Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Mar 1.
Published in final edited form as: Genesis. 2019 Jan 12;57(3):e23270. doi: 10.1002/dvg.23270

Impaired intermediate formation in mouse embryos expressing reduced levels of Tbx6

Deborah L Chapman 1,*
PMCID: PMC6422700  NIHMSID: NIHMS1002520  PMID: 30548789

Abstract

Intermediate mesoderm (IM) is the strip of tissue lying between the paraxial mesoderm (PAM) and the lateral plate mesoderm that gives rise to the kidneys and gonads. Chick fate mapping studies suggest that IM is specified shortly after cells leave the primitive streak and that these cells do not require external signals to express IM-specific genes (James and Schultheiss, 2003). Surgical manipulations of the chick embryo, however, revealed that PAM-specific signals are required for IM differentiation into pronephros – the first kidney (Mauch et al., 2000). Here, we use a genetic approach in mice to examine the dependency of IM on proper PAM formation. In Tbx6 null mutant embryos, which form 7–9 improperly patterned anterior somites, IM formation is severely compromised, while in Tbx6 hypomorphic embryos, where somites form but are improperly patterned along the axis, the impact to IM formation is lessened. These results suggest that IM and its derivatives, the kidneys and the gonads, are directly or indirectly dependent on proper PAM formation. This has implications for humans harboring Tbx6 mutations which are known to have somite-derived defects including congenital scoliosis (Sparrow et al., 2013; Wu et al., 2015).

INTRODUCTION

Intermediate mesoderm (IM) is the strip of tissue lying between the paraxial mesoderm (PAM) and the lateral plate mesoderm (LPM) that gives rise to the kidneys and gonads. Fate mapping studies in the mouse show that cells emerging from the mid-streak level of the primitive streak (PS) will give rise to the LPM, which includes the IM (Lawson et al., 1991; Smith et al., 1994; Tam and Beddington, 1987; Wilson and Beddington, 1996). Despite these cell fate assignments, transplantation experiments have demonstrated that cells in the PS display a high degree of plasticity or developmental potential (Tsang et al., 2000). Therefore at these early stages cell fates are not yet fixed and thus cells can respond to signals from surrounding tissues. Identifying the tissues that provide these signals and ultimately the nature of these signals is an important next step in understanding IM formation.

Chick fate mapping results are consistent with data from the mouse, namely that cells from the more caudal regions of the PS are fated to form IM and that PS cells have a higher developmental potential than their fate map suggests (Garcia-Martinez and Schoenwolf, 1992; James and Schultheiss, 2003; Psychoyos and Stern, 1996; Schoenwolf et al., 1992). By definition, specification of a tissue is said to occur when cells removed from the embryo and cultured in a minimal media can still form that tissue or express markers of that tissue. James and Schultheiss (2003) examined the timing of chick IM specification and found that at stage 6, soon after emerging from the caudal region of the PS, cells express Pax-2, a marker of IM. They further showed that similar to the mouse studies described above, IM cell fate is not determined until after the cells have left the streak and occupy a more lateral position, which occurs at stage 8 in the chick. Interestingly, others have shown that PAM cells contribute to the stomal cells of the developing kidney (Guillaume et al., 2009).

Once the IM cell fate is established, cells undergo differentiation to form the pronephros, or the first kidney, and later will differentiate to form the mesonephros and finally the metanephric kidney through inductive interactions between the ureteric bud and metanephric mesenchyme, which is also derived from the IM (reviewed in (Saxen, 1987). Lineage tracing experiments in the chick demonstrated that chick IM (pronephros) descendants of cells at stage 10 adjacent to somite contribute to the nephric duct epithelium caudal to the site of labeling. Therefore extension of the IM along the axis in the chick occurs by caudal extension of this pronephros population and not by the addition of cells from the PS (Obara-Ishihara et al., 1999). Similar studies in the mouse have not been reported.

In the mouse, IM formation in terms of kidney development has been primarily studied through gene knock out experiments. Pax2 and Pax8, related paired homeobox-containing transcription factors, are the earliest known markers of IM with Pax8 being expressed slightly earlier than Pax2 in the pronephric duct (Bouchard et al., 2000; Pfeffer et al., 1998; Plachov et al., 1990). These factors are required in a redundant fashion to specify the pronephros (Bouchard et al., 2002). Interestingly the forkhead transcription factors, Foxc1 and Foxc2, function to regulate PAM versus IM formation; double homozygous mutant embryos fail to form somites and instead exhibit expanded IM, while their misexpression in IM leads to a PAM fate (Wilm et al., 2004). The transcription factor lim1 is expressed at all stages of IM formation – the nascent IM at embryonic day (e) 7.5 and in the pro-, meso- and metanephric kidney (Barnes et al., 1994; Tsang et al., 2000). lim1−/− mouse embryos form only rudimentary pronephric ducts that never express Pax2 (Shawlot and Behringer, 1995; Tsang et al., 2000). Later IM differentiation includes formation of the metanephric mesenchyme, which is under the control of Eya1 (Sajithlal et al., 2005; Xu and Xu, 2015) and Osr1 (James et al., 2006), and branching of the ureteric bud, which is controlled through ret9-GDNF signaling. ret9 encodes a receptor tyrosine kinase and is expressed along the entire length of the nephric duct at e10–11 and later at the tips of the ureteric bud branches, while the ret-9 ligand, GDNF, is expressed in the metanephric mesenchyme surrounding the ureteric bud. Both, Ret and GDNF are critical for ureteric bud outgrowth, such that in the absence of either factor renal agenesis occurs (reviewed in (Costantini and Shakya, 2006)).

A great deal is known about the proteins necessary for the cell autonomous events controlling IM formation, however less is known about the non-cell autonomous signals, i.e. signals emerging from the surrounding tissue, that control IM formation and differentiation. Midline signaling, specifically through Shh, is required for bilateral mesonephros formation as more medial positioning of the metanephric mesenchyme and later kidney fusions are observed in embryos lacking midline Shh (Tripathi et al., 2010). Later midline signaling, but not Shh from IM, is needed to regulate the number of mesonephric tubules, such that conditional knock out of Shh in the notochord and floorplate at later stages of development results in ectopic mesonephric tubules formation (Murashima et al., 2014). Because Shh-responsive cells were found in the PAM but not the IM, it was concluded that Shh working through the PAM was critical to regulate these processes. Work in the chick further suggests that signals from the PAM are required for the differentiation of IM into pronephros (James and Schultheiss, 2003; Mauch et al., 2000). Using classical surgical manipulations combined with molecular marker analysis, Mauch et al. examined the effect of physically separating perspective IM from the surrounding tissues at different times during development (Mauch et al., 2000). Separation of PAM from the perspective IM resulted in the cessation of IM extension posteriorly, while similar surgical separations that prevented signals from the axial and LPM had no effect. They therefore concluded that PAM signals were necessary for IM induction. James and Schultheiss showed that IM is specified shortly after the cells move through the caudal PS, but also found that axial/paraxial signals promoted IM formation (James and Schultheiss, 2003). From these and other results, the authors proposed a two-step model for patterning the IM: first, IM specification occurs shortly after cells emerge from the PS, thereafter, competing signals from the axial tissues and LPM are required to determine the number of cells committed to an IM fate. It is not clear whether this two-step model is complete, as it does not address prior results implicating PAM signals for posterior extension of the IM.

Here, we use a genetic approach in mice to analyze the PAM requirement for IM formation. We find that IM formation is compromised in mouse embryos that are deficient in PAM formation, specifically those null for Tbx6 or those expressing hypomorphic levels of Tbx6. Interestingly, either a reduction in PAM formation or mispatterning of the PAM results in the absence or malformation of the IM. Altogether our results show a dependency of IM on properly formed and patterned PAM.

RESULTS

IM formation in Tbx6 mutant embryos

We became interested in the requirement for PAM in the formation and patterning of surrounding tissues during our studies of the Tbx6 mouse mutant embryo, in which posterior paraxial tissue is replaced by ectopic neural tissue from the forelimb bud caudally (Chapman and Papaioannou, 1998). We reasoned that if PAM-specific signals are required for IM formation, patterning, or elaboration of pattern, then the Tbx6 mutant would be a useful genetic tool to explore this. In addition to the Tbx6 null allele, we could also examine IM formation in the partially rescued Tbx6−/− Tg46/+ embryos (Tg46-rescued) in which PAM forms but is mispatterned, with somites adopting entirely posterior identity (White et al., 2003). As demonstrated by myogenin expression in the myotome of the somite, the Tbx6 null embryo forms 9–11 irregular anterior somites, while the Tg46-rescued embryo forms irregular somites along the entire axis (Fig. 1a-f). Ectopic neural tissue forms in both the Tbx6 and Tg46-rescued embryos beginning at the level of the forelimb bud and extending posteriorly as shown by Sox2 expression (Fig. 1a-c, g-i). Initially we examined the expression of genes known to be active during the early stages of IM formation and elaboration; pax2, lim1, ret9 and wnt-11 are all markers of the pro- and mesonephros. As many of these markers are also expressed in the developing neural tissue, and since both Tbx6 null and Tg46-rescued embryos have lateral ectopic neural tissue, we examined these marker genes at e9.5 during pronephros development and prior to their expression in neural tissue (Fig. 1j-k). In wild-type embryos at e9.5, Pax2 expression extends from the forelimb bud region to the cloaca. In Tbx6−/− embryos, Pax2 expression in the IM is observed only in the forelimb bud region, while posterior to this Pax2 IM expression truncated prematurely or became discontinuous, and thus never reached the cloaca (Fig. 1j-k). Expression patterns of lim1 and ret-9 confirmed this observation (data not shown).

Figure 1. Marker gene analysis of Tbx6 null and Tg46-rescued embryos.

Figure 1.

Open in a new tab

(a-c) Schematic of transverse sections through normal, Tbx6 null and Tg46-rescued (Tg46R) embryos showing the position of paraxial somites (pink) or ectopic neural tubes (blue) lateral to the axial neural tube (blue). Whole mount in situ hybridization of e10.5 (d-i) or e9.5 (j-k) embryos for myogenin expression in the myotome (d-f); Sox2 in neural tissue (g-i); and Pax2 in the IM (j-k). The regularly spaced stripes of myogenin expression in the normal embryo (d) is altered in the Tbx6−/− anterior somites and absent posteriorly (e). myogenin expression is disordered along the entire A-P axis of Tg46R embryos (f) compared to the normal embryo (d). Both Tbx6−/− (h) and Tg46R (i) embryos have ectopic neural tissue in the paraxial position, as seen by Sox2 expression from the forelimb bud caudally. Neural staining is highlighted by blue arrows and arcs. (j) Pax2 expression in the normal embryo extends from the forelimb bud caudally to the cloaca (red and blue arrowheads indicate the anterior and posterior of Pax2 expression, respectively, in panels j-k). (j’) High magnification of a side view of the tail shown in panel j. Pax2 is expressed at the forelimb bud level, but never reaches the cloaca in the Tbx6−/− embryos (k). (k’) High magnification of a dorsal view of the tail shown in panel k. Red asterisks mark the forelimb bud.

Histological analysis of the Tbx6 null embryo confirmed marker gene studies, specifically the absence of mesonephros posterior to the forelimb bud (Fig. 2). In contrast, mesonephric tubules have clearly formed in the forelimb region of the e10.5 Tg46-rescued embryos (Fig. 2). By e13.5, the metanephric kidney has formed in the normal embryo, with ureteric bud and kidney tubules developing within a condensed mesenchyme (Fig. 3). Although the Tbx6 null embryos do not survive past e12.5, the Tg46-rescued embryos are viable, thus permitting histological analysis of the metanephric kidney and surrounding tissue that might be influencing its formation. Metanephric kidney formation was highly variable in the Tg46-rescued embryos as was the extent of ectopic neural tissue. In some embryos, tubules formed within a condensed mesenchyme, however the tissue was reduced in size compared to the normal embryo (Fig. 3b). On the other extreme, tubules formed within a loose mesenchyme with no clear kidney capsule (Fig. 3c). In some embryos, ectopic neural tissue formation was extensive and displaced the developing organs (including the kidneys) more anteriorly. A clear correlation between the extent of kidney formation and the amount of ectopic neural tissue, however, could not be made. Indeed, in at least one embryo, metanephric tubules were observed adjacent to ectopic neural tissue (Fig. 3b).

Figure 2. Histological analysis of mesonephros formation in Tbx6 null and Tg46-rescued embryos.

Figure 2.

Open in a new tab

Transverse sections of e10.5 normal (a, d, e), Tbx6 null (b, c) and Tg46-rescued (f, g) embryos stained with H&E (a-c) or Mason’s trichrome (d-g). Mesonephric tubules have formed in the normal embryo (a, red arrowheads), whereas tubules are absent in the Tbx6 mutant (b, c; blue arrowheads denote the region of normal IM formation). Secondary ectopic neural tissue is denoted by 2o. Low (d) and high (d’) magnification of a section along the length of a normal mesonephros (red arrowhead). Mesonephric tubules form in the forelimb region of the Tg46-rescued embryos (red arrowheads in f, high magnifications of the tubules are shown in f’ and f”). Evenly-spaced somites are found in the normal embryo (e) compared to the irregular segmentation of the PAM in the Tg46-rescued embryo (g). Boundaries between the somites are denoted by black arrowheads (e, g).

Figure 3. Histological analysis of kidney formation in Tg46-rescued embryos.

Figure 3.

Open in a new tab

Transverse sections of e13.5 normal and Tg46-rescued embryos stained with Mason’s trichrome. Primed panels are high magnifications of the respective panels. (a) At e13.5, the normal embryo has well-organized kidneys (red arrowheads) with tubules forming within distinct kidney mesenchyme. The kidney (k) and urogenital ridge (ugr) are shown in the high magnification (a’). (b-d) The Tg46-rescued embryos display variable kidney formation and secondary neural tissue (2o). The primary/axial neural tube is denoted by 1o in panel b. (b) In some Tg46-rescued embryos, kidney tubules (red arrowheads) form within condensed mesenchyme that is indicative of kidney mesenchyme. These tubules are immediately adjacent to ectopic neural tissue as shown in the neighboring sections (b’, b”). In other Tg46-rescued embryos, kidney tubules form (red arrowheads) but are not found within condensed mesenchyme (c-c’) or within a distinct kidney capsule (d-d”‘).

As previously mentioned, pax2, lim1 and ret9 are all expressed in the neural tube at later stages (e10.5 and older) of development (Barnes et al., 1994; Nornes et al., 1990; Pachnis et al., 1993; Shawlot and Behringer, 1995). Consequently, these were also expressed in the lateral regions of e10.5 Tbx6 null and Tg46-rescued embryos and thus limited our marker gene analyses. To circumvent this problem we examined the expression of the hoxb7-GFP reporter transgene that is expressed in the developing pro-, meso- and metanephros (Srinivas et al., 1999). These results confirmed both marker gene and histological studies and showed that IM is severely disrupted from the forelimb bud caudally in the Tbx6 mutant and variably forms in the Tg46-rescued embryos (Fig. 4).

Figure 4. IM formation is disrupted in Tbx6 null and in embryos expressing reduced levels of Tbx6.

Figure 4.

Open in a new tab

The hoxb7-GFP transgene, which is expressed in the pro, meso- and metanephric kidney, was used to examine the extent of IM formation and differentiation in the various Tbx6 mutant embryos. Embryos and dissected tissue were flat mounted and examined by fluorescence microscopy. Embryos were dissected at e9.5 (a-b); e10.5 (c-f); e11.5 (g-i); e13.5 (j-n); and e15.5 (o-p). (a, c, d) Normal (n) embryos show GFP in the IM from the forelimb bud to the cloaca at e9.5 and in the formed ureteric bud (ub) by e10.5. GFP expression in the Tbx6−/− embryo truncates prematurely or is disrupted at e9.5 (b’, b” show higher magnifications) and by e11.5 (h, dorsal view) expression is limited to a short segment in the forelimb region. Red and blue arrowheads mark the anterior and posterior, respectively, of the IM segments in all panels so marked. White arrows in b” show islands of GFP expressing cells. At e10.5 and e11.5, GFP expression in Tg46R embryos extends along the axis similar to the normal embryos, however, it appears to be more disorganized (e, f, i). At e13.5, kidney morphogenesis is highly variable in the Tg46R embryos (k, m, n): a branching ureteric bud observed in one embryo (k) resembles the normal littermate (j), whereas bilateral failure or decreased tubule branching is seen in another Tg46R embryo (m, n). (p) The Tbx6rv/rv embryo shows ureteric buds (arrows) that have failed to undergo branching morphogenesis (white arrows mark the tip of the ureter), in comparison to the highly developed kidney tubules in the normal embryo (o). This is a rare event in the Tbx6rv/rv embryos that usually form at least one kidney. Abbreviations used: pronephros, pn; ureteric bud, ub; gonad, g.

We and others have previously identified rib-vertebrae as a hypomorphic allele of Tbx6 (Watabe-Rudolph et al., 2002; White et al., 2003). Tbx6rv/rv embryos express less than heterozygous levels of Tbx6 and the resulting mice have mispatterned somites, which results in rib and vertebrae fusions that are reminiscent of the Tg46-rescued embryos (White et al., 2003). We therefore examined e15.5 Tbx6rv/rv kidneys using the hoxb7-GFP transgene. Kidney formation in these embryos was again variable – some embryos formed two normal kidneys, while others formed only one with no preference for right or left side (Fig. 4). In the most severely affected embryos, GFP expression was observed in the ureteric buds, but these failed to undergo branching morphogenesis (Fig. 4p).

Impaired IM formation in wnt3a−/− and Tbx6−/− wnt3a−/− embryos

Our lab has been taking a genetic approach to look for interactions between Tbx6 and genes known to be required for PAM formation and patterning. wnt3a functions in a number of different processes during development, but we are primarily interested in its role in PAM formation. wnt3a−/− embryos form the first 9+ anterior somites, thereafter ectopic neural tissue forms at the expense of PAM, with a single large ectopic neural tube found ventral to the axial neural tube (Yoshikawa et al., 1997). Tbx6 is initially expressed in the wnt3a mutants, but expression is not maintained (Yamaguchi et al., 1999). Conversely, wnt3a is expressed in the Tbx6 mutant embryos (Chapman and Papaioannou, 1998). Based on this, we hypothesized that wnt3a lies upstream of Tbx6 in the PAM pathway. To test this, we generated Tbx6 wnt3a double heterozygous animals, which are viable and fertile, and crossed these to generate the Tbx6−/− wnt3a−/− embryos (Fig. 5). Morphologically, the double mutants are similar to the wnt3a mutant, possessing a truncated axis and dysmorphic tail region. Interestingly, myogenin expression revealed only 4–5 somites in the double mutants as opposed to the 9+ myogenin positive somites in the wnt3a mutant. This more severe phenotype in double mutant embryos suggests that wnt3a and Tbx6 may be functioning in parallel pathways to control anterior somite formation and not in a direct pathway as we had previously thought.

Figure 5. Genetic interaction between Tbx6 and wnt3a reveals a loss of IM.

Figure 5.

Open in a new tab

Embryos from intercrosses of Tbx6+/− wnt3a+/− mice were dissected at e9.5. (a-f) Whole mount in situ hybridization of myogenin expression in normal (n) and mutant embryos (genotypes are indicated). (a-c) and (d-f) represent embryos from separate litters. (a-c) Disruption of somite-derived myotomes in the Tbx6−/− and wnt3a−/− embryos (~11 irregular stripes) compared to normal embryos (~27 stripes). Tbx6−/− wnt3a−/− embryos (e, f) show only 4–5 myogenin-positive stripes compared to ~17 in the normal littermate (d). (g-l) Pax2 whole mount in situ hybridization in normal and mutant embryos. Pax2 expression extends from the forelimb bud (red asterisk) to the cloaca in normal embryos (anterior and posterior of IM are designated with red and blue arrowheads, respectively, or by red arrowheads where there are only spots). In wnt3a−/− (h-i) and Tbx6−/− embryos (j), Pax2 expression is discontinuous, while in Tbx6−/− wnt3a−/− embryos no Pax2 expression is detected (k-l). Panels labeled with prime are high magnifications of their respective panel. Red asterisks indicate the position of the forelimb bud.

IM formation is initiated but its posterior extension is interrupted in Tbx6−/− embryos, which form 9–11 irregular anterior somites. We also examined wnt3a mutant embryos to determine whether the IM phenotype was specific to Tbx6, or resulted from a loss of PAM tissue and hence a PAM-specific signal. The wnt3a mutant embryos also displayed truncated IM as revealed by Pax2 expression patterns (Fig. 5 h-i). If IM relies on signals from the PAM, then the initial formation of IM in the wnt3a and Tbx6 mutant embryos would result from signals arising from the anterior somites. Since the Tbx6−/− wnt3a−/− embryos form only 4–5 anterior somites, we reasoned that IM formation would be more severely impaired and therefore examined Pax2 expression in the double homozygous mutant embryos. Interestingly, Pax2 expression was absent in Tbx6−/− wnt3a−/− embryos (Fig. 5k-l) indicating a complete loss of IM with further loss of PAM.

DISCUSSION

We have investigated the role of PAM in the formation and differentiation of IM in the mouse using a genetic approach. Embryos harboring mutations in Tbx6 or wnt3a form only 9–11 anterior somites. In these embryos, IM formation initiates but fails to extend caudally past the forelimb bud region, often becoming discontinuous. Caudal migration of the pronephric duct could be blocked by the ectopic neural tissue that forms in these mutants, however this does not explain the discontinuous nature of IM marker gene or hoxb7-GFP transgene expression. Instead IM may be specified anew, perhaps receiving a PAM signal from the anterior PAM that forms in these mutants. Interesting, our studies revealed that the Tbx6 wnt3a double mutant embryos are more severely affected than either mutant alone, forming only 4–5 irregular anterior somites. These double mutants fail to express the IM marker Pax2. Altogether these results suggest that the anterior 9–11 somites which form in Tbx6 and wnt3a single mutants are sufficient for the initiation of IM formation, however further reduction of anterior PAM leads to the loss of IM derivatives. wnt3a−/− and Tbx6−/− wnt3a−/− embryos exhibit axial truncations later in development. Although axis extension in these mutants appears unaffected at the time IM is predicted to be migrating through the PS, we cannot rule out that migration defects through the streak contribute to the cessation of IM formation.

Previously, we examined the cell autonomous requirement for Tbx6 in various tissues during development (Chapman et al., 2003). For these studies, Tbx6 mutant ES cells were injected into wildtype blastocysts and the resulting embryos were dissected at e9.5–10.5 and examined for the contribution of Tbx6−/− cells to various tissues. These studies revealed that Tbx6 is required for the formation of posterior somites, but not for IM as Tbx6 mutant cells could contribute to IM. This, together with the absence of Tbx6 expression in the IM, support the idea that the loss of IM in the Tbx6 mutant is due to cell-non-autonomous defects resulting from a loss of PAM, as opposed to a direct effect of Tbx6 in the IM tissue. In the chick, lineage-tracing studies showed that PAM contributes to the renal stromal cells of the meso- and metanephros (Guillaume et al., 2009). More recent studies used a Tbx6-Cre-ERT2 line to lineage trace cells that expressed Tbx6 revealing that timed-induction starting at e7.5 to e8.5 resulted in labeled cells in the mesonephric tubules and metanephric primordia (Concepcion et al., 2017). This is perhaps not surprising since this would label cells in the primitive streak, which are known to express Tbx6 (Chapman et al., 1996). However, because cells that once expressed Tbx6 contribute to IM derivatives, we cannot rule out that this contributes to the disruption in IM formation observed in the Tbx6−/− embryo.

We also examined IM formation and differentiation in embryos with disruptions in somite patterning. Although somites form in both the Tg46-rescued and Tbx6rv/rv embryos, there is a loss of rostral-caudal patterning which ultimately leads to the fusions of ribs and vertebrae (White et al., 2003). In addition to these improperly patterned somites, Tg46-rescued embryos also produce ectopic neural tissue in the paraxial position. Kidney formation in the Tg46-rescued embryo was highly variable, and this variability may reflect the amount of ectopic neural tissue that forms. It is possible that signals from neural tissue inhibit IM formation, or that the ectopic neural tissue displaces the PAM away from the developing IM. The former situation is unlikely as James and Schultheiss (2003) found that grafts of PAM and neural tissue tended to attract the IM, such that IM wrapped around the graft. Indeed our histological analysis revealed the formation of kidney tubules adjacent to ectopic neural tissue (Fig. 3b). We cannot rule out that the ectopic neural tissue is inhibiting caudal migration of the pronephros in more severely affected mutants, if this is indeed the mechanism by which IM extends along the axis in the mouse. It is equally possible that the displacement of tissues anteriorly by the ectopic neural tissue in the Tg46-rescued embryos contributes to the observed kidney malformations.

Abnormal kidney formation has previously been reported for the Tbx6rv/rv mice, which possess a hypomorphic Tbx6 allele and have a less severe phenotype than the Tg46-rescued embryos (Nacke et al., 2000; White et al., 2003). Homozygosity for the Tbx6rv allele is viable, however these mice possess fusions of ribs and vertebrae that result in short stature and kinky tail phenotypes. Tbx6rv/rv mice frequently develop one bilateral horseshoe shaped kidney or a single kidney located on one side of the axis (Nacke et al., 2000; Theiler and Gluecksohn-Waelsh, 1956). Using the hoxb7-GFP transgene to track kidney formation in the Tbx6rv/rv embryos, we showed that one possible cause for the defects observed in the mice was the failure of the ureteric bud to branch. Interestingly, the Tbx6rv/rv vertebral, rib and kidney phenotypes are similar to human scoliosis patients, who exhibit curvature of the spine often associated with fusions of ribs and vertebrae (MacEwen et al., 2005).

Results from the chick and the results from the mouse presented here are in stark contrast to that found in the zebrafish (Griffin and Kimelman, 2002). Spadetail (spt) encodes a T-box protein and is required for trunk somite formation. One-eyed pinhead (oep) encodes a nodal-receptor co-factor, which is required for endoderm and prechordal mesoderm. Interestingly, mutations in both genes result in synergistic effects, with double mutant embryos failing to form all somitic and cardiac mesoderm. Examination pax2.1 expression in these mutants revealed a relatively normal IM-staining pattern and thus normal pronephros formation, despite the absence of PAM. The reason for this discrepancy between zebrafish and mouse/chick IM formation is unclear and requires further investigation.

Altogether, our results support the findings of Mauch et al. (2000) in the chick, namely that a PAM-specific signal is required for initiation and elaboration of the IM. Failure of nephric duct extension in the Tbx6 and wnt3a single mutants and the more severe loss of IM derivatives in Tbx6 wnt3a double mutant embryos further support a role for PAM in IM formation and differentiation. We further demonstrate that proper formation of the PAM is required for correct morphogenesis of the kidney. Whether this is a direct effect of improper somite formation or the consequence of ectopic neural tissue is not clear and would require the analysis of mutant embryos that do not form neural tissue when PAM fails to form.

EXPERIMENTAL PROCEDURES

Mice:

Tbx6tm1Pa mice have previously been described and are maintained on a mixed C57Bl6/J 129Sv/Ev genetic background (Chapman and Papaioannou, 1998). These mice were crossed to the Tbx6Tg46 transgenic mice, which are maintained on a FVB/N background. wnt3atm1Amc were obtained from Jackson Laboratories and are maintained on a mixed C57Bl6/J 129S1/Sv background (Takada et al., 1994). Hoxb7/GFP transgenic mice, which have green fluorescent protein (GFP) under the control of the Hoxb7 enhancer, were ultimately obtained from G. Martin (UCSF) (Srinivas et al., 1999). Genotyping of the Tbx6tm1Pa and Tbx6Tg46 transgenic mice and embryos was performed by Southern blot analysis using a Tbx6-specific probe as previously described (Chapman and Papaioannou, 1998; White et al., 2003). The hoxb7/GFP transgene was genotyped according to (Srinivas et al., 1999). wnt3a mice were genotyped using the following PCR primers: forward: .5’- CCAACTCCGTGTAAGACCTGAAAC −3’, reverse: 5’- GGTGAAAAAGCAGCCCTTGC −3’, mutant forward: 5’- GGTGGATGTGGAATGTGTGCG – 3’, which generated a 450 bp wild-type and 620 bp mutant bands.

Whole mount in situ hybridization:

Whole mount in situ hybridization was performed as previously described by Wilkinson (1992) using antisense riboprobes for myogenin, Pax2, sox2, Lim1 and ret9. Hybridization and washes were performed at 63oC.

Histology:

Embryos were dissected at the designated times in PBS with 0.2% BSA, fixed overnight in Bouin’s fixative, dehydrated through an ethanol series and embedded in 1:1 Paraplast Xtra:Tissue Prep2 paraffin according to standard techniques. Sections were cut at 6–8 μm, placed on Superfrost slides and stained with Mason’s trichrome or hematoxylin and eosin.

Immunofluorescence:

GFP embryos and dissected tissue were visualized in Vectashield mounting media in whole mount using a Leica DMR microscope.

ACKNOWLEDGMENTS

I thank Drs. G. Martin and F. Costantini for the hoxb7-GFP mice, and Drs. R. Behringer, P. Gruss, B. Klein, A. Myer, and L. Pevny for probes. Special thanks to Dr. J. Hildebrand and members of our labs for helpful discussion and careful reading of the manuscript.

Grant sponsor: NIH HD038786

References

  1. Barnes JD, Crosby JL, Jones CM, Wright CV, Hogan BL. 1994. Embryonic expression of Lim-1, the mouse homolog of Xenopus Xlim-1, suggests a role in lateral mesoderm differentiation and neurogenesis. Dev Biol 161: 168–178. [DOI] [PubMed] [Google Scholar]
  2. Bouchard M, Pfeffer P, Busslinger M. 2000. Functional equivalence of the transcription factors Pax2 and Pax5 in mouse development. Development 127: 3703–3713. [DOI] [PubMed] [Google Scholar]
  3. Bouchard M, Souabni A, Mandler M, Neubuser A, Busslinger M. 2002. Nephric lineage specification by Pax2 and Pax8. Genes Dev 16: 2958–2970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chapman DL, Agulnik I, Hancock S, Silver LM, Papaioannou VE. 1996. Tbx6, a mouse T-box gene implicated in paraxial mesoderm formation at gastrulation. Dev Biol 180: 534–542. [DOI] [PubMed] [Google Scholar]
  5. Chapman DL, Cooper-Morgan A, Harrelson Z, Papaioannou VE. 2003. Critical role for Tbx6 in mesoderm specification in the mouse embryo. Mech Dev 120: 837–847. [DOI] [PubMed] [Google Scholar]
  6. Chapman DL, Papaioannou VE. 1998. Three neural tubes in mouse embryos with mutations in the T-box gene Tbx6. Nature 391: 695–697. [DOI] [PubMed] [Google Scholar]
  7. Concepcion D, Washkowitz AJ, DeSantis A, Ogea P, Yang JI, Douglas NC, Papaioannou VE. 2017. Cell lineage of timed cohorts of Tbx6-expressing cells in wild-type and Tbx6 mutant embryos. Biol Open 6: 1065–1073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Costantini F, Shakya R. 2006. GDNF/Ret signaling and the development of the kidney. Bioessays 28: 117–127. [DOI] [PubMed] [Google Scholar]
  9. Garcia-Martinez V, Schoenwolf GC. 1992. Positional control of mesoderm movement and fate during avian gastrulation and neurulation. Dev Dyn 193: 249–256. [DOI] [PubMed] [Google Scholar]
  10. Griffin KJ, Kimelman D. 2002. One-Eyed Pinhead and Spadetail are essential for heart and somite formation. Nat Cell Biol 4: 821–825. [DOI] [PubMed] [Google Scholar]
  11. Guillaume R, Bressan M, Herzlinger D. 2009. Paraxial mesoderm contributes stromal cells to the developing kidney. Dev Biol 329: 169–175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. James RG, Kamei CN, Wang Q, Jiang R, Schultheiss TM. 2006. Odd-skipped related 1 is required for development of the metanephric kidney and regulates formation and differentiation of kidney precursor cells. Development 133: 2995–3004. [DOI] [PubMed] [Google Scholar]
  13. James RG, Schultheiss TM. 2003. Patterning of the avian intermediate mesoderm by lateral plate and axial tissues. Dev Biol 253: 109–124. [DOI] [PubMed] [Google Scholar]
  14. Lawson KA, Meneses JJ, Pedersen RA. 1991. Clonal analysis of epiblast fate during germ layer formation in the mouse embryo. Development 113: 891–911. [DOI] [PubMed] [Google Scholar]
  15. MacEwen GD, Winter RB, Hardy JH, Sherk HH. 2005. Evaluation of kidney anomalies in congenital scoliosis. 1972. Clin Orthop Relat Res: 4–7. [DOI] [PubMed]
  16. Mauch TJ, Yang G, Wright M, Smith D, Schoenwolf GC. 2000. Signals from trunk paraxial mesoderm induce pronephros formation in chick intermediate mesoderm. Dev Biol 220: 62–75. [DOI] [PubMed] [Google Scholar]
  17. Murashima A, Akita H, Okazawa M, Kishigami S, Nakagata N, Nishinakamura R, Yamada G. 2014. Midline-derived Shh regulates mesonephric tubule formation through the paraxial mesoderm. Dev Biol 386: 216–226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Nacke S, Schafer R, Habre de Angelis M, Mundlos S. 2000. Mouse mutant “rib-vertebrae” (rv): a defect in somite polarity. Dev Dyn 219: 192–200. [DOI] [PubMed] [Google Scholar]
  19. Nornes HO, Dressler GR, Knapik EW, Deutsch U, Gruss P. 1990. Spatially and temporally restricted expression of Pax2 during murine neurogenesis. Development 109: 797–809. [DOI] [PubMed] [Google Scholar]
  20. Obara-Ishihara T, Kuhlman J, Niswander L, Herzlinger D. 1999. The surface ectoderm is essential for nephric duct formation in intermediate mesoderm. Development 126: 1103–1108. [DOI] [PubMed] [Google Scholar]
  21. Pachnis V, Mankoo B, Costantini F. 1993. Expression of the c-ret proto-oncogene during mouse embryogenesis. Development 119: 1005–1017. [DOI] [PubMed] [Google Scholar]
  22. Pfeffer PL, Gerster T, Lun K, Brand M, Busslinger M. 1998. Characterization of three novel members of the zebrafish Pax2/5/8 family: dependency of Pax5 and Pax8 expression on the Pax2.1 (noi) function. Development 125: 3063–3074. [DOI] [PubMed] [Google Scholar]
  23. Plachov D, Chowdhury K, Walther C, Simon D, Guenet JL, Gruss P. 1990. Pax8, a murine paired box gene expressed in the developing excretory system and thyroid gland. Development 110: 643–651. [DOI] [PubMed] [Google Scholar]
  24. Psychoyos D, Stern CD. 1996. Fates and migratory routes of primitive streak cells in the chick embryo. Development 122: 1523–1534. [DOI] [PubMed] [Google Scholar]
  25. Sajithlal G, Zou D, Silvius D, Xu PX. 2005. Eya 1 acts as a critical regulator for specifying the metanephric mesenchyme. Dev Biol 284: 323–336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Saxen L 1987. Ontogenesis of the vertebrate excretory system. In: Saxen L, editor. The Organogenesis of the Kidney Cambridge: Cambridge University Press; p 1–34. [Google Scholar]
  27. Schoenwolf GC, Garcia-Martinez V, Dias MS. 1992. Mesoderm movement and fate during avian gastrulation and neurulation. Dev Dyn 193: 235–248. [DOI] [PubMed] [Google Scholar]
  28. Shawlot W, Behringer RR. 1995. Requirement for Lim1 in head-organizer function. Nature 374: 425–430. [DOI] [PubMed] [Google Scholar]
  29. Smith JL, Gesteland KM, Schoenwolf GC. 1994. Prospective fate map of the mouse primitive streak at 7.5 days of gestation. Dev Dyn 201: 279–289. [DOI] [PubMed] [Google Scholar]
  30. Sparrow DB, McInerney-Leo A, Gucev ZS, Gardiner B, Marshall M, Leo PJ, Chapman DL, Tasic V, Shishko A, Brown MA, Duncan EL, Dunwoodie SL. 2013. Autosomal dominant spondylocostal dysostosis is caused by mutation in TBX6. Hum Mol Genet 22: 1625–1631. [DOI] [PubMed] [Google Scholar]
  31. Srinivas S, Goldberg MR, Watanabe T, D’Agati V, al-Awqati Q, Costantini F. 1999. Expression of green fluorescent protein in the ureteric bud of transgenic mice: a new tool for the analysis of ureteric bud morphogenesis. Dev Genet 24: 241–251. [DOI] [PubMed] [Google Scholar]
  32. Takada S, Stark KL, Shea MJ, Vassileva G, McMahon JA, McMahon AP. 1994. Wnt-3a regulates somite and tailbud formation in the mouse embryo. Genes Dev 8: 174–189. [DOI] [PubMed] [Google Scholar]
  33. Tam PP, Beddington RS. 1987. The formation of mesodermal tissues in the mouse embryo during gastrulation and early organogenesis. Development 99: 109–126. [DOI] [PubMed] [Google Scholar]
  34. Theiler K, Gluecksohn-Waelsh S. 1956. The morphological effects and the development of the fused mutation in the mouse. Anat. Rec. 125: 83–104. [DOI] [PubMed] [Google Scholar]
  35. Tripathi P, Guo Q, Wang Y, Coussens M, Liapis H, Jain S, Kuehn MR, Capecchi MR, Chen F. 2010. Midline signaling regulates kidney positioning but not nephrogenesis through Shh. Dev Biol 340: 518–527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Tsang TE, Shawlot W, Kinder SJ, Kobayashi A, Kwan KM, Schughart K, Kania A, Jessell TM, Behringer RR, Tam PP. 2000. Lim1 activity is required for intermediate mesoderm differentiation in the mouse embryo. Dev Biol 223: 77–90. [DOI] [PubMed] [Google Scholar]
  37. Watabe-Rudolph M, Schlautmann N, Papaioannou VE, Gossler A. 2002. The mouse rib-vertebrae mutation is a hypomorphic Tbx6 allele. Mech Dev 119: 251–256. [DOI] [PubMed] [Google Scholar]
  38. White PH, Farkas DR, McFadden EE, Chapman DL. 2003. Defective somite patterning in mouse embryos with reduced levels of Tbx6. Development 130: 1681–1690. [DOI] [PubMed] [Google Scholar]
  39. Wilkinson DG. 1992. Whole mount in situ hybridization of vertebrate embryos. In: Wilkinson DG, editor. In situ hybridization: A practical approach Oxford: IRL Press; p 75–83. [Google Scholar]
  40. Wilm B, James RG, Schultheiss TM, Hogan BL. 2004. The forkhead genes, Foxc1 and Foxc2, regulate paraxial versus intermediate mesoderm cell fate. Dev Biol 271: 176–189. [DOI] [PubMed] [Google Scholar]
  41. Wilson V, Beddington RS. 1996. Cell fate and morphogenetic movement in the late mouse primitive streak. Mech Dev 55: 79–89. [DOI] [PubMed] [Google Scholar]
  42. Wu N, Ming X, Xiao J, Wu Z, Chen X, Shinawi M, Shen Y, Yu G, Liu J, Xie H, Gucev ZS, Liu S, Yang N, Al-Kateb H, Chen J, Zhang J, Hauser N, Zhang T, Tasic V, Liu P, Su X, Pan X, Liu C, Wang L, Shen J, Shen J, Chen Y, Zhang T, Zhang J, Choy KW, Wang J, Wang Q, Li S, Zhou W, Guo J, Wang Y, Zhang C, Zhao H, An Y, Zhao Y, Wang J, Liu Z, Zuo Y, Tian Y, Weng X, Sutton VR, Wang H, Ming Y, Kulkarni S, Zhong TP, Giampietro PF, Dunwoodie SL, Cheung SW, Zhang X, Jin L, Lupski JR, Qiu G, Zhang F. 2015. TBX6 null variants and a common hypomorphic allele in congenital scoliosis. N Engl J Med 372: 341–350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Xu J, Xu PX. 2015. Eya-six are necessary for survival of nephrogenic cord progenitors and inducing nephric duct development before ureteric bud formation. Dev Dyn 244: 866–873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Yamaguchi TP, Takada S, Yoshikawa Y, Wu N, McMahon AP. 1999. T (Brachyury) is a direct target of Wnt3a during paraxial mesoderm specification. Genes Dev 13: 3185–3190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Yoshikawa Y, Fujimori T, McMahon AP, Takada S. 1997. Evidence that absence of Wnt-3a signaling promotes neuralization instead of paraxial mesoderm development in the mouse. Dev Biol 183: 234–242. [DOI] [PubMed] [Google Scholar]

RESOURCES