Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Mar 15.
Published in final edited form as: Cancer Res. 2018 Dec 28;79(6):1054–1068. doi: 10.1158/0008-5472.CAN-18-1255

Activation of Estrogen Receptor Alpha by Decitabine Inhibits Osteosarcoma Growth and Metastasis

Maria Angeles Lillo Osuna 1, Jesus Garcia-Lopez 2, Ikbale El Ayachi 3, Iram Fatima 3, Aysha B Khalid 1, Jerusha Kumpati 1, Alexandria V Slayden 1, Tiffany N Seagroves 4, Gustavo A Miranda-Carboni 3,†, Susan A Krum 1,†,*
PMCID: PMC6420872  NIHMSID: NIHMS1516894  PMID: 30593524

Abstract

Osteosarcoma is a malignant tumor in the bone that originates from normal osteoblasts or osteoblast precursors. Normal osteoblasts express estrogen receptor alpha (ERα); however, osteosarcomas do not due to promoter DNA methylation. Here we show that treatment of 143B osteosarcoma cells with Decitabine (DAC, 5-Aza-2’-deoxycytidine) induces expression of ERα and leads to decreased proliferation and concurrent induction of osteoblast differentiation. DAC exposure reduced protein expression of metastasis-associated markers VIMENTIN, SLUG, ZEB1, and MMP9, with a concurrent decrease in mRNA expression of known stem cell markers SOX2, OCT4, and NANOG. Treatment with 17β-estradiol (E2) synergized with DAC to reduce proliferation. Overexpression of ERα inhibited proliferation and induced osteoblast differentiation, whereas knockout of ERα by CRISPR/Cas9 prevented the effects of DAC. In an orthotopic model of osteosarcoma, DAC inhibited tumor growth and metastasis of 143B cells injected into the tibia of NOD scid gamma (NSG) mice. Furthermore, ERα overexpression reduced tumor growth and metastasis, and ERα knockout prevented the effects of DAC in vivo. Together, these experiments provide pre-clinical evidence that the FDA-approved DNA methylation inhibitor DAC may be repurposed to treat osteosarcoma patients based on its efficacy to decrease proliferation, to induce osteoblast differentiation, and to reduce metastasis to visceral organs.

Keywords: Osteosarcoma, estrogen receptor, DNA methylation, 5-Aza-2’-deoxycytidine

Precis

Findings describe the effects of DNA methyltransferase inhibition on ERα and its potential role as a tumor suppressor in osteosarcoma

Introduction

Osteosarcoma is the most common primary malignant tumor in the bone (1). The 5-year survival rate for localized tumors is 69%, but with a metastasis diagnosis, the five-year survival rate is only 15–30% (2–5). It is thought that sex hormones play a role in the etiology of the disease, as more boys than girls get osteosarcoma and the cancer develops at the time of puberty.

Estrogens directly regulate bone mineral density and osteoblast differentiation, acting via a variety of mechanisms and cell types (6). Estrogens bind to either estrogen receptor alpha (ERα) or estrogen receptor beta (ERβ) leading to transcriptional activation and non-genomic effects (7). The effects of estrogens are both pro-osteoblastic and anti-osteoclastic, leading to maintenance of bone. Estrogens induce the transcription of osteoblast differentiation genes, such as alkaline phosphatase and BMP2 (7). Normal osteoblasts express estrogen receptor alpha (ERα) and osteosarcomas originate form osteoblasts and/or mesenchymal stem cells (8,9); however, a 2008 study demonstrated that 0 out of 28 osteosarcoma tumors showed detectable expression of ERα by immunohistochemistry (10).

Epigenetic changes are frequently present in cancer (11). Tumor suppressor genes, such as p15 and p27, are commonly silenced due to promoter methylation (12,13). Methylation of DNA is catalyzed by the enzyme DNA methyltransferase (DNMT) which adds a methyl group to the carbon 5 position of the cytosine ring in CpG islands, leading to heterochromatin and inhibition of gene expression (14). In osteosarcomas, similar than in other human malignancies, there is evidence of genome-wide changes in DNA methylation. In one study, 1379 promoter regions were hyper-methylated and under-expressed in osteosarcomas in comparison with normal human osteoblasts (15). The estrogen receptor alpha (ESR1) promoter has been previously shown to be epigenetically silenced (methylated) in a variety of human cancers (16,17).

In contrast to mutations, methylation is reversible by DNMT inhibitors. The DNMT inhibitor Decitabine (DAC, 5-Aza-2’-deoxycytidine), which is approved by the US Food and Drug Administration (FDA) (18), demonstrates promising effects in acute myeloid leukemia (AML) and myelodysplasia (19). However, the efficacy of DNMT inhibitors in solid tumors remains unclear (20).

In this study ESR1 expression and the presence of DNA methylation in its promoter region were evaluated in osteosarcoma. The DNMT inhibitor DAC was used in vitro and in vivo and was shown to induce ESR1 re-expression in osteosarcoma. Overall, ERα is both necessary and sufficient to inhibit both proliferation and metastasis, with a concurrent increase in the differentiation of osteosarcoma cells.

MATERIALS AND METHODS

Reagents and antibodies

Dimethyl Sulfoxide (DMSO) was purchased from ThermoFisher Scientific (Pittsburgh, PA, USA). 5-Aza-2’-Deoxycytidine (DAC), 17β-estradiol (E2), doxorubicin and doxycycline (DOX) were purchased from Sigma-Aldrich (St. Louis, MO, USA). ICI 182,780 (fulvestrant) was purchased from Tocris Bioscience (Bristol, UK). Antibodies to β-Actin (8H10D10), PCNA (PC10), Vimentin (D21H3), Slug (C19G7) and Snail (SN9H2) were purchased from Cell Signaling Technology (Danvers, MA, USA). Antibodies to ERα (HC-20) and Zeb1 (E-20) were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). The antibody to ERα was purchased from NeoMarkers (Ab-16) (Fremont, CA, USA). The antibody to DNMT3A (aa457–486) was purchased from LifeSpan BioSciences Inc. (Seattle, WA, USA). The antibodies to human mitochondria (113–1) and MMP9 were purchased from Abcam (Cambridge, MA, USA). The antibody to alkaline phosphatase was deposited to the Developmental Studies Hybridoma Bank (DSHB) by Katzmann, J.A. (DSHB Hybridoma Product B4–78). Horseradish peroxidase-conjugated anti-rabbit and anti-mouse antibodies and rabbit anti-mouse IgG-Alexa Fluor 647 antibodies were purchased from ThermoFisher Scientific (Waltham, MA, USA). Goat anti-rabbit IgG-Alexa Fluor 488 was purchased from Life Technologies.

Plasmids

pHIV-eIF1A-Luciferase (Luc)-IRES-Puro vector was obtained from Dr. Tiffany Seagroves (UTHSC), which is based on the pHIV backbone available at Addgene (#21375). pEGFP-N1 was purchased from Clontech, pcDNA3-ERα was obtained from Dr. Myles Brown and pEGFP-C1-ER alpha was purchased from Addgene (#28230).

Four different gRNA sequences were designed to target ESR1: gRNA1: F, CACCGGCGTCGATTATCTGAATTT, R, AAACAAATTCAGATAATCGACGCC; gRNA3: F, CACCCTCCGTAAATGCTACGAAGT, R, AAACACTTCGTAGCATTTACGGAG; gRNA5: F, CACCGGGTCTGAGGCTGCGGCGTT, R, AAACAACGCCGCAGCCTCAGACCC; gRNA6: F, CACCGCCTACGAGTTCAACGCCG; R, AAACCGGCGTTGAACTCGTAGGC. Each gRNA was cloned into an all-in-one pU6-sgRNA-CAS9-P2A-GFP plasmid, which was modified from pX330 (Addgene #42230). All plasmids were sequenced to confirm successful ligation.

Cell culture, proliferation assays and Alkaline Phosphatase

143B, U2OS and MG63 human osteosarcoma cell lines were obtained from ATCC (Manassas, VA, USA) and grown according the ATCC recommendations. The cell lines were verified each year by STR profiling and mycoplasma testing. Media was supplemented with vehicle control (DMSO) (1 μL/mL) or DAC (1 μL/mL) to a final concentration of 2.5 μM for 143B cells and 10 μM for U2OS and MG63 cells. On day 5, cells were counted in a hemocytometer and RNA, DNA and protein were obtained from these cultures or cells were fixed with 3.7% formaldehyde (ThermoFisher) and stained for alkaline phosphatase substrate (Sigma-Aldrich). In addition, Sensolyte pNPP Alkaline Phosphatase assay kit (AnaSpec, Fremont, CA) was used for AP quantification. Treatments were performed in triplicate. For longer cultures, media was refreshed every 3 days. To determine the effect of 17β-estradiol (E2) in cultures, the experiments were performed in DMEM media without phenol red (Corning) and supplemented with 10% charcoal dextran-treated fetal bovine serum (CDT-FBS) (Omega Scientific, Tarzana, CA, USA) (Supplementary Figure 1). EtOH (control), E2, fulvestrant or E2+fulvestrant was added for 72 hours. RNAs were obtained from these cultures. For longer cultures media was refreshed every 3 days. Proliferation was determined using the IncuCyte S3 live cell imager and expressed as percent phase confluence (Essen Bioscience, Ann Arbor, MI, USA).

U2OS-ERα cells, kindly provided by Dr. Thomas Spelsberg, were maintained in DMEM/F-12 media (Corning Mediatech, Inc., Manassas, VA, USA) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine and penicillin-streptomycin (Corning, Mediatech, Inc.) plus Blasticidin (5 μg/mL) and Zeocin (0.2 mg/mL) (Invitrogen). ERα expression in U2OS-ERα cells was induced by treatment with 100 ng/mL doxycycline (DOX).

Primary human osteoblasts were isolated from the femoral heads of patients undergoing total hip replacement surgery after informed written consent under a protocol approved by University of Tennessee Health Science Center Institutional Review Board in accordance with recognized ethical guidelines (e.g., Declaration of Helsinki, CIOMS, Belmont Report, U.S. Common Rule).

RNA and Quantitative PCR (qPCR)

Total cellular RNA was extracted from cells with TRIzol Reagent (Invitrogen). Each RNA sample was collected in biological triplicates and each qPCR reaction was amplified in triplicate. Total RNA was converted to cDNA with Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) according to the manufacturer’s instructions. cDNA was subjected to quantitative PCR using the Maxima SYBR Green qPCR Master Mix with ROX (ThermoFisher Scientific). Gene expression levels were compared after normalization to endogenous β-actin (Actb). Primers were selected using Primer-BLAST (21) and the sequences are: Actb: F, GGACTTCGAGCAAGAGATGG, R, AGCACTGTGTTGGCGTACAG; ESR1: F, GAATCTGCCAAGGAGACTCGC, R, ACTGGTTGGTGGCTGGACAC; NANOG: F, CAAAGGCAAACAACCCACTT, R, TCTGCTGGAGGCTGAGGTAT; OCT-4: F, GGGCTCACCCTGGGGGTTCT, R, CTGCTGGGCGATGTGGCTGA; SOX2: F, GGGGAAAGTAGTTTGCTGCC, R, CGCCGCCGATGATTGTTATT; ALPL: F, CCACGTCTTCACATTTGGTG, R, AGACTGCGCCTGGTAGTTGT; BSP: F, TGAAACGAGTCAGCTGGATG, R, TGAAATTCATGGCTGTGGAA; OSX: F, ACTTTGGATGCTCCCATCTCCACCT, R, AGGGCATGATCCCTTCCATTCCACA; OMD: F, CAAACAGGATTCCCATTTCGTCA, R, GTTGCTGAATGTGCATCGGAAT; VIMENTIN: F, ATGAAAGTGTGGCTGCCAAGAACC, R, TCTCTTCCATTTCACGCATCTGGC; MMP9: F, GAGACCGGTGAGCTGGATAG, R, TACACGCGAGTGAAGGTGA; SLUG: F, TTTCTGGGCTGGCCAAACATAAGC, R, AATGTGTCCTTGAAGCAACCAGGG; ZEB1: F, ATGCACAACCAAGTGCAGAAGAGC, R, AGGCTGATCATTGTTCTTGGCAGG; SNAIL: F, ACTGCAACAAGGAATACCTCAGCC, R, TTCTTGACATCTGAGTGGGTCTGG Actb promoter: F, CAGTGCCTAGGTCACCCACT, R, AGAAGTCGCAGGACCACACT; Hbb promoter: F, TGGTATGGGGCCAAGAGATA, R, TAGATGGCTCTGCCCTGACT; ESR1 promoter: F, TGGTTTTCTTTCTTTCCCATGCCAGT, R, TGGGGCGGAGGCAGGATCTC.

RNA sequencing analysis, methylation and ChIP-sequencing

Gene expression data from osteosarcoma patient derived xenografts (PDX) are available from the Childhood Solid Tumor Network (22). DNA methylation data from osteosarcoma PDX tumors are available from GEO (Series GSE58770). Gene expression data from breast cancer cell lines are available from GEO (Series GSE73526). ChIP sequencing data for H3K4me2 and H3K9me3 in U2OS cells compared with osteoblasts are available on the UCSC Genome Browser.

Immunoblot Analysis

Protein extracts were prepared by homogenizing cells on ice in RIPA buffer containing protease inhibitors. Protein concentrations were measured using the Bradford method. Immunoblots were performed with standard protocol.

Chromatin immunoprecipitation (ChIP)

Cells were grown in 150 mm diameter plates. ChIP was performed as described (23,24). Each ChIP was performed with triplicate biological replicates. DNA was normalized to percent input and the Actb promoter.

DNA extraction, methylation specific PCR and promoter methylation mapping

Total cellular DNA was extracted from cells by using DNeasy Blood & Tissue Kit (Qiagen Sciences, Maryland, USA) following the manufacturer’s recommendations. Each DNA sample was collected in triplicate. EpiMark Bisulfite Conversion Kit (New England Biolabs, Inc., Ipswich, MA, USA) was used following the manufacturer’s recommendations.

For PCR amplification of the methylated and un-methylated ESR1 promoter, PCR was performed on the bisulfite converted DNA with the following primers: methylated ESR1: F, CGAGTTGGAGTTTTTGAATCGTTC, R, CTACGCGTTAACGACGACCG and un-methylated ESR1: F, ATGAGTTGGAGTTTTTGAATTGTTT, R, ATAAACCTACACATTAACAACAACCA (25). PCR was performed with a denaturation step at 95°C for 15 min, followed by 35 cycles of denaturation at 95°C for 30 s., primer annealing at 57°C for 30 s., and primer extension at 72°C for 30 s. Upon completion of the cycling steps, products were subjected to a final extension at 72°C for 5 minutes, the reaction was stored at 4°C and then analyzed by agarose gel electrophoresis or cloned into pCRII with the TOPO-TA Cloning Kit (Life Technologies). Individual clones were sequenced with the T7 promoter primer. The data were analyzed with BISMA (26).

Apoptosis analysis

143B cells were plated in an 8-well chamber slide well on day 1. On day 2 the media was supplemented with vehicle control (DMSO), DAC or doxorubicin (1 μM). On day five, cells were fixed with 4% PFA for 1 hour at room temperature, washed with PBS, and permeabilized with freshly prepared 0.1% Triton X-100 and 0.1% sodium citrate for 2 minutes on ice. Apoptosis was detected by the In Situ Cell Death Detection Kit, Fluorescein (Roche Applied Sciences, Indianapolis, IN, USA) according to the manufacturer’s instructions. Afterwards, cells were washed in PBS and coverslips were mounted onto slides with mounting medium for fluorescence with DAPI (Vector Laboratories Inc., Burlingame, CA, USA). Cells were imaged using a fluorescence EVOS FL Auto (Life Technology) microscope.

Transfection

One day before transfection, cells were plated at constant density of 5 × 104 cells/well in 24 well-plates. Transfection with Lipofectamine 3000 (ThermoFisher Scientific) was performed according to the manufacturer’s instructions. DNA plasmids were added at a final concentration of 0.12 μg DNA/well. Forty-eight hours post-transfection cells were harvested for RNA or protein extraction, sorted, or plated for a proliferation assay using the IncuCyte S3 system (Essen Bioscience, Ann Arbor, MI, USA). In the case of 143B-Luciferase transfected cells, growth media was supplemented with 2.12 μM puromycin to produce a 143B-derived stable cell line expressing luciferase (143BLuc) used for tumor xenografts.

In order to obtain a 143BLuc ESR1 knock-out (143BLuc-ERαKO) stable cell line, 143BLuc cells were transfected with four pU6-sgRNA-CAS9-P2A-GFP plasmids, each one with a different ESR1 gRNA sequence. GFP+ single cells were sorted into a 96 well plate and clones were analyzed.

Cell Sorting

Cells were re-suspended in pre-sorting buffer (PBS 1X, 1 mM EDTA, 25 mM HEPES, 1% FBS), filtered with 40 μM filter and stored at 4°C before being sorted using a BD FACSAria IIu cell sorter (BD Biosciences, San Jose, CA), operated by BD FACSViva Software version 8.

Immunofluorescence

Cells were fixed with 4% PFA (30 minutes on ice), blocked with 10% goat serum (1 hour at room temperature), stained with primary antibody (overnight at 4°C), followed by incubation with secondary antibody (1:250) and then mounted with mounting media with DAPI (Vector Laboratories, Inc.). Images were acquired with an EVOS FL Auto (Life Technology) microscope.

Tumorsphere Assays

To establish tumorspheres, 143B and U2OS cells pretreated during 72 hours with vehicle control (DMSO) or DAC and U2OS-ERα cells with or without DOX, were seeded onto ultralow attachment plates at a density of 5 × 104 cells/mL and cultured in defined sphere medium [phenol-red free DMEM (Corning) supplemented with B27 (Invitrogen), 20 ng/mL EGF, 20 ng/mL bFGF (BD Biosciences, San Jose, CA, USA), and 4 μg/mL heparin (Sigma-Aldrich)]. On days 1 and 5 the spheres were treated with either vehicle control (DMSO) or DAC and with or without DOX in U2OS-ERα cultures. All treatments were performed in triplicate. Spheres were imaged on day 7 of treatments using an EVOS FL Auto (Life Technology) microscope. RNA was then obtained from these cultures.

To generate secondary spheres, primary spheres from an entire well were collected, dissociated enzymatically with 1:1 dilution of [media : 0.05% trypsin (Invitrogen)] for 10 minutes at 37ºC, dissociated mechanically into single-cell suspensions by pipetting 10 times with a p200 tip, filtered using a cell strainer mesh (40 μM) and re-plated in a ultra-low attachment plate, with no additional treatments. The entire well containing secondary spheres was imaged on day 7 using an EVOS FL Auto (Life Technology) microscope.

Soft agar colony formation assay

143B cells were pretreated during 72 hours with vehicle control (DMSO) or DAC (2.5 μM). Cells were trypsinized, quantified and plated 12.5 × 102 cells/4 cm2 (1 well from a 12 well plate) in 0.65 mL (0.325 mL 0.6% agar + 0.325 mL media 2X enriched with DMSO or DAC) over a feeder layer of 0.65 mL (0.325 mL 1% agar + 0.325 mL media 2X enriched with DMSO or DAC). Cultures were incubated at 37ºC for 21 days in a humidified incubator supplied with 5% CO2, and 0.1 mL of medium was added twice weekly to prevent desiccation. Colonies were stained with 0.1 mL sterile MTT dye (5 mg/mL) (St. Louis, MO, USA) per well overnight at 37ºC. Once colonies were stained, photographs were taken with an EVOS FL Auto microscope and colonies counted. Treatments were performed in triplicate.

Scratch assay

Cells were plated on day 1 (5 × 104 143B cells/mL or 10 × 104 U2OS-ERα cells/mL). On day 2 the media was supplemented with vehicle control (DMSO) or DAC (and with DOX in U2OS-ERα cultures). On day 5, the cell monolayer was scraped in a straight line to create a “scratch” with a p200 pipet tip. Debris was removed with PBS washes and growth medium supplemented with vehicle control (DMSO) or DAC (and with DOX in U2OS-ERα cultures) was replaced. The first image was acquired immediately with an EVOS FL Auto microscope and then the plate was placed in a tissue culture incubator at 37ºC. Images were taken every hour until the scratch disappeared in control wells. Three independent experiments were carried out in triplicate. Images were further analyzed quantitatively by using ImageJ software.

Tumor Xenografts

Animal experiments were approved by the Institutional Animal Care and Use Committee at the University of Tennessee Health Science Center. Animals were maintained in a specific pathogen free environment at 20–26 °C with a relative humidity of 30–70% and a 12 hour light/dark cycle. Commercial rodent chow (LM-485, Teklad, Madison, WI) and drinking water were available ad libitum.

2 × 105 143B-Luc (luciferase), 143BLuc, 143BLuc-ERα or 143BLuc-ERαKO cells in 10 μL media were mixed with 10 μL phenol-red free Matrigel (Corning) and injected into the right tibia of each adult male NOD scid gamma (NSG) mouse, while the mice were under isoflurane anesthesia. For DAC assays, one week after injections the animals were randomized into two treatment groups: control (PBS) or DAC, provided by intraperitoneal injections (IP) (0.1 mL total volume/injection) every other day for the duration of the treatment period. The dose of DAC (1 mg/kg) was set to the previously determined maximum tolerated dose (MTD) in mice based on absence of gross toxicity or lethality (27).

Weekly, mice were monitored with a Perkin-Elmer IVIS Lumina imaging system. Ten minutes before imaging, mice were injected IP with XenoLight D-Luciferin potassium salt (PerkinElmer, Waltham, MA). Mice were anesthetized with isoflurane/oxygen and placed on the imaging stage in a dorsal position. Leg and whole-body images were collected between 1 to 60 seconds. Bio-imaging counts from pulmonary and liver metastases were converted to total flux (photons/s) using Living Image software. Mice were sacrificed when walking difficulties were observed in mice in the control group. After fixation, legs, lungs and livers were harvested and fixed in 10% formalin (ThermoFisher Scientific). Prior to histology, legs were decalcified with DecalStat (StatLab, Mckinney, TX, USA).

Immunohistochemistry

Legs, lungs and livers were paraffin-embedded and serial sections were obtained. The slides were processed through standard deparaffinization protocols and the samples were then incubated in blocking buffer (5% normal goat serum, 2.5% BSA in PBS at pH 7.5) for 30 minutes. Primary antibodies were incubated overnight at 4°C in a humidified chamber followed by staining with the DAKO Envision + visualization system and counterstaining with hematoxylin. Whole slide images were acquired with a XT Aperio Scanscope Digitizer and analyzed with ImageScope software (Leica Biosystems). Higher power images representative of different areas within the samples were captured with an EVOS FL Auto (Life Technology) microscope. Images were analyzed quantitatively using ImageJ software.

Statistical Analysis

Unless otherwise specified, all data were expressed as the mean plus or minus the standard error of the mean. For in vitro assays, significance was tested by a two-tailed unpaired t-test (*p <0.05; **p <0.001; ***p <0.0001), and for tumors, a two-tailed Mann-Whitney test was performed (*p <0.05; **p <0.001; ***p <0.0001); all data were analyzed in Prism software (GraphPad, San Diego, CA).

RESULTS

Osteosarcoma tumors do not express ERα (ESR1)

ERα was previously reported to not be expressed in osteosarcomas by immunohistochemistry (10). We wanted to verify and to expand these data by mining publicly available expression datasets. Microarray data were analyzed from 11 osteosarcoma samples and 19 cell lines (Supplementary Figure 2) and show no expression of ERα. RNA-sequencing data from 18 osteosarcoma PDX tumors were also compared to two ER+ breast cancer cell lines (MCF-7 and MDA-MB-415) and two ER- cell lines (HCC1599 and MDA-MD-231). None of the human osteosarcoma PDX samples (OS) expressed ESR1 (Figure 1A).

Figure 1. Estrogen receptor alpha is not expressed in osteosarcomas due to promoter methylation.

Figure 1.

Levels of ESR1 (ERα) gene expression was analyzed in (A) 2 ER+ breast cancer cell lines and 2 ER- breast cancer cell lines and compared with 18 human PDX osteosarcoma samples by RNA sequencing. (B) ESR1 cDNA levels were obtained by qPCR from normal human osteoblasts compared with the human osteosarcoma cell lines 143B, U2OS and MG63 (***p<0.0001). (C) ERα protein expression was analyzed by immunoblotting in 143B, U2OS and MG63 osteosarcoma cell lines; MCF7 breast cancer cells were used as a positive control. β-Actin is shown for normalization. (D) ESR1 methylation was compared in human PDX osteosarcomas (n=21) versus normal human osteoblasts (n=3). Human osteosarcoma samples from OS01 to OS07 correlate with samples OS01-OS07 in (A). (E) Methylation-specific PCR at the promoter region of the ESR1 gene was performed with bisulfite-treated DNA from MCF7, 143B, U2OS and MG63 cells. (F) Similar reactions as in (E) were analyzed by quantitative PCR. (G) ChIP was performed in human cell lines 143B and U2OS using an antibody to DNMT3A with primers designed to the ESR1 promoter, Hbb (negative control) or β-Actin (Actb, for normalization). **p=0.0038, *p=0.0126.

By qPCR we confirm that ESR1 mRNA was not expressed in three human osteosarcoma cell lines (143B, U2OS and MG63), and it was expressed in normal human osteoblasts (Figure 1B), as expected. Moreover, ERα protein was not detected in the osteosarcoma cell lines (Figure 1C), with MCF7 cells serving as the positive control.

ESR1 is methylated in osteosarcoma

Genes can be silenced by many mechanisms, including DNA methylation. To analyze ESR1 promoter methylation, osteosarcoma PDX data were analyzed from GEO Series GSE58770 methylation arrays (28). The ESR1 promoter was not methylated in normal human osteoblasts (hOB1–3, Figure 1D). However, in 19 of 21 osteosarcoma PDX lines, the ESR1 promoter was methylated (Figure 1D).

To determine if the ESR1 promoter was methylated in osteosarcoma cell lines, methylation-specific PCR was performed on bisulfite-treated DNAs isolated from MCF7, 143B, U2OS and MG63 cells using primers to the methylated and un-methylated ESR1 promoter. MCF7 cells (an ER+ breast cancer cell line) strongly express ERα, and served as a negative control for ESR1 methylation (Figure 1E). ESR1 promoter was completely methylated in 143B cells, demonstrating that ESR1 gene silencing was associated with DNA methylation. ESR1 promoter was partially methylated in U2OS and MG63 cell lines (Figure 1F).

ChIP was performed in human osteosarcoma cell lines (143B and U2OS) with an antibody to DNMT3A, an enzyme that catalyzes DNA methylation (transfer of methyl groups to specific CpG sequences in DNA). DNMT3A was enriched at the ESR1 promoter in both osteosarcoma cell lines relative to the ACTB (β-Actin) promoter (normalization control) and hemoglobin (Hbb) promoter (negative control) (Figure 1G), suggesting that DNMT3A is responsible for ESR1 promoter methylation.

Further analysis of publicly available data shows epigenetic marks associated with gene repression at the ESR1 promoters. ChIP-sequencing data in U2OS cells compared with normal osteoblasts demonstrate that along the ESR1 promoters the chromatin is open in osteoblasts, as marked by histone 3 lysine 4 dimethylation (H3K4me2) and a lack of histone 3 lysine 9 trimethylation (H3K9me3), and closed in U2OS cells, as marked by H3K9me3 (Supplementary Figure 2).

Treatment with an FDA-approved methylation inhibitor (DAC) re-expresses ERα, decreases proliferation and induces differentiation in osteosarcoma cells

In order to determine if inhibition of DNA methylation would be sufficient to re-express ESR1, the DNA methylation inhibitor 5-Aza-2’-Deoxycytidine (DAC) was used in 143B cells. After 72 hours of treatment, ESR1 promoter methylation sites were analyzed by bisulfite sequencing. 143B cells treated with DAC had 66.6%−82.4% un-methylated CpGs compared with 94.4% to 100% methylation of CpGs in 143B cells treated with DMSO (Figure 2A). In addition, un-methylated ESR1 promoter DNA could be detected by methylation-specific PCR after DAC treatment (Figure 2B). This partial reversal of ESR1 promoter methylation was sufficient to induce ESR1 mRNA and protein expression levels as shown by immunofluorescence (Figure 2C-D). DAC treatment also significantly reduced 143B proliferation (Figure 2E), without inducing apoptosis, detected by TUNEL staining (Figure 2F-G).

Figure 2. DAC inhibits proliferation and induces differentiation of 143B cells.

Figure 2.

143B cells were treated with DMSO or DAC (2.5 μM) for 72 hours. (A) Detailed mapping of ESR1 methylation sites in bisulfite-treated DNAs from 143B cells treated with DMSO or DAC (n=4). Bisulfite-treated DNA was cloned and multiple clones (n=4) were sequenced. (B) Methylation at the promoter region of the ESR1 gene in untreated MCF7 cells (control) and in 143B cells before and after treatment was analyzed. Bisulfite-treated DNAs were amplified with gene-specific primers by PCR for unmethylated-ESR1 and methylated-ESR1. Treatment with DAC led to re-expression of ERα as determined by (C) quantitative PCR for ESR1 mRNA (***p<0.0001) and by (D) immunofluorescence for ERα protein. Magnification bar = 100 μm. (E) Growth inhibition was assayed by quantifying the cells with or without DAC (**p=0.0012) and (F) apoptosis was analyzed by TUNEL assay; cells treated with Doxorubicin (DOX) (1 μM) served as a positive control for apoptosis. Magnification bar = 200 μm. Multiple images were quantified in (G). Treatment with DAC re-expressed Alkaline Phosphatase: Expression of (H) ALPL mRNA by qPCR (***p<0.0001) and AP protein by (I) staining with an alkaline phosphatase substrate (magnification bar = 1000 μm) and (J) using the Sensolyte pNPP Alkaline Phosphatase Assay kit (*p=0.0197). (K) Expression of osteogenic differentiation genes: ESR1, ALPL, BSP, OSX and OMD were analyzed by qPCR (***p<0.0001, **p=0.0015) on cDNA converted from RNA isolated from 143B cells treated with DAC for 3 or 6 days.

We next tested if DAC treatment and the concomitant increase in ERα would promote 143B osteogenic differentiation, a multistep process that ends with bone mineralization. Alkaline Phosphatase (AP; ALPL) is an early gene marker of osteoblastogenesis. DAC treatment significantly increased ALPL mRNA levels by 5-fold in 143B cells (Figure 2H), compared to vehicle (DMSO)-treated cells, after three days of treatment. AP protein activity was not detected in 143B cells treated with DMSO (control), but, significant AP protein activity was observed in DAC-treated 143B cells (Figure 2I-J). 143B cells treated with DAC for 6 days began to express the osteogenic differentiation markers bone sialoprotein (BSP/Osteopontin/Spp1), Osterix (OSX) and Osteomodulin (OMD) (Figure 2K). However, terminal differentiation (mineralization) was not observed in 143B cells treated with DAC for up to 21 days when the cells became unattached.

Even though the ESR1 promoter was partially methylated in U2OS and MG63 cell lines, inhibition of DNA methylation using DAC (10 μM) was sufficient to reduce methylated ESR1 promoter DNA (detected by methylation-specific PCR), to re-express ESR1 expression, to decrease cell proliferation and to increase osteogenic differentiation markers in both U2OS (Supplementary Figure 3) and MG63 (Supplementary Figure 4) osteosarcoma cell lines, as observed in 143B cells.

ERα is sufficient to induce differentiation and to decrease proliferation in osteosarcoma cells

Alkaline phosphatase is a direct ERα target gene in mouse calvarial osteoblasts (29). Over-expression of ERα (Figure 3A-B) induced expression of alkaline phosphatase in both 143B cells (Figure 3C-D) and U2OS cells (Supplementary Figure 5). Osteomodulin (Figure 3E and Supplementary Figure 5) and BSP (Supplementary Figure 5) are also induced by ERα over-expression. Moreover, over-expression of ERα decreased proliferation in both 143B cells (Figure 3F) and U2OS cells (Supplementary Figure 5). Therefore, re-expression of ERα is sufficient to induce osteoblast differentiation of osteosarcoma cells.

Figure 3. ERα is sufficient for osteosarcoma differentiation.

Figure 3.

Cells were transfected with either an empty plasmid (control) or a plasmid expressing the ESR1 coding sequence for 48 hours. (A) ESR1 expression in transfected cells was analyzed by qPCR (***p<0.0001) and by (B) immunoblot, using protein from MCF7 cells as a positive control. β-Actin is shown for normalization. Expression of osteogenic differentiation genes was analyzed in transfected cells: Alkaline phosphatase by (C) qPCR (***p=0.0005) and by (D) staining with an alkaline phosphatase substrate (Magnification bar = 200 μm) and (E) Osteomodulin (OMD) by qPCR (***p=0.0006). (F) Growth of 143B-Control and 143B-ERα transfected cells was measured as percent phase confluence in real time using an IncuCyte FLR, recording data every 12 hours (**p=0.0027). (G) 143B cells were cultured with phenol red-free medium with CDT serum supplemented with DMSO or DAC plus vehicle control (0.1% EtOH), or E2 (10 nM) or E2 (10 nM) + fulvestrant (1 μM). Cell growth was measured in real time on an IncuCyte FLR (***p=0.0004; n=6/treatment). The expression of (H) ESR1 (***p<0.0001) and (I) ALPL (***p=0.0003) mRNA at 72 hours post-treatment with DAC was analyzed by qPCR.

E2 further induces DAC-mediated differentiation and decreases proliferation of osteosarcoma cells

To demonstrate that the re-expressed ERα in 143B cells by DAC is functional, cells were cultured in phenol free media/charcoal-stripped serum and treated with DAC in the presence or absence of 17-β-estradiol (E2) and/or the ERα antagonist fulvestrant, and proliferation was analyzed. While E2 and/or fulvestrant had no effect on the proliferation of 143B cells treated with DMSO (Figure 3G), E2 further decreased the proliferation of 143B cells treated with DAC (Figure 3G). Moreover, fulvestrant treatment inhibited the E2-induced decrease in proliferation observed in DAC-treated cells (Figure 3G). Whereas E2 had no effect on ESR1 or ALPL expression in 143B cells treated with DMSO (Figure 3H-I), in 143B cells treated with DAC, E2 decreased ESR1 expression (Figure 3H), as expected, based on the known ERα transcriptional activation cycle (30), and further increased ALPL expression (Figure 3I). Fulvestrant also inhibited the E2-induced increases in ALPL mRNA (Figure 3I).

DAC suppresses metastasis-associated characteristics in vitro

Cell motility is a cellular characteristic necessary for metastasis (31). To test whether DAC could alter metastasis-associated phenotypes, wound healing assays were performed in vitro. DAC treatment significantly decreased the motility of 143B cells since the scratch (wound) was not closed relative to vehicle treated control cells, which had completely migrated across the scratch (Figure 4A) by 14 hours after wound formation.

Figure 4. DAC decreases 143B metastatic properties in vitro.

Figure 4.

(A) 143B cell migration potential was measured by a wound healing assay. 143B cells were seeded and treated with DMSO or DAC. After all cells reached confluence, a scratch was made, and then the cells were incubated with either DMSO- or DAC-enriched media for an additional 14 hours and then imaged. The area of the scratch was measured at times 0 and 14 hours and the data are presented in a bar graph as a percentage of initial scratch area (***p<0.0001). (B) 143B primary and secondary tumorspheres treated with DMSO (control) or DAC for seven days and then imaged. Magnification bar = 1000 μm. (C) RNA was obtained from 143B primary spheres and qPCR was performed for SOX2 (***p<0.0001), OCT4 (**p=0.0066) and NANOG (*p=0.0466). (D) 143B cells were treated with DMSO (control) or DAC and grown on 0.6% Noble agar for 3 weeks. Endpoint colonies were stained with MTT dye and images were taken. Magnification bar = 1000 and 100 μm. Colonies were measured (diameter) and enumerated under a light microscope (***p<0.0001). Metastasis-associated markers were compared in 143B cells treated with DMSO or DAC for one week by (E) qPCR (***p<0.0001, **p=0.0013 and *p=0.0452) and by (F) immunoblotting.

Tumorsphere formation capacity is another cellular characteristic that is associated with metastasis potential (32). We first confirmed that osteosarcoma cells grow as spheres (Supplementary Figure 6). Next, spheres were generated from 143B cells treated with DMSO or DAC. DAC decreased both the number and the size (diameter) of 143B spheres (Figure 4B). Furthermore, 143B spheres treated with DAC were not able to form secondary spheres (Figure 4B). In addition, the expression of the stem cell markers SOX2, OCT4 and NANOG was decreased in spheres treated with DAC in comparison with DMSO-treated spheres (Figure 4C). The ability of 143B cells to grow in suspension, a feature of circulating tumor cells, was also analyzed by the soft agar colony formation assay. Relative to control cultures, there were fewer and significantly smaller colonies observed in DAC-treated cultures (Figure 4D). Together, these data support the conclusion that DAC reduces cell motility, anchorage-independence and sphere formation potential, all features of metastatic cancer cells.

A previous characterization of osteosarcoma cell lines, analyzing tumorigenicity in vivo and colony forming, invasive and migratory abilities in vitro, determined that 143B cells are more aggressive than U2OS and MG63 osteosarcoma cell lines (33). In addition, the 143B cell line is the only model able to metastasize to visceral organs when injected in an orthotopic model (to the leg bones) (34) or subcutaneously in mice (35). 143B cells express higher levels of the metastasis-associated markers vimentin, Zeb1 and Snail (Supplementary Figure 7). Therefore, the expression of metastasis-associated markers was analyzed in 143B cells following treatment for one week with either DMSO or DAC. mRNA and protein levels of Vimentin, MMP9, Slug, Zeb1 and Snail were significantly decreased in 143B cells treated with DAC as compared to cells treated with DMSO (Figure 4E-F). Over-expression of ERα in 143B cells and U2OS cells was sufficient to decrease the expression of vimentin, MMP9 and Zeb1 (Supplementary Figures 5 and 7).

DAC treatment reduces proliferation and induces ERα expression in 143B xenograft tumors

Next, we investigated the effects of DAC therapy in an orthotopic model of osteosarcoma in vivo. 143B cells were selected to form orthotopic tumors in vivo because they metastasize to the lung and liver, as is seen in human osteosarcoma patients. 143B cells were injected into the tibia of NSG mice and were treated with either PBS (control) or DAC every other day. 100% of the injections formed tumors. All of the mice were sacrificed when walking difficulties were observed in the control treatment group, which occurred after three weeks of treatment. Comparisons of end-stage primary tumor volume revealed that tumors from control mice were bigger than tumors treated with DAC (Figure 5A-B). There were 8.9 times more proliferating cells, as marked by PCNA, in control-treated tumors than DAC treated tumors (Figure 5C-D). Moreover, DAC treatment induced expression of ERα in tumor cells (Figure 5E-G). Furthermore, ERα staining did not overlap with the highest proliferating cells, as marked by PCNA (Figure 5G).

Figure 5. ERα expression represses 143B tumor growth in orthotopic tumors.

Figure 5.

143B cells were injected into the right tibia of male NSG mice. One week after tumor cell injections, the animals were randomized into treatment groups: control (PBS) or DAC provided by IP injections every other day. Mice were monitored for tumor size and they were sacrificed 2 weeks later (3 weeks post-injections) when walking difficulties appeared in mice in the control treatment group. At study endpoint, legs were harvested and tumors were (A) photographed (magnification bar = 6 mm) and (B) measured (*p=0.0259) (n=6 tumors per group). (C) Hematoxylin and Eosin (H&E) staining was performed in all the legs that developed tumors. Proliferation in control or DAC tumors was analyzed by PCNA immunohistochemistry. Magnification bar = 1000 μm. (D) PCNA+ areas inside the tumors were quantified (***p=0.0001) (n=3 tumors per group) as a percentage of tumor area that was PCNA+. (E) ERα protein expression was analyzed by immunostaining of tumor cells in the tibia. Magnification bar = 200 μm. (F) ER+ areas in part (E) were quantified (***p<0.0001). (G) A DAC-treated tumor was stained for both ERα and PCNA and the staining areas show little overlap. Arrows indicate the border of ERα and PCNA staining. (H) 143BLuc-Control or 143BLuc-ERα cells were injected into the right tibia of male NSG mice. Mice were monitored for tumor size weekly by luciferase imaging. Representative in vivo images at 4 weeks post-injections are shown. (I) Quantification of luminescence (total flux) from the two groups of mice at different time points after cell injection (**p=0.001, **p=0.03).

Because DAC leads to the demethylation of many genes, we wanted to know if induction of ERα would be sufficient to decrease tumor growth, as suggested by the in vitro decrease in proliferation and increase in differentiation when ERα is over-expressed. 143BLuc cells transfected with a plasmid constitutively expressing ERα or a control plasmid were injected into the tibia of NSG mice. After 4 weeks, the mice with 143BLuc-Control cells had significantly higher luciferase signal (4-fold) than the mice with 143BLuc-ERα cells (Figure 5H-I). As early as 1 week after transfection, tumors with ERα were smaller than the control tumors (Figure 5I).

DAC treatment reduces lung and liver metastasis of 143B xenograft tumors

Throughout the experiment, all mice were monitored for visceral organ metastasis by luciferase-based bio-imaging weekly. High metastatic signal was present in the area of the lungs by week two, when animals in the control group began having trouble walking due to leg tumor burden. Immediately prior to sacrifice, whole body luciferase images were captured, which showed stronger radiance in the control group relative to the DAC group (Figure 6A). Luciferase counts/second (total flux) were graphed in mice treated with or without DAC, which showed that metastatic signal in control mice was significantly increased relative to mice treated with DAC (Figure 6B). In addition to lung metastases, liver metastases were detected ex vivo. In order to enumerate macro-metastases versus micro-metastases in the lungs and livers, immunohistochemistry for a human mitochondria marker was performed using fixed tissue sections, which showed that, while around ~10% of the lung area was filled with metastases in control mice, only a few micro-metastases were observed in the lungs from mice treated with DAC (Figure 6C-D). Similarly, livers from control mice presented with macroscopic metastases, whereas livers from mice treated with DAC revealed only micro-metastases (Figure 6E-F). ERα alone was sufficient to decrease metastasis, as 143BLuc-ERα cells metastasized significantly less than 143BLuc-Control cells (Figure 6G). Based on these results, DAC suppresses proliferation of osteosarcoma cells via ERα, both in vitro and in vivo.

Figure 6. DAC therapy and ERα expression represses 143B tumor metastasis to visceral organs.

Figure 6.

143BLuc cells were injected into the right tibia of NSG mice. One week after injections, the animals were randomized into two treatment groups: control (PBS) or DAC. (A) In vivo images with lower extremities covered with black paper to block light signal were taken from individually imaged mice using the IVIS Lumina. (B) Quantification of luminescence (total flux) from visceral metastases (lung + liver) is shown as the mean with standard deviation for each group of mice (**p=0.0001) (n= 8 mice per group). Lungs and livers were then harvested, fixed and embedded in paraffin. (C) Immunohistochemistry for human mitochondria was performed in lung samples. Whole slide images and images from different areas within the samples were taken (magnification bar = 1000 μm). (D) Human mitochondria-positive areas in the whole tissue were quantified (**p=0.001) (n=3 lungs per group). (E-F) The same procedures described in C-D were used to evaluate liver metastases (*p=0.05) (n=3 liver per group). (G) 143BLuc-Control or 143BLuc-ERα cells were injected into the right tibia of male NSG mice. In vivo images with lower extremities covered with black paper to block light signal from the primary tumor were taken 4 weeks post-injections from the two groups of mice.

ERα is necessary for DAC-induced differentiation and suppression of tumor growth

To determine if ERα is necessary for DAC-mediated effects, CRISPR/CAS9 was used to knockout ERα in 143BLuc cells. 143BLuc cells were transfected with four pU6-sgRNA-CAS9-P2A-GFP plasmids, each one with a different gRNA sequences to target ESR1. Cells were sorted for GFP and one single cell was seeded per well of a 96 well plate in order to get clones. ERα mRNA was confirmed to be knocked out in 143BLuc cells. After DAC treatment, ERα was approximately 3-fold lower in both clones 7 and 9 (Figure 7A). After induction with DAC these clones also had a significant decrease in alkaline phosphatase expression (Figure 7B) and activity (Figure 7C-D). BSP was reduced in clone 7 (but not clone 9, Figure 7E), and OMD (Figure 7F) was reduced in both 143BLuc-ERαKO clones, indicating a defect in osteoblast differentiation in the absence of ERα. (The promoter of BSP is likely methylated, as DNMT3A is enriched at this locus in 143B cells(Figure 7G)). Furthermore, the metastasis-associated genes vimentin, MMP9, Slug and Zeb1 were not reduced by DAC in the absence of ERα (Supplementary Figure 7).

Figure 7. ERα is necessary for DAC-induced osteoblast differentiation of osteosarcomas.

Figure 7.

143BLuc-ERαKO clones obtained from 143BLuc transfection with pU6-sgRNA-CAS9-P2A-GFP plasmids, which contained different gRNA sequences to target ESR1 were treated with DAC (2.5 μM). (A) ESR1 re-expression after DAC treatment was analyzed by qPCR in 143B or 143BLuc-ERαKO clones (***p<0.0001 vs. 143BLuc+DAC). Alkaline Phosphatase expression was analyzed by (B) qPCR (***p<0.0001 vs. 143BLuc+DAC) and AP protein by (C) staining with an alkaline phosphatase substrate. Magnification bar = 400 μm. (D) AP+ areas in part (C) were quantified (**p<0.0075). Expression of osteogenic differentiation genes: (E) BSP and (F) OMD were analyzed by qPCR (***p<0.0001, **p=0.005) on cDNA converted from RNA isolated from 143B cells treated with DAC for 6 days. (G) ChIP was performed in 143B cells using an antibody to DNMT3A with primers designed to the BSP promoter, Hbb (negative control) or β-Actin (Actb, for normalization) (**p=0.0038). (H) 143BLuc and 143BLuc-ERαKO cells were treated with DMSO or DAC for the indicated times. Percent confluence was analyzed in real time using an IncuCyte FLR, recording data every 2 hours (***p<0.001). All time points after the *** are statistically significant for 143BLuc+DAC. (I) 143BLuc and 143BLuc-ERαKO cells were injected in the tibia of NSG mice and treated with DMSO (control) or DAC. Luciferase signal is shown after 3 weeks. (J) Quantification of luminescence from part (I).

Next, the role of ERα was tested in DAC-induced reduction in proliferation. While DAC reduced the proliferation of 143BLuc cells, DAC fails to halt proliferation in 143BLuc-ERαKO cells (Figure 7H).

To determine if ERα is necessary for DAC-induced reduction in tumor size in vivo, 143BLuc-ERαKO cells were injected into the tibia of NSG mice and compared to 143BLuc cells. DAC decreased tumor size in mice injected with 143BLuc cells but not in 143BLuc-ERαKO cells (Figure 7I-J). Together, these data confirm that ERα is necessary and sufficient for DAC-mediated tumor inhibition.

Discussion:

In this study we demonstrate that DAC treatment in vitro and in vivo is able to re-express ERα, which is frequently methylated in osteosarcomas. Furthermore, ERα is necessary and sufficient to induce osteosarcoma cell differentiation and to decrease osteosarcoma proliferation.

Osteosarcoma cells share more characteristics with undifferentiated osteo-progenitors than with differentiated osteoblasts, since osteosarcoma cells present a high proliferative index and fail to differentiate. Furthermore, alkaline phosphatase, an early osteogenic marker, and BSP (Bone sialoprotein/Osteopontin) and osteocalcin (OCN), which are more differentiated osteoblast markers, are not highly expressed in either osteosarcoma cell lines or tumors (36–38). Moreover, there is a correlation between a less differentiated state of the osteosarcoma cells and a worse prognosis, aggressiveness and metastasis capacity (38). We have shown that DAC treatment increases the expression of alkaline phosphatase, BSP, osterix and osteomodulin.

Other laboratories have shown that increased differentiation of osteosarcomas decreases tumor proliferation. MG63 osteosarcoma cells exposed to bone morphogenic proteins (BMPs) and treated with adenovirus expressing Runx2, the “master” osteoblast transcription factor, had reduced tumor proliferation after injection into the tibia (39). The osteogenic marker Alkaline Phosphatase (AP) (40) also shows an inverse correlation with the ability to grow in vitro and to produce tumors in nude mice (41). AP was significantly downregulated in osteosarcoma cell lines with colony-forming ability, one of the in vitro assays for assessing tumor aggressiveness (33). U2OS cells transfected with AP and intravenously inoculated into mice developed fewer lung metastases than control-transfected cells. Moreover, the AP- transfected tumors showed a reduced secretion of MMP-9, an enzyme implicated in metastases (41), suggesting that AP could be a good clinical target in osteosarcoma by reducing malignant potential through concomitantly decreasing proliferation and increasing differentiation. In this prior study, although AP was defined as a suitable target in osteosarcoma, no therapy was suggested to achieve increased AP expression. In contrast, we now show that ERα directly regulates AP and that DAC treatment will increase AP expression and activity in osteosarcoma cells. Genetically modified approaches to induce over-expression of Runx2 or AP is not practical in the clinic, but these studies collectively demonstrate that differentiation is an effective strategy in osteosarcoma.

Silencing of gene expression due to DNA methylation, an epigenetic alteration, has been demonstrated in osteosarcomas compared to normal osteoblasts (42,43). Osteosarcoma is caused by differentiation defects, and it was hypothesized that silenced genes in osteosarcoma could be associated with osteogenic differentiation (38). DAC is able to influence cellular differentiation in embryonic cells by demethylation (44). In addition, DAC treatment facilitates osteogenic differentiation of mesenchymal stem cells (45). It has been demonstrated that DAC treatment significantly up-regulates ALPL expression in a drug resistant osteosarcoma cell line (46). However, ALPL is not methylated in osteosarcoma cell lines (43). These data suggest that DAC has an indirect effect in ALPL expression, by inducing the expression of a methylated gene (ERα) that regulates ALPL.

Many genes are hyper-methylated in osteosarcomas. Kreese et al., published that the most frequently methylated genes in 19 human osteosarcoma cell lines were MEST, NNAT and CXCL5 (43), which are each suggested to have roles in tumorigenesis (47,48). Even though other genes are also hyper-methylated, de-methylation of ERα alone is both necessary and sufficient for DAC’s potent effects on proliferation and differentiation. It is likely that ESR1 was not observed to be methylated in many previous studies where gene methylation was compared (42,43) because those assays profiled a smaller number of methylation sites.

ERα is a well-studied gene that is expressed in many tissues and its signaling is cell type specific. For example, whereas E2 induces proliferation in breast cancer cells, E2 induces differentiation in osteoblasts by inducing expression of Alkaline Phosphatase (29,40), bone sialoprotein (49) and other genes. Herein, we demonstrate that in osteosarcoma, ERα re-expression induces differentiation and decreases proliferation.

Supplementary Material

1

Acknowledgements:

All flow cytometry and flow sorting data were generated in the Flow Cytometry and Cell Sorting core (FCCS) at The University of Tennessee Health Science Center with the assistance of Dr. Terry-Ann Milford. Whole slide images were performed at the Research Histology Core at The University of Tennessee Health Science Center. Additional resources were provided by the Molecular Resource Center at The University of Tennessee Health Science Center.

This work is supported by a St. Baldrick’s Research Grant with generous support from the Sweet Caroline Fund to S.A. Krum. This work was also supported by a grant from the National Cancer Institute (CA138488 to T.N. Seagroves) and intramural support from the West Cancer Center in Memphis, TN (to T.N. Seagroves, G.A. Miranda-Carboni and S.A. Krum).

Footnotes

The authors declare that they have no conflicts of interest.

References:

  • 1.Chou AJ, Geller DS, Gorlick R. Therapy for osteosarcoma: where do we go from here? Paediatr Drugs 2008;10:315–27 [DOI] [PubMed] [Google Scholar]
  • 2.Tang N, Song WX, Luo J, Haydon RC, He TC. Osteosarcoma development and stem cell differentiation. Clin Orthop Relat Res 2008;466:2114–30 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Marina N, Gebhardt M, Teot L, Gorlick R. Biology and therapeutic advances for pediatric osteosarcoma. Oncologist 2004;9:422–41 [DOI] [PubMed] [Google Scholar]
  • 4.Meyers PA, Gorlick R. Osteosarcoma. Pediatr Clin North Am 1997;44:973–89 [DOI] [PubMed] [Google Scholar]
  • 5.Kaste SC, Pratt CB, Cain AM, Jones-Wallace DJ, Rao BN. Metastases detected at the time of diagnosis of primary pediatric extremity osteosarcoma at diagnosis: imaging features. Cancer 1999;86:1602–8 [DOI] [PubMed] [Google Scholar]
  • 6.Krum SA, Brown M. Unraveling estrogen action in osteoporosis. Cell cycle 2008;7:1348–52 [DOI] [PubMed] [Google Scholar]
  • 7.Krum SA. Direct transcriptional targets of sex steroid hormones in bone. J Cell Biochem 2011;112:401–8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Quist T, Jin H, Zhu JF, Smith-Fry K, Capecchi MR, Jones KB. The impact of osteoblastic differentiation on osteosarcomagenesis in the mouse. Oncogene 2015;34:4278–84 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Khalid AB, Krum SA. Estrogen receptors alpha and beta in bone. Bone 2016;87:130–5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Dohi O, Hatori M, Suzuki T, Ono K, Hosaka M, Akahira J, et al. Sex steroid receptors expression and hormone-induced cell proliferation in human osteosarcoma. Cancer Sci 2008;99:518–23 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Jones PA, Baylin SB. The epigenomics of cancer. Cell 2007;128:683–92 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Grubisha MJ, DeFranco DB. Local endocrine, paracrine and redox signaling networks impact estrogen and androgen crosstalk in the prostate cancer microenvironment. Steroids 2013;78:538–41 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Daa T, Kashima K, Kondo Y, Yada N, Suzuki M, Yokoyama S. Aberrant methylation in promoter regions of cyclin-dependent kinase inhibitor genes in adenoid cystic carcinoma of the salivary gland. APMIS 2008;116:21–6 [DOI] [PubMed] [Google Scholar]
  • 14.Herman JG, Baylin SB. Gene silencing in cancer in association with promoter hypermethylation. The New England journal of medicine 2003;349:2042–54 [DOI] [PubMed] [Google Scholar]
  • 15.Xu J, Li D, Cai Z, Zhang Y, Huang Y, Su B, et al. An integrative analysis of DNA methylation in osteosarcoma. J Bone Oncol 2017;9:34–40 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Eads CA, Lord RV, Wickramasinghe K, Long TI, Kurumboor SK, Bernstein L, et al. Epigenetic patterns in the progression of esophageal adenocarcinoma. Cancer research 2001;61:3410–8 [PubMed] [Google Scholar]
  • 17.Carvalho AL, Jeronimo C, Kim MM, Henrique R, Zhang Z, Hoque MO, et al. Evaluation of promoter hypermethylation detection in body fluids as a screening/diagnosis tool for head and neck squamous cell carcinoma. Clinical cancer research : an official journal of the American Association for Cancer Research 2008;14:97–107 [DOI] [PubMed] [Google Scholar]
  • 18.Gore SD, Jones C, Kirkpatrick P. Decitabine. Nat Rev Drug Discov 2006;5:891–2 [DOI] [PubMed] [Google Scholar]
  • 19.Kantarjian H, Issa JP, Rosenfeld CS, Bennett JM, Albitar M, DiPersio J, et al. Decitabine improves patient outcomes in myelodysplastic syndromes: results of a phase III randomized study. Cancer 2006;106:1794–803 [DOI] [PubMed] [Google Scholar]
  • 20.Linnekamp JF, Butter R, Spijker R, Medema JP, van Laarhoven HW. Clinical and biological effects of demethylating agents on solid tumours - A systematic review. Cancer Treat Rev 2017;54:10–23 [DOI] [PubMed] [Google Scholar]
  • 21.Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC bioinformatics 2012;13:134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Stewart E, Federico S, Karlstrom A, Shelat A, Sablauer A, Pappo A, et al. The Childhood Solid Tumor Network: A new resource for the developmental biology and oncology research communities. Developmental biology 2016;411:287–93 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Krum SA, Miranda-Carboni GA, Hauschka PV, Carroll JS, Lane TF, Freedman LP, et al. Estrogen protects bone by inducing Fas ligand in osteoblasts to regulate osteoclast survival. EMBO J 2008;27:535–45 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Miranda-Carboni GA, Guemes M, Bailey S, Anaya E, Corselli M, Peault B, et al. GATA4 regulates estrogen receptor-alpha-mediated osteoblast transcription. Molecular endocrinology 2011;25:1126–36 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lapidus RG, Nass SJ, Butash KA, Parl FF, Weitzman SA, Graff JG, et al. Mapping of ER gene CpG island methylation-specific polymerase chain reaction. Cancer research 1998;58:2515–9 [PubMed] [Google Scholar]
  • 26.Rohde C, Zhang Y, Reinhardt R, Jeltsch A. BISMA--fast and accurate bisulfite sequencing data analysis of individual clones from unique and repetitive sequences. BMC bioinformatics 2010;11:230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lantry LE, Zhang Z, Crist KA, Wang Y, Kelloff GJ, Lubet RA, et al. 5-Aza-2’-deoxycytidine is chemopreventive in a 4-(methyl-nitrosamino)-1-(3-pyridyl)-1-butanone-induced primary mouse lung tumor model. Carcinogenesis 1999;20:343–6 [DOI] [PubMed] [Google Scholar]
  • 28.Moriarity BS, Otto GM, Rahrmann EP, Rathe SK, Wolf NK, Weg MT, et al. A Sleeping Beauty forward genetic screen identifies new genes and pathways driving osteosarcoma development and metastasis. Nature genetics 2015;47:615–24 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Krum SA, Miranda-Carboni GA, Lupien M, Eeckhoute J, Carroll JS, Brown M. Unique ER{alpha} cistromes control cell type-specific gene regulation. Molecular endocrinology 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Read LD, Greene GL, Katzenellenbogen BS. Regulation of estrogen receptor messenger ribonucleic acid and protein levels in human breast cancer cell lines by sex steroid hormones, their antagonists, and growth factors. Molecular endocrinology 1989;3:295–304 [DOI] [PubMed] [Google Scholar]
  • 31.Palmer TD, Ashby WJ, Lewis JD, Zijlstra A. Targeting tumor cell motility to prevent metastasis. Adv Drug Deliv Rev 2011;63:568–81 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ishiguro T, Ohata H, Sato A, Yamawaki K, Enomoto T, Okamoto K. Tumor-derived spheroids: Relevance to cancer stem cells and clinical applications. Cancer Sci 2017;108:283–9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Lauvrak SU, Munthe E, Kresse SH, Stratford EW, Namlos HM, Meza-Zepeda LA, et al. Functional characterisation of osteosarcoma cell lines and identification of mRNAs and miRNAs associated with aggressive cancer phenotypes. British journal of cancer 2013;109:2228–36 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Luu HH, Kang Q, Park JK, Si W, Luo Q, Jiang W, et al. An orthotopic model of human osteosarcoma growth and spontaneous pulmonary metastasis. Clin Exp Metastasis 2005;22:319–29 [DOI] [PubMed] [Google Scholar]
  • 35.Mohseny AB, Machado I, Cai Y, Schaefer KL, Serra M, Hogendoorn PC, et al. Functional characterization of osteosarcoma cell lines provides representative models to study the human disease. Laboratory investigation; a journal of technical methods and pathology 2011;91:1195–205 [DOI] [PubMed] [Google Scholar]
  • 36.Harris SA, Enger RJ, Riggs BL, Spelsberg TC. Development and characterization of a conditionally immortalized human fetal osteoblastic cell line. J Bone Miner Res 1995;10:178–86 [DOI] [PubMed] [Google Scholar]
  • 37.Cheng H, Jiang W, Phillips FM, Haydon RC, Peng Y, Zhou L, et al. Osteogenic activity of the fourteen types of human bone morphogenetic proteins (BMPs). J Bone Joint Surg Am 2003;85-A:1544–52 [DOI] [PubMed] [Google Scholar]
  • 38.Wagner ER, Luther G, Zhu G, Luo Q, Shi Q, Kim SH, et al. Defective osteogenic differentiation in the development of osteosarcoma. Sarcoma 2011;2011:325238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Luo X, Chen J, Song WX, Tang N, Luo J, Deng ZL, et al. Osteogenic BMPs promote tumor growth of human osteosarcomas that harbor differentiation defects. Laboratory investigation; a journal of technical methods and pathology 2008;88:1264–77 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Green TM, Alpaugh ML, Barsky SH, Rappa G, Lorico A. Breast Cancer-Derived Extracellular Vesicles: Characterization and Contribution to the Metastatic Phenotype. Biomed Res Int 2015;2015:634865. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Manara MC, Baldini N, Serra M, Lollini PL, De Giovanni C, Vaccari M, et al. Reversal of malignant phenotype in human osteosarcoma cells transduced with the alkaline phosphatase gene. Bone 2000;26:215–20 [DOI] [PubMed] [Google Scholar]
  • 42.Sadikovic B, Yoshimoto M, Al-Romaih K, Maire G, Zielenska M, Squire JA. In vitro analysis of integrated global high-resolution DNA methylation profiling with genomic imbalance and gene expression in osteosarcoma. PloS one 2008;3:e2834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Kresse SH, Rydbeck H, Skarn M, Namlos HM, Barragan-Polania AH, Cleton-Jansen AM, et al. Integrative analysis reveals relationships of genetic and epigenetic alterations in osteosarcoma. PloS one 2012;7:e48262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Jones PA, Taylor SM. Cellular differentiation, cytidine analogs and DNA methylation. Cell 1980;20:85–93 [DOI] [PubMed] [Google Scholar]
  • 45.Zhou GS, Zhang XL, Wu JP, Zhang RP, Xiang LX, Dai LC, et al. 5-Azacytidine facilitates osteogenic gene expression and differentiation of mesenchymal stem cells by alteration in DNA methylation. Cytotechnology 2009;60:11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Capobianco E, Mora A, La Sala D, Roberti A, Zaki N, Badidi E, et al. Separate and combined effects of DNMT and HDAC inhibitors in treating human multi-drug resistant osteosarcoma HosDXR150 cell line. PloS one 2014;9:e95596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Li X, Lewis MT, Huang J, Gutierrez C, Osborne CK, Wu MF, et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. Journal of the National Cancer Institute 2008;100:672–9 [DOI] [PubMed] [Google Scholar]
  • 48.Tessema M, Klinge DM, Yingling CM, Do K, Van Neste L, Belinsky SA. Re-expression of CXCL14, a common target for epigenetic silencing in lung cancer, induces tumor necrosis. Oncogene 2010;29:5159–70 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Takai H, Matsumura H, Matsui S, Kim KM, Mezawa M, Nakayama Y, et al. Unliganded estrogen receptor alpha stimulates bone sialoprotein gene expression. Gene 2014;539:50–7 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

RESOURCES