results of IL6 and IL8 in different experimental groups. n = 3 per group. Each experiment was repeated at least three times, with representative results being shown. * P < 0.05.

UTX regulates apoptosis in cultured renal mesangial cells

The terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay detects DNA double‐ and single‐strand breaks, the hallmark of apoptosis. Numbers of TUNEL+ cells were dramatically increased in PA‐treated MES13 cells, and overexpression of UTX under PA conditions further aggravated apoptosis (Fig. 4 A). On the other hand, UTX knockdown significantly suppressed TUNEL+ cells in PA‐ treated MES13 cells (Fig. 4 B). Cell viability was also examined by MTT assays. Under PA treatment, overexpression of UTX decreased cell viability, whereas UTX knockdown increased cell viability (Fig. 4 C and D). Furthermore, we examined the level of Bcl‐2, a key anti‐apoptotic protein, in these cells. Under PA conditions, overexpression of UTX significantly suppressed the Bcl‐2 protein level, whereas knockdown of UTX markedly upregulated Bcl‐2 level (Fig. 4 E and F).

Figure 4.

Figure 4

UTX regulates apoptosis in cultured renal mesangial cells

A and B, representative images of TUNEL+ cells in different experimental groups. C and D, cell viability in different experimental groups. E and F, representative western blots with densitometric quantitative results of Bcl‐2 in different experimental groups. Each experiment was repeated at least three times, with representative results being shown. * P < 0.05. [Color figure can be viewed at wileyonlinelibrary.com]

GSK‐J4 inhibits inflammatory responses in renal mesangial cells

We next investigated whether inhibition of UTX could relieve the hyperlipidaemia‐induced inflammation. Under PA treatment, GSK‐J4, an inhibitor for H3K27 demethylase (Ntziachristos et al. 2014), increased H3K27me2/3 levels in MES13 cells (Fig. 5 A). Consistent with the results obtained from knockdown of UTX, GSK‐J4 significantly inhibited the PA‐induced upregulation of Il1b and Il6 in MES13 cells (Fig. 5 B). Hyperglycaemia is another important player that contributes to renal dysfunction in diabetes. Under HG conditions, GSK‐J4 treatment not only increased H3K27me2/3 levels (Fig. 5 C), but also attenuated HG‐induced inflammatory responses, as demonstrated by elevated Il1b and Il6 (Fig. 5 D). Moreover, a control study suggested that osmotic changes in the experiment play no obvious role in the HG‐induced elevation of inflammatory factors because no significant change on Il1b and Il6 mRNA levels was observed in mannose‐treated MES13 cells (data not shown).

Figure 5.

Figure 5

GSK‐J4 inhibits inflammatory response in cultured renal mesangial cells

A, effects of GSK‐J4 on H3K27me2/3 levels under PA treatment with representative western blots shown on the left and densitometric quantitative results shown on the right. B, effects of GSK‐J4 on Il1b and Il6 levels under PA‐treated conditions. C, effects of GSK‐J4 on H3K27me2/3 levels under HG treatment with representative western blots shown on the left and densitometric quantitative results shown on the right. D, effects of GSK‐J4 on Il1b and Il6 levels under HG‐treated conditions. n = 3 per group. Each experiment was repeated at least three times, with representative results being shown. * P < 0.05.

UTX promotes DNA damage via p53

To identify possible binding partners of UTX, an immunoprecipitation experiment was performed in 293T cells transfected with UTX. Mass spectroscopy results suggested that p53 and RAD50, two key factors involved in DNA damage responses (Achanta & Huang, 2004; Roset et al. 2014; Speidel, 2015), may bind to UTX (Fig. 6 A). To investigate whether the endogenous UTX binds to p53 or RAD50, and whether PA treatment affects their binding, we performed a co‐immunoprecipitation experiment in 293T cells with or without PA treatment. We found that UTX interacts with p53 and RAD50, and the binding affinity of UTX to p53 but not to RAD50 was enhanced under PA treatment (Fig. 6 B).

Figure 6.

Figure 6

UTX promotes DNA damage via p53

A, silver staining and mass spectrometry results of immunoprecipitation suggest possible binding partners of UTX. IP, immunoprecipitation. B, co‐immunoprecipitation results of UTX in 293T cells treated with or without PA. HSP70 serves as the loading control. C and D, representative images of p‐H2A.X staining (red) in the experimental groups. E to G, representative western blots (up) with densitometric quantitative results (below) of p‐H2A.X, p‐p53, p53 and β‐actin in the experimental groups. n = 1–3 per group. Each experiment was repeated at least three times, with representative results being shown. * P < 0.05. [Color figure can be viewed at wileyonlinelibrary.com]

A DNA damage marker p‐H2A.X was stained in MES13 cells. PA treatment notably induced p‐H2A.X staining, which was further increased after UTX overexpression (Fig. 6 C). Consistently, western blotting demonstrated that UTX overexpression further increased the PA‐induced elevation of p‐p53 (active form of p53) and p‐H2A.X (Fig. 6 E). Moreover, knockdown of UTX significantly inhibited the PA‐induced upregulation of p‐H2A.X staining, as well as the levels of p‐H2A.X and p‐p53 (Fig. 6 D and F). To explore whether p53 is indispensible for UTX regulated DNA damage under PA treatment, we knocked down p53 in UTX stable knockdown cells, and the inhibitory effects of UTX knockdown on p‐H2A.X was blocked by p53 knockdown (Fig. 6 G).

GSK‐J4 delays the development of DKD in db/db mice

To investigate whether GSK‐J4 can delay the progression of DKD in vivo, three dosages of GSK‐J4 (10, 50, 100 mg kg−1 body weight) were i.p. injected into C57BL/6 mice. At 100 mg kg−1 body weight, GSK‐J4 significantly upregulated renal H3K27me3 levels after 1 day of treatment and therefore was used for in vivo experiments (Fig. 7 A).

Figure 7.

Figure 7

Administration of GSK‐J4 delays the development of DKD in db/db mice

A, representative western blots (top) with densitometric quantitative results (bottom) of GSK‐J4 dose‐dependent effects on H3K27me3 levels (1 day treatment). B, representative western blots (left) with densitometric quantitative results (right) of H3K27me2, H3K27me3, H3K27ac, JMJD3 and EZH2 in different experimental groups (8 day treatment). C and D, representative images of H&E, type IV collagen, PASH and Masson staining (8 day treatment). E and F, quantitative PCR results of Kim1, Ngal, Il1b, Il6 and Tnfa (8 day treatment). G, representative images of F4/80 staining (8 day treatment). n = 5 or 6 per group. * P < 0.05. [Color figure can be viewed at wileyonlinelibrary.com]

The body weight of db/db mice was significantly higher than that of WT mice and GSK‐J4 had no effect on it (Table 1). Compared to vehicle‐treated db/db mice, GSK‐J4 treatment showed no difference in the levels of non‐fasting blood glucose (NFBG) and glycosylated serum protein (Table 1). Elevation of serum albumin level was observed in db/db mice; however, this increase was not normalized by GSK‐J4 treatment, possibly as a result of the short duration of the treatment (Table 1). A higher kidney weight of db/db mice indicated renal hypertrophy, which was suppressed by GSK‐J4 treatment (Table 1). Meanwhile, the urine volume, urine protein and GFR were significantly elevated in db/db mice, which were normalized by GSK‐J4 treatment, indicating improved renal functions (Table 1).

Table 1.

Physiological effects of GSK‐J4 treatment on experimental groups

WT+DMSO WT+GSK‐J4 db/db+DMSO db/db+GSK‐J4
NFBG (mmol L−1) 9.2 ± 0.5 7.5 ± 0.4* 33.1 ± 0.2** 31.0 ± 1.3
GSP (mmol L−1) 7.2 ± 0.1 8.0 ± 0.5 13.5 ± 1.7** 11.7 ± 1.8
Body weight (g) 24.0 ± 0.8 24.8 ± 0.6 46.7 ± 2.0** 48.5 ± 2.2
Kidney weight (mg) 167.7 ± 8.0 167.5 ± 4.5 245.2 ± 6.1** 217.5 ± 1.1$
Liver weight (g) 1.1 ± 0.06 1.0 ± 0.04 2.4 ± 0.06** 2.1 ± 0.04
Fat (g) 0.14 ± 0.02 0.13 ± 0.02 1.23 ± 0.07** 1.21 ± 0.05
KI (%) 0.70 ± 0.03 0.69 ± 0.02 0.53 ± 0.01** 0.47 ± 0.03#
Urine volume (mL) 1.3 ± 0.3 2.0 ± 0.1 12.7 ± 0.5** 9.5 ± 1.0#
Urine protein (mg) 3.6 ± 0.9 5.0 ± 0.5 10.0 ± 1.5** 4.4 ± 1.2#
GFR (mL min−1) 0.15 ± 0.03 0.22 ± 0.02 0.25 ± 0.03* 0.15 ± 0.03#
Serum albumin (g L−1) 9.1 ± 1.0 9.7 ± 1.1 13.5 ± 1.9* 10.2 ± 0.8

GSP, glycosylated serum protein; KI, kidney weight/body weight; Ucr, urinary creatinine; Pcr, serum creatinine; V, 24 h urinary volume. GFR calculated as Ucr*V/Pcr/1440. * P < 0.05 compared to WT mice; ** P < 0.001 compared to WT mice; $ P = 0.07 compared to db/db mice, # P < 0.05 compared to db/db mice, n = 5–6 per group.

Consistent with our previous observations (Fig. 1 B), the levels of H3K27me2/3 were decreased in db/db mice, whereas GSK‐J4 treatment prevented such diabetes‐induced downregulation (Fig. 7 B). Meanwhile, the level of H3K27ac was unchanged among these groups (Fig. 7 B). In addition, no difference in the levels of JMJD3 and EZH2 was observed (Fig. 7 B). H&E staining and collagen IV staining showed increased mesangial areas of db/db mice compared to those of WT mice, and GSK‐J4 treatment normalized such glomerular expansion in db/db mice (Fig. 7 C). Moreover, PASH staining and Masson's trichrome staining showed mildly elevated tubulointerstitial lesion and fibrosis in the kidneys of db/db mice, and administration of GSK‐J4 significantly suppressed these lesions in db/db mice (Fig. 7 D). The mRNA levels of Kim1 and Ngal (tubular injury markers) were examined, although no elevation of Kim1 was detected, and a significant increase in Ngal was found in the kidneys of db/db mice, whereas GSK‐J4 treatment significantly normalized Kim1 and Ngal levels in the kidneys of db/db mice (Fig. 7 E). To investigate whether GSK‐J4 delays the development of DKD by relieving inflammation, inflammatory markers were examined. The transcription levels of Il1b, Il6 and Tnfa were increased in the kidneys of db/db mice, which were normalized by GSK‐J4 treatment (Fig. 7 F). Compared to WT mice, the staining of a macrophage marker F4/80 was significantly enhanced in renal sections of db/db mice, which was attenuated after GSK‐J4 treatment (Fig. 7 G). Although db/db mice also showed increased oxidative stress in the kidneys, as demonstrated by DHE staining, GSK‐J4 treatment showed no obvious effect on this diabetes‐induced abnormality (data not shown).

Compared to WT mice, db/db mice showed a more severe DNA damage phenotype indicated by the dramatically elevated protein levels of p‐ATR, p‐Chk1, p‐ATM, p‐p53 and p‐H2A.X, suggesting activated DNA damage response signalling, whereas GSK‐J4 treatment effectively decreased these DNA damage related protein levels in db/db mice (Fig. 8 A and B). Consistently, p‐H2A.X staining demonstrated that GSK‐J4 treatment significantly alleviated diabetes‐induced DNA damage on renal sections of db/db mice (Fig. 8 C).

Figure 8.

Figure 8

Administration of GSK‐J4 alleviates DNA damage in db/db mice

A and B, representative western blots (left) with densitometric quantitative results (right) of p‐ATR, p‐Chk1, p‐ATM, p‐p53, p53, p‐H2A.X and HSP70 in the experimental groups. C and D, representative images of p‐H2A.X (C) and TUNEL staining (D) in the experimental groups. E, representative western blots (top) with densitometric quantitative results (bottom) of Bax, Bcl‐2 and HSP70 in different experimental groups. n = 5 or 6 per group; scale bar = 50 μm. * P < 0.05. F, possible mechanisms for the roles that UTX plays in diabetic kidney disease. [Color figure can be viewed at wileyonlinelibrary.com]

The TUNEL assay demonstrated increases in apoptosis in the kidneys of db/db mice, and GSK‐J4 treatment significantly reduced the diabetes‐induced upregulation of apoptosis in the kidneys (Fig. 8 D). Consistent with the TUNEL assay results, the Bax level was significantly increased and the Bcl‐2 level was decreased in the kidneys of db/db mice, whereas GSK‐J4 significantly normalized these diabetes‐induced changes (Fig. 8 E).

Discussion

One‐half of diabetic patients eventually develop kidney diseases with limited available therapies, which results in huge medical costs (Brenneman et al. 2016). In the present study, we report that UTX, a histone H3K27 demethylase, plays important roles in the progression of DKD. GSK‐J4, an inhibitor for H3K27 demethylase, inhibits the diabetes‐induced renal dysfunction in db/db mice.

Recently, UTX was suggested to be increased in the podocytes of DKD patients, and UTX overexpression in cultured podocytes upregulates Jagged‐1 (Majumder et al. 2018). In the present study, we further reported that UTX was also increased in the mesangial cells and renal tubular cells in the kidneys of DKD patients, as well as in type 2 diabetic animal models (Fig. 1). Mesangial cells, podocytes and tubular cells are all involved in the development of DKD, which are responsible for mesangial expansion and accumulation of extracellular matrix (Gruden et al. 2005), podocyte loss, podocyte foot processes fusion and effacement (Maezawa et al. 2015), as well as renal tubular basement membrane thickening and tubular atrophy (Tang et al. 2017), respectively. We showed elevated UTX in all three major renal cell types involved in DKD, implicating a critical role of UTX in DKD.

Similarly, we also demonstrated that administration of GSK‐J4 to db/db mice ameliorated mesangial matrix accumulation (Fig. 7), a major lesion for DKD, as recently suggested by Majumder et al. (2018). However, in that previous work, a low dosage of GSK‐J4 (10 mg kg−1 body weight, twice per week) was injected into 2‐month‐old male db/db mice, which had just become diabetic (Katharine P. Hummel, 1966), for 10 weeks for prevention purposes; although normalized renal function (as demonstrated by reduced albuminuria) and podocyte foot process effacement were achieved, there was no effect on podocyte loss and urine volume (Majumder et al. 2018). We thus hypothesize that other cell types may also contribute to the beneficial effects observed. In the present study, a higher dosage (100 mg kg−1 body weight, twice per day) was injected into 4‐month‐old db/db mice for a much shorter administration duration (8 days) for intervention purposes. We found significantly decreased urine volume, urine protein, GFR and KI in GSK‐J4‐treated db/db mice (Table 1). Another interesting result of the present study concerns the effect of GSK‐J4 on blood glucose levels. A chronic low dosage of GSK‐J4 decreases NFBG levels (Majumder et al. 2018), whereas no difference was observed in the present study (Table 1). These results may indicate a direct effect of high dosage GSK‐J4 on DKD because lowering blood glucose usually attenuates multiple diabetic complications (Pirart et al. 1978) and thus the beneficial effects of chronic low dosage of GSK‐J4 on DKD may be a result of the indirect blood lowering effect. In summary, both studies demonstrated the beneficial effects of GSK‐J4 on DKD, either in a chronic low dosage preventive way or in an acute high dosage interventional approach.

GSK‐J4 has been shown to inhibit cancers and inflammatory diseases. It inhibits histone demethylase activity, which is essential for the growth of T‐cell acute lymphoblastic leukaemia (Ntziachristos et al. 2014) and non‐small cell lung cancer cells (Watarai et al. 2016). In addition, GSK‐J4 inhibits paediatric brainstem glioma by targeting the oncogenic mutation in histone variant H3.3 (Hashizume et al. 2014). Furthermore, GSK‐J4 also modulates inflammatory responses in macrophage and microglia by inhibiting demethylase activity, which is critical for the activation of proinflammatory genes (Kruidenier et al. 2012; Das et al. 2017). Moreover, GSK‐J4 modifies the H3K27me3 and H3K4me3 levels on specific gene promoters in dendritic cells, which prevents autoimmune encephalomyelitis (Donas et al. 2016). In the present study, we demonstrated that UTX, especially its enzyme activity, is involved in the regulation of inflammation in cultured renal cells and in db/db mice (Figs 2, 3 and 7). We also found that overexpression and knockdown of UTX did not affect the expression of JMJD3 in MES13 cells. In addition, knockdown JMJD3 did not affect PA‐induced inflammation in MES13 cells. These results suggest that, in our model, UTX may regulate DKD‐ or PA‐induced inflammation independent of JMJD3. Because inflammation plays an important role in the pathogenesis of DKD (Wada & Makino, 2013; Donate‐Correa et al. 2015), the anti‐inflammatory effects achieved by genetic or pharmacological inhibition of UTX indicate that it is a potential target for DKD or other inflammatory diseases.

UTX has been shown to interact with p53 (Akdemir et al. 2014) and co‐ordinately regulate DNA damage in Drosophila (Zhang et al. 2013). However, in mammalian cells, direct interaction between UTX and DNA damage modulators has not been reported. In the present study, we demonstrated that UTX binds with p53 and RAD50, comprising two DNA damage modulators (Fig. 6). Furthermore, UTX regulated DNA damage via p53 (Fig. 6), at least in vitro, and GSK‐J4 inhibited the diabetes‐induced DNA damage in the kidney of db/db mice (Fig. 8).

In summary, the results of the present study suggest novel functions of UTX with respect to regulating inflammation and DNA damage. Genetic inhibiting UTX ameliorated PA‐induced inflammation and DNA damage in renal cells. Administration of GSK‐J4, an inhibitor for UTX, in db/db mice normalized renal function and morphology by alleviating inflammation and DNA damage. Our findings reveal new roles of UTX in DKD and provide a potential therapeutic target for DKD (Fig. 8 F).

Additional information

Competing interests

The authors declare that they have no competing interests.

Author contributions

LZ and KH designed the experiments. HC, YXH, XQZ, CL, YMY, MRX, CYL, HS, CZ, PY and YNQ performed the experiments. HC, YXH, LZ and KH analysed the data. HC, YXH, LZ and KH wrote the manuscript. All authors read and approved the final manuscript submitted for publication.

Funding

This work was supported by the Natural Science Foundation of China (31500941, 31471208, 31671195 and 31871381), the Natural Science Foundation of Hubei Province (2016CFA012), the Program for HUST Academic Frontier Youth Team, Integrated Innovative Team for Major Human Diseases Program of Tongji Medical College (HUST), and the Fundamental Research Fund for the Central Universities (2018KFYYXJJ021).

Acknowledgements

We are grateful for the support of the Analytical and Testing Core of College of Life Sciences of Wuhan University, as well as the Analytical and Testing Center of Huazhong University of Science and Technology.

Biographies

Hong Chen completed her PhD and postdoctoral training at the School of Pharmacy, Tongji Medical College of Huazhong University of Science and Technology (Wuhan, China), under the supervision of Professor Kun Huang. Her graduate studies focused on renal biology, in particular on the roles of adipokines in diabetic kidney disease and acute kidney injury. In 2017, she joined the School of Pharmacy, Tongji Medical College at Huazhong University of Science and Technology, as a lecturer, where she is investigating the role of epigenetics in diabetic kidney disease.

graphic file with name TJP-597-1643-g001.gif

Yixue Huang is a second year PhD student under the supervision of Professor Kun Huang at School of Pharmacy, Tongji Medical College of Huazhong University of Science and Technology (China). Her research interests include understanding the underlying mechanisms of diabetic kidney disease and fatty liver diseases. In addition, she is interested in identifying small molecular inhibitors with clinical potentials.

Edited by: Kim Barrett & Robert Fenton

Contributor Information

Ling Zheng, Email: lzheng@whu.edu.cn.

Kun Huang, Email: kunhuang@hust.edu.cn.

References

  1. Achanta G & Huang P (2004). Role of p53 in sensing oxidative DNA damage in response to reactive oxygen species‐generating agents. Cancer Res 64, 6233–6239. [DOI] [PubMed] [Google Scholar]
  2. Agger K, Cloos PA, Christensen J, Pasini D, Rose S, Rappsilber J, Issaeva I, Canaani E, Salcini AE & Helin K (2007). UTX and JMJD3 are histone H3K27 demethylases involved in HOX gene regulation and development. Nature 449, 731–734. [DOI] [PubMed] [Google Scholar]
  3. Akdemir KC, Jain AK, Allton K, Aronow B, Xu X, Cooney AJ, Li W & Barton MC (2014). Genome‐wide profiling reveals stimulus‐specific functions of p53 during differentiation and DNA damage of human embryonic stem cells. Nucleic Acids Res 42, 205–223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Al‐Aubaidy HA & Jelinek HF (2011). Oxidative DNA damage and obesity in type 2 diabetes mellitus. Eur J Endocrinol 164, 899–904. [DOI] [PubMed] [Google Scholar]
  5. Brenneman J, Hill J & Pullen S (2016). Emerging therapeutics for the treatment of diabetic nephropathy. Bioorganic Med Chem Lett 26, 4394–4402. [DOI] [PubMed] [Google Scholar]
  6. Chen H, Li J, Jiao L, Petersen RB, Li J, Peng A, Zheng L & Huang K (2014). Apelin inhibits the development of diabetic nephropathy by regulating histone acetylation in Akita mouse. J Physiol 592, 505–521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen H, Liu C, Cheng C, Zheng L & Huang K (2018). Effects of apelin peptides on diabetic complications. Curr Protein Pept Sci 19, 179–189. [DOI] [PubMed] [Google Scholar]
  8. Chen H, Wan D, Wang L, Peng A, Xiao H, Petersen RB, Liu C, Zheng L & Huang K (2015). Apelin protects against acute renal injury by inhibiting TGF‐beta1. Biochim Biophys Acta 1852, 1278–1287. [DOI] [PubMed] [Google Scholar]
  9. Chen H, Wang L, Wang W, Cheng C, Zhang Y, Zhou Y, Wang C, Miao X, Wang J, Wang C, Li J, Zheng L & Huang K (2017). ELABELA and an ELABELA fragment protect against AKI. J Am Soc Nephrol 28, 2694–2707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chen H, Zheng C, Zhang X, Li J, Li J, Zheng L & Huang K (2011). Apelin alleviates diabetes‐associated endoplasmic reticulum stress in the pancreas of Akita mice. Peptides 32, 1634–1639. [DOI] [PubMed] [Google Scholar]
  11. Choi HJ, Park JH, Park M, Won HY, Joo HS, Lee CH, Lee JY & Kong G (2015). UTX inhibits EMT‐induced breast CSC properties by epigenetic repression of EMT genes in cooperation with LSD1 and HDAC1. EMBO Rep 16, 1288–1298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Das A, Arifuzzaman S, Yoon T, Kim SH, Chai JC, Lee YS, Jung KH & Chai YG (2017). RNA sequencing reveals resistance of TLR4 ligand‐activated microglial cells to inflammation mediated by the selective jumonji H3K27 demethylase inhibitor. Sci Rep 7, 1–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Ding Y, Li J, Liu S, Zhang L, Xiao H, Li J, Chen H, Petersen RB, Huang K & Zheng L (2014). DNA hypomethylation of inflammation‐associated genes in adipose tissue of female mice after multigenerational high fat diet feeding. Int J Obes 38, 198–204. [DOI] [PubMed] [Google Scholar]
  14. DiPetrillo K & Gesek FA (2004). Pentoxifylline ameliorates renal tumor necrosis factor expression, sodium retention, and renal hypertrophy in diabetic rats. Am J Nephrol 24, 352–359. [DOI] [PubMed] [Google Scholar]
  15. Donas C, Carrasco M, Fritz M, Prado C, Tejon G, Osorio‐Barrios F, Manriquez V, Reyes P, Pacheco R, Bono MR, Loyola A & Rosemblatt M (2016). The histone demethylase inhibitor GSK‐J4 limits inflammation through the induction of a tolerogenic phenotype on DCs. J Autoimmun 75, 105–117. [DOI] [PubMed] [Google Scholar]
  16. Donate‐Correa J, Martin‐Nunez E, Muros‐de‐Fuentes M, Mora‐Fernandez C & Navarro‐Gonzalez JF (2015). Inflammatory cytokines in diabetic nephropathy. J Diabetes Res 2015, 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Du P, Fan B, Han H, Zhen J, Shang J, Wang X, Li X, Shi W, Tang W, Bao C, Wang Z, Zhang Y, Zhang B, Wei X & Yi F (2013). NOD2 promotes renal injury by exacerbating inflammation and podocyte insulin resistance in diabetic nephropathy. Kidney Int 84, 265–276. [DOI] [PubMed] [Google Scholar]
  18. Falkevall A, Mehlem A, Palombo I, Heller Sahlgren B, Ebarasi L, He L, Ytterberg AJ, Olauson H, Axelsson J, Sundelin B, Patrakka J, Scotney P, Nash A & Eriksson U (2017). Reducing VEGF‐B signaling ameliorates renal lipotoxicity and protects against diabetic kidney disease. Cell Metab 25, 713–726. [DOI] [PubMed] [Google Scholar]
  19. Faralli H, Wang C, Nakka K, Benyoucef A, Sebastian S, Zhuang L, Chu A, Palii CG, Liu C, Camellato B, Brand M, Ge K & Dilworth FJ (2016). UTX demethylase activity is required for satellite cell‐mediated muscle regeneration. J Clin Invest 126, 1555–1565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gruden G, Perin PC & Camussi G (2005). Insight on the pathogenesis of diabetic nephropathy from the study of podocyte and mesangial cell biology. Curr Diabetes Rev 1, 27–40. [DOI] [PubMed] [Google Scholar]
  21. Grundy D (2015). Principles and standards for reporting animal experiments in The Journal of Physiology and Experimental Physiology. J Physiol 593, 2547–2549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Habib SL, Yadav A, Kidane D, Weiss RH & Liang S (2016). Novel protective mechanism of reducing renal cell damage in diabetes: activation AMPK by AICAR increased NRF2/OGG1 proteins and reduced oxidative DNA damage. Cell Cycle 15, 3048–3059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hashizume R, Andor N, Ihara Y, Lerner R, Gan H, Chen X, Fang D, Huang X, Tom MW, Ngo V, Solomon D, Mueller S, Paris PL, Zhang Z, Petritsch C, Gupta N, Waldman TA & James CD (2014). Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma. Nat Med 20, 1394–1396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hong S, Cho YW, Yu LR, Yu H, Veenstra TD & Ge K (2007). Identification of JmjC domain‐containing UTX and JMJD3 as histone H3 lysine 27 demethylases. Proc Natl Acad Sci U S A 104, 18439–18444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Jackson SP & Bartek J (2009). The DNA‐damage response in human biology and disease. Nature 461, 1071–1078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hummel KP, Dickie MM, Coleman DL (1966). Diabetes, a new mutation in the mouse. Science 153, 1127–1128. [DOI] [PubMed] [Google Scholar]
  27. Kruidenier L, Chung CW, Cheng Z, Liddle J, Che K, Joberty G, Bantscheff M, Bountra C, Bridges A, Diallo H, Eberhard D, Hutchinson S, Jones E, Katso R, Leveridge M, Mander PK, Mosley J, Ramirez‐Molina C, Rowland P, Schofield CJ, Sheppard RJ, Smith JE, Swales C, Tanner R, Thomas P, Tumber A, Drewes G, Oppermann U, Patel DJ, Lee K & Wilson DM (2012). A selective jumonji H3K27 demethylase inhibitor modulates the proinflammatory macrophage response. Nature 488, 404–408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lan F, Bayliss PE, Rinn JL, Whetstine JR, Wang JK, Chen S, Iwase S, Alpatov R, Issaeva I, Canaani E, Roberts TM, Chang HY & Shi Y (2007). A histone H3 lysine 27 demethylase regulates animal posterior development. Nature 449, 689–694. [DOI] [PubMed] [Google Scholar]
  29. Li C, Wang L, Huang K & Zheng L (2012). Endoplasmic reticulum stress in retinal vascular degeneration: protective role of resveratrol. Invest Ophthalmol Vis Sci 53, 3241–3249. [DOI] [PubMed] [Google Scholar]
  30. Lim AK & Tesch GH (2012). Inflammation in diabetic nephropathy. Mediators Inflamm 2012, 1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Lin Y‐C, Chang Y‐H, Yang S‐Y, Wu K‐D & Chu T‐S (2018). Update of pathophysiology and management of diabetic kidney disease. J Formos Med Assoc 117, 662–675. [DOI] [PubMed] [Google Scholar]
  32. Lingaraj U, Annamalai C & Radhakrishnan H (2013). Diabetes and kidney disease. Apollo Med 10, 118–125. [Google Scholar]
  33. Liu X, Zhou Y, Liu X, Peng A, Gong H, Huang L, Ji K, Petersen RB, Zheng L & Huang K (2014). MPHOSPH1: a potential therapeutic target for hepatocellular carcinoma. Cancer Res 74, 6623–6634. [DOI] [PubMed] [Google Scholar]
  34. Maezawa Y, Takemoto M & Yokote K (2015). Cell biology of diabetic nephropathy: roles of endothelial cells, tubulointerstitial cells and podocytes. J Diabetes Invest 6, 3–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Majumder S, Thieme K, Batchu SN, Alghamdi TA, Bowskill BB, Kabir MG, Liu Y, Advani SL, White KE, Geldenhuys L, Tennankore KK, Poyah P, Siddiqi FS & Advani A (2018). Shifts in podocyte histone H3K27me3 regulate mouse and human glomerular disease. J Clin Invest 128, 483–499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Marechal A & Zou L (2013). DNA damage sensing by the ATM and ATR kinases. Cold Spring Harb Perspect Biol 5, 1–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Mohamed R, Jayakumar C, Chen F, Fulton D, Stepp D, Gansevoort RT & Ramesh G (2016). Low‐dose IL‐17 therapy prevents and reverses diabetic nephropathy, metabolic syndrome, and associated organ fibrosis. J Am Soc Nephrol 27, 745–765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Navarro‐Gonzalez JF, Mora‐Fernandez C, Muros de Fuentes M & Garcia‐Perez J (2011). Inflammatory molecules and pathways in the pathogenesis of diabetic nephropathy. Nat Rev Nephrol 7, 327–340. [DOI] [PubMed] [Google Scholar]
  39. Navarro JF, Milena FJ, Mora C, Leon C & Garcia J (2006). Renal pro‐inflammatory cytokine gene expression in diabetic nephropathy: effect of angiotensin‐converting enzyme inhibition and pentoxifylline administration. Am J Nephrol 26, 562–570. [DOI] [PubMed] [Google Scholar]
  40. Navarro JF & Mora C (2006). Diabetes, inflammation, proinflammatory cytokines, and diabetic nephropathy. Sci World J 6, 908–917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Ntziachristos P, Tsirigos A, Welstead GG, Trimarchi T, Bakogianni S, Xu L, Loizou E, Holmfeldt L, Strikoudis A, King B, Mullenders J, Becksfort J, Nedjic J, Paietta E, Tallman MS, Rowe JM, Tonon G, Satoh T, Kruidenier L, Prinjha R, Akira S, Van Vlierberghe P, Ferrando AA, Jaenisch R, Mullighan CG & Aifantis I (2014). Contrasting roles of histone 3 lysine 27 demethylases in acute lymphoblastic leukaemia. Nature 514, 513–517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Omote K, Gohda T, Murakoshi M, Sasaki Y, Kazuno S, Fujimura T, Ishizaka M, Sonoda Y & Tomino Y (2014). Role of the TNF pathway in the progression of diabetic nephropathy in KK‐A(y) mice. Am J Physiol Renal Physiol 306, F1335–F1347. [DOI] [PubMed] [Google Scholar]
  43. Pergola PE, Raskin P, Toto RD, Meyer CJ, Huff JW, Grossman EB, Krauth M, Ruiz S, Audhya P, Christ‐Schmidt H, Wittes J, Warnock DG & Investigators BS (2011). Bardoxolone methyl and kidney function in CKD with type 2 diabetes. New Engl J Med 365, 327–336. [DOI] [PubMed] [Google Scholar]
  44. Pirart J, Lauvaux JP & Rey W (1978). Blood sugar and diabetic complications. New Engl J Med 298, 1149. [DOI] [PubMed] [Google Scholar]
  45. Prabhakar S, Starnes J, Shi S, Lonis B & Tran R (2007). Diabetic nephropathy is associated with oxidative stress and decreased renal nitric oxide production. J Am Soc Nephrol 18, 2945–2952. [DOI] [PubMed] [Google Scholar]
  46. Reidy K, Kang HM, Hostetter T & Susztak K (2014). Molecular mechanisms of diabetic kidney disease. J Clin Invest 124, 2333–2340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Roset R, Inagaki A, Hohl M, Brenet F, Lafrance‐Vanasse J, Lange J, Scandura JM, Tainer JA, Keeney S & Petrini JH (2014). The Rad50 hook domain regulates DNA damage signaling and tumorigenesis. Genes Dev 28, 451–462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Shimizu I, Yoshida Y, Suda M & Minamino T (2014). DNA damage response and metabolic disease. Cell Metab 20, 967–977. [DOI] [PubMed] [Google Scholar]
  49. Speidel D (2015). The role of DNA damage responses in p53 biology. Arch Toxicol 89, 501–517. [DOI] [PubMed] [Google Scholar]
  50. Suzuki D, Miyazaki M, Naka R, Koji T, Yagame M, Jinde K, Endoh M, Nomoto Y & Sakai H (1995). In situ hybridization of interleukin 6 in diabetic nephropathy. Diabetes 44, 1233–1238. [DOI] [PubMed] [Google Scholar]
  51. Tang F, Hao Y, Zhang X & Qin J (2017). Effect of echinacoside on kidney fibrosis by inhibition of TGF‐beta1/Smads signaling pathway in the db/db mice model of diabetic nephropathy. Drug Des Devel Ther 11, 2813–2826. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Wada J & Makino H (2013). Inflammation and the pathogenesis of diabetic nephropathy. Clin Sci 124, 139–152. [DOI] [PubMed] [Google Scholar]
  53. Wan D, Liu C, Sun Y, Wang W, Huang K & Zheng L (2017). MacroH2A1.1 cooperates with EZH2 to promote adipogenesis by regulating Wnt signaling. J Mol Cell Biol 9, 325–337. [DOI] [PubMed] [Google Scholar]
  54. Wang W, Wang Q, Wan D, Sun Y, Wang L, Chen H, Liu C, Petersen RB, Li J, Xue W, Zheng L & Huang K (2017). Histone HIST1H1C/H1.2 regulates autophagy in the development of diabetic retinopathy. Autophagy 13, 941–954. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Watarai H, Okada M, Kuramoto K, Takeda H, Sakaki H, Suzuki S, Seino S, Oizumi H, Sadahiro M & Kitanaka C (2016). Impact of H3K27 demethylase inhibitor GSKJ4 on NSCLC cells alone and in combination with metformin. Anticancer Res 36, 6083–6092. [DOI] [PubMed] [Google Scholar]
  56. Welstead GG, Creyghton MP, Bilodeau S, Cheng AW, Markoulaki S, Young RA & Jaenisch R (2012). X‐linked H3K27me3 demethylase Utx is required for embryonic development in a sex‐specific manner. Proc Natl Acad Sci U S A 109, 13004–13009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. You H, Gao T, Cooper TK, Brian Reeves W & Awad AS (2013). Macrophages directly mediate diabetic renal injury. Am J Physiol Renal Physiol 305, F1719–F1727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Zhang C, Hong Z, Ma W, Ma D, Qian Y, Xie W, Tie F & Fang M (2013). Drosophila UTX coordinates with p53 to regulate ku80 expression in response to DNA damage. PloS ONE 8, e78652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Zhang Y, Guo X, Yan W, Chen Y, Ke M, Cheng C, Zhu X, Xue W, Zhou Q, Zheng L, Wang S, Wu B, Liu X, Ma L, Huang L & Huang K. (2017). ANGPTL8 negatively regulates NF‐kappaB activation by facilitating selective autophagic degradation of IKKgamma. Nat Commun 8, 2164. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Physiology are provided here courtesy of The Physiological Society

RESOURCES