Skip to main content
NCBI home page
Brain and Behavior logoLink to Brain and Behavior
. 2019 Feb 6;9(3):e01187. doi: 10.1002/brb3.1187

Tristetraprolin attenuates brain edema in a rat model of cerebral hemorrhage

Peiyu Li 1, Junwu Zhang 1, Xin Li 1, Hongwei Gao 2,✉
PMCID: PMC6422712  PMID: 30729695

Abstract

Objectives

We evaluated the protective effects of protein phosphatase 2A (PP2A)/tristetraprolin (TTP) against brain edema in a rat model of cerebral hemorrhage, bleeding in the brain that occurs in tissues and ventricles. TTP is a well‐known mRNA‐binding protein and essential regulatory molecule for gene expression.

Methods

Cerebral hemorrhage was induced in male albino rats divided into four homogeneous groups: normal control (I), control (II), PP2A siRNA (III), and scrambled siRNA (IV). Neurological scores, caspase‐3 mRNA and protein expression, PP2A and TTP protein expression, apoptosis, and water content in the brain were determined.

Results

The neurological score decreased substantially to 8.2 in rats in which cerebral hemorrhage was induced and was further reduced to 7.4 and 7.7 in groups III and IV, respectively. Caspase‐3 expression increased significantly by 90% in group II and by 26.9% in group III. Apoptosis increased by 26.1% in rats in which cerebral hemorrhage was induced and increased considerably by 35.3% and 33.4% in groups III and IV, respectively. PP2A and TTP protein expression increased significantly by 87% and 59%, as compared to their respective sham controls. However, PP2A and TTP siRNA treatment reduced the protein expression of PP2A and TTP in groups III and IV. The water content in the brain increased significantly by 77.4% in rats in which cerebral hemorrhage was induced (group II), as compared to the sham group. The water content in the brain increased by 84.1% and 78.7% in groups III and IV, respectively.

Conclusion

Taken together, these data indicate that TTP has a protective role against brain edema by reducing inflammation, apoptosis, and water content in the brain at 48 hr after cerebral hemorrhage. Our findings may be useful for developing important approaches to treating brain injury.

Keywords: apoptosis, brain water, cerebral hemorrhage, inflammation, tristetraprolin

1. INTRODUCTION

Cerebral hemorrhage is a type of bleeding in the brain that occurs in tissues and ventricles (Hemphill et al., 2015). Vomiting, neck stiffness, reduced consciousness, fever, and seizures are significant symptoms (Caceres & Goldstein, 2012). Brain tumors, trauma, arteriovenous malformation, aneurysms, alcoholism, amyloidosis, increased blood pressure, blood thinners, and low levels of cholesterol are significant causes of cerebral hemorrhage (Caceres & Goldstein, 2012; Hemphill et al., 2015). Brain injury occurs within 3 days of cerebral hemorrhage and accounts for more than 50% of related deaths due to neuronal apoptosis, reduced cerebral blood flow and O2, increased intracranial pressure, oxidative stress, inflammation, and brain edema (Connolly et al., 2012; Fujii et al., 2013).

The available treatments for cerebral hemorrhage include reducing blood pressure to the systolic range, normalizing blood glucose, reversing blood thinners, conducting surgery to remove the blood (Hemphill et al., 2015), and especially inhibiting apoptosis and suppressing inflammation. Neuronal dysfunction and inflammation are significant pathological aspects of cerebral hemorrhage (Guo et al., 2016; Yin, Huang, Sun, Guo, & Zhang, 2017). The levels of interleukins (ILs) and tumor necrosis factor (TNF)‐α increase in cerebral hemorrhage, leading to the activation microglia and the infiltration of inflammatory cells (Chang, Wu, Lin, & Kwan, 2015; Niwa et al., 2016; Wu et al., 2016). Stoecklin and Anderson (2006) reported increased levels of cytokines in response to increased levels of proteins due to inflammation. Tristetraprolin (TTP) is an RNA‐binding protein encoded by Zfp36 gene, and a CCCH tandem zinc finger protein member is involved in the posttranscriptional regulation of inflammatory responses. TTP has been reported for its protective role in several diseases such as glioma. Protein phosphatase (PP) 2A is pleiotropic enzymes and involves in dephosphorylation. We hypothesized that the dephosphorylation of TTP by PP2A could decrease the apoptosis and neuroinflammation. Therefore, in this study, we analyzed the effects of protein phosphatase 2A (PP2A)/tristetraprolin (TTP) on brain edema in a rat model of cerebral hemorrhage.

2. MATERIALS AND METHODS

2.1. Rats

Male albino rats were purchased from the animal house of Heilongjiang Provincial Hospital, Harbin, Heilongjiang, China. Their body weights (190–210 g) were recorded, and they were divided into four homogeneous groups. A 12‐hr light/dark cycle was maintained throughout the experimental period. Each homogenous group included six rats, and all were provided with water and food. All the animal experiments were approved by the ethics committee of Heilongjiang Provincial Hospital, Harbin, Heilongjiang, China.

2.2. Induction of cerebral hemorrhage

The rats were anesthetized with 10% chloral hydrate via intraperitoneal administration. Body weight and rectal temperature were maintained. The animals were shaved, and the external carotid artery was identified and transected. A sharp monofilament nylon suture was advanced rostrally. The internal carotid artery and external carotid stump were reperfused to induce cerebral hemorrhage. The incision was closed, and the rats were allowed to recover; medication was given for pain relief (Xie et al., 2017).

2.3. Treatment

After inducing cerebral hemorrhage, the rats were assigned to four groups: sham control (group I), control (II), PP22A siRNA (III), and scrambled siRNA (IV). Controls were given the same volume of normal saline. All laboratory experiments were monitored and approved by the ethics committee of Heilongjiang Provincial Hospital.

2.4. Preparation tissue homogenate

The rat was sacrificed following anesthetized with intramuscular injection of anesthesia ketamine hydrochloride (100 mg/kg body weight) + Xylazine (10 mg/kg body weight). Brain tissues were surgically removed, and cortex region was dissected and homogenized with a buffer (10 mM Tris‐HCl, 1 mM K‐EDTA, 0.25 mM sucrose). The brain homogenate was centrifuged for 5 min at 10,000 × g.

2.5. Determination of infarct size

The neurological deficit score was determined based on staining in the brain region (Schaar, Brenneman, & Savitz, 2010). After intramuscular injection of ketamine hydrochloride plus xylazine, the rats were anesthetized and then sacrificed by decapitation. Brain tissue was removed surgically and frozen at −20°C for 30 min. Then, frozen brain tissue was sliced into 2‐mm‐thick sections and stained with 2% 2,3,5‐triphenyltetrazolium chloride (TTC) for 60 min at 37°C without exposure to light. Finally, sections were fixed with 10% paraformaldehyde for 10 hr at 37°C.

2.6. RT‐PCR

Total RNA from tissue homogenate from the rats was extracted and converted into cDNA using oligo (dt) primers. Quantitative polymerase chain reaction (qPCR) was used to quantify caspase‐3 mRNA expression using specific primers (forward: 5′‐TTAATAAAGGTATCCATGGAGAACACT‐3′, reverse: 5′‐TTAGTGATAAAAATAGAGTTCTTTTGTGAG‐3′). GAPDH (forward: 5′‐GGTCACCAGGGCTGCTTTT‐3′, reverse: 5′‐ATCTCGCTCCTGGAAGATGGT‐3′) was used as an internal control to quantify caspase‐3 expression (Table 1). The level of mRNA expression was calculated as described previously (Masatoshi et al., 2001).

Table 1.

List of primers and antibodies used in this study

Caspase‐3 (forward) 5′‐TTAATAAAGGTATCCATGGAGAACACT−3′,
Caspase‐3 (reverse) 5′‐TTAGTGATAAAAATAGAGTTCTTTTGTGAG‐3′
GAPDH (forward) 5′‐GGTCACCAGGGCTGCTTTT‐3′
GAPDH (reverse) 5′‐ATCTCGCTCCTGGAAGATGGT‐3′
TTP Anti‐Tristetraprolin antibody (ab83579), Abcam
PP2A Anti‐PP2A B subunit antibody (ab16448), Abcam
Open in a new tab

2.7. TUNEL assay

Cell viability and death were measured using a terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay kit (In Situ Cell Death Detection Kit, Abcam, UK). Tissue sections were processed according to the manufacturer's protocol (Fayzullina & Martin, 2014), and images were taken using a confocal fluorescence microscope (Olympus, Japan).

2.8. Immunohistochemistry

Brain tissue from rats was cut into sections using a microtome and stored at 4°C for further use. Hydrogen peroxide was used to remove endogenous peroxidase activity from brain sections, and then, sections were incubated with bovine serum albumin (BSA) for 30 min to remove nonspecific protein binding sites. Then, sections were treated with caspase‐3 antibody (ab13847; Abcam) for 12 hr. Sections were treated with HRP‐conjugated secondary antibody following repeated washing (Duraiyan, Govindarajan, Kaliyappan, & Palanisamy, 2012).

2.9. Western blot analyses

The level of protein in brain tissue homogenate was estimated and was separated by SDS‐PAGE. Then proteins were transferred to polyvinylidene membranes and incubated with primary antibodies for TTP (ab83579; Abcam, Table 1) and PP2A (ab16448; Abcam, Table 1) for 12 hr. The membranes were incubated with HRP‐IgG (goat anti‐rabbit, A0545‐1ML; Sigma‐Aldrich) for 1 hr. TTP and PP2A were assessed by enhanced chemiluminescence (ECL; Zhuang, Ye, & Huang, 2017).

2.10. Determination of water content in the brain

Determining the water content in the brain could be useful for evaluating the level of brain edema. Hence, the water content of the rats' brains was measured according to Yan et al. (2013). White and red matter of brain was desiccated at 100°C for 48 hr to get constant weight. The net weight of dried 2,3,5‐triphenyltetrazolium chloride‐stained brain was obtained through the determination of desiccated white and gray matter together. The brain water content was measured by using the following formula: (Wet weight‐dried weight)/wet weight × 100%.

2.11. Statistical analyses

All experimental outcomes are presented as means and standard deviations. ANOVAs were used for comparisons. Results were considered statistically significant at p < 0.05.

2.12. Ethical approval

Animal experiments were approved by the ethical committee of Department Of neurosurgery, Heilongjiang Provincial Hospital, Harbin, Heilongjiang, 150036, China.

3. RESULTS

The neurological score decreased substantially to 8.2 in rats in which cerebral hemorrhage was induced (group II) and was further reduced to 7.4 and 7.7 in groups III and IV, respectively (p < 0.05; Figure 1). The area of infarct increased substantially by 291 mm3 in group II, whereas it decreased significantly by 215 and 221.8 mm3 in groups III and IV, respectively (data not shown). Caspase‐3 mRNA expression in the brain was determined by RT‐PCR. Caspase‐3 expression increased by 90% in group II and by 26.9% in group III (both p < 0.05; Figure 2).

Figure 1.

Figure 1

Open in a new tab

Neurological scores in the normal control (I), control (II), PP2A siRNA (III), and scrambled siRNA (IV) groups. *p < 0.05 vs. group I; # p < 0.05 vs. groups I and II (N = 6)

Figure 2.

Figure 2

Open in a new tab

Caspase‐3 mRNA expression by RT‐PCR in the normal control (I), control (II), PP2A siRNA (III), and scrambled siRNA (IV) groups. *p < 0.05 vs. group I; # p < 0.05 vs. groups I and II (N = 6)

A TUNEL assay was used to determine the rate of apoptosis. Apoptosis increased by 26.1% in rats in which cerebral hemorrhage was induced (group II) and increased significantly by 35.3% and 33.4% in groups III and IV, respectively (p < 0.05; Figure 3). Caspase‐3 protein expression in the brain tissue was determined by immunohistochemistry. Caspase‐3 expression increased substantially in group II, increased further in group III, and increased significantly in group IV (p < 0.05; Figure 4). PP2A and TTP protein expression increased significantly by 87% and 59%, as compared to their respective sham controls, respectively. However, PP2A and TTP siRNA treatment reduced the protein expression of PP2A and TTP in groups III and IV (p < 0.05; Figure 5). The water content in the brain increased significantly by 77.4% in rats in which cerebral hemorrhage was induced (group II). The water content in the brain was further increased by 84.1% and 78.7% in groups III and IV, respectively (p < 0.05; Figure 6).

Figure 3.

Figure 3

Open in a new tab

Apoptosis as determined by a TUNEL assay in the normal control (I), control (II), PP2A siRNA (III), and scrambled siRNA (IV) groups. *p < 0.05 vs. group I; # p < 0.05 vs. groups I and II (N = 6)

Figure 4.

Figure 4

Open in a new tab

Caspase‐3 protein as determined by immunohistochemistry in the normal control (I), control (II), PP2A siRNA (III), and scrambled siRNA (IV) groups. *p < 0.05 vs. group I; # p < 0.05 vs. groups I and II (N = 6)

Figure 5.

Figure 5

Open in a new tab

PP2A and TTP protein as determined by Western blotting analyses in the normal control (I), control (II), PP2A siRNA (III), and scrambled siRNA (IV) groups. *p < 0.05 vs. group I; # p < 0.05 vs. groups I and II (N = 6)

Figure 6.

Figure 6

Open in a new tab

Water content in the brain in the normal control (I), control (II), PP2A siRNA (III), and scrambled siRNA (IV) groups. *p < 0.05 vs. group I; # p < 0.05 vs. groups I and II. Values are expressed as percentages (N = 6)

4. DISCUSSION

We evaluated the protective effects of PP2A/TTP against brain edema in a rat model of cerebral hemorrhage. Cerebral hemorrhage often leads to death, particularly when the brainstem is affected (Sanders & McKenna, 2001). Xie et al. (2017) reported that inflammatory and immune responses account for the majority of damage to brain tissue during cerebral hemorrhage. We have observed that silencing TTP and PP2A leads to increased brain edema and a reduction in neurological scores at 48 hr after cerebral hemorrhage. The knockdown of TTP and PP2A reduces the levels of inflammatory cytokines such as IL‐6, TNF‐α, and IL‐8, diminishing the beneficial effects of TTP (Yin et al., 2018).

Hemphill et al. (2015) reported that the available treatments for cerebral hemorrhage include reducing blood pressure to the systolic range, normalizing blood glucose, reversing blood thinners, and performing surgery to remove the blood. Suppressing apoptosis and inflammation are the best‐known approaches for treating cerebral hemorrhage. Neuronal dysfunction and inflammation are significant pathological characteristics of cerebral hemorrhage (Guo et al., 2016; Yin et al., 2017). Levels of ILs and TNF‐α increase in cerebral hemorrhages, leading to the activation of microglia and infiltration of inflammatory cells (Chang et al., 2015; Niwa et al., 2016; Wu et al., 2016). Increased levels of cytokines have also been noted (Stoecklin & Anderson, 2006).

Brooks and Blackshear (2013) suggested that TTP is a well‐known mRNA‐binding protein that provides key regulatory molecules for gene expression. Pandiri et al. (2016) reported that TTP could play a vital role in tissue development, tumorigenesis, apoptosis, and morphogenesis. Suswam et al. (2008) highlighted the protective role of TTP against apoptosis and inflammation. Joe et al. (2015) suggested that TTP is effective at inducing inflammatory cytokines such as ILs and TNF‐α. PP2A may induce anti‐apoptotic and anti‐inflammatory activity in TTP, as it negatively regulates apoptosis, inflammation, and cell growth to protect against damage due to stroke, neurodegeneration, and cardiovascular disease (Lubbers & Mohler, 2016; Seshacharyulu, Pandey, Datta, & Batra, 2013). Mahtani et al. (2001) reported the anti‐inflammatory effects of PP2A in rheumatoid arthritis. Our experimental results are consistent with previous findings showing that silencing PP2A and TTP leads to a reduction in anti‐apoptotic and anti‐inflammatory effects.

5. CONCLUSION

Tristetraprolin has strong protective effects against brain edema by reducing inflammation, apoptosis, and the water content in the brain at 48 hr after cerebral hemorrhage in rats. Our experimental findings may be useful for developing important approaches to treating brain injury.

CONFLICT OF INTERESTS

All authors declare that they have no competing interest.

Li P, Zhang J, Li X, Gao H. Tristetraprolin attenuates brain edema in a rat model of cerebral hemorrhage. Brain Behav. 2019;9:e01187 10.1002/brb3.1187

REFERENCES

  1. Brooks, S. A. , & Blackshear, P. J. (2013). Tristetraprolin (TTP): Interactions with mRNA and proteins, and current thoughts on mechanisms of action. Biochimica Et Biophysica Acta, 1829, 666–679. 10.1016/j.bbagrm.2013.02.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Caceres, J. A. , & Goldstein, J. N. (2012). Intracranial hemorrhage. Emergency Medicine Clinics of North America, 30(3), 771–794. 10.1016/j.emc.2012.06.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chang, C. Z. , Wu, S. C. , Lin, C. L. , & Kwan, A. L. (2015). Curcumin, encapsulated in nano‐sized PLGA, down‐regulates nuclear factor kappaB (p65) and subarachnoid hemorrhage‐induced early brain injury in a rat model. Brain Research, 1608, 215–224. [DOI] [PubMed] [Google Scholar]
  4. Connolly, E. S. , Rabinstein, A. A. , Carhuapoma, J. R. , Derdeyn, C. P. , Dion, J. , Higashida, R. T. , … Vespa, P. (2012). Guidelines for the management of aneurysmal subarachnoid hemorrhage: A guideline for healthcare professionals from the American heart association/American stroke association. Stroke, 43, 1711–1737. 10.1161/STR.0b013e3182587839 [DOI] [PubMed] [Google Scholar]
  5. Duraiyan, J. , Govindarajan, R. , Kaliyappan, K. , & Palanisamy, M. (2012). Applications of immunohistochemistry. Journal of Pharmacy and Bioallied Sciences, 4, S307–S309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Fayzullina, S. , & Martin, L. J. (2014). Detection and analysis of DNA damage in mouse skeletal muscle in situ using the TUNEL method. Journal of Visualized Experiments: Jove, 94, 52211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Fujii, M. , Yan, J. , Rolland, W. B. , Soejima, Y. , Caner, B. , & Zhang, J. H. (2013). Early brain injury, an evolving frontier in subarachnoid hemorrhage research. Translational Stroke Research, 4, 432–446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Guo, Z. , Hu, Q. , Xu, L. , Guo, Z. N. , Ou, Y. , He, Y. , … Zhang, J. H. (2016). Lipoxin a4 reduces inflammation through formyl peptide receptor 2/p38 MAPK signaling pathway in subarachnoid hemorrhage rats. Stroke, 47, 490–497. 10.1161/STROKEAHA.115.011223 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Hemphill, J. C. , Greenberg, S. M. , Anderson, C. S. , Becker, K. , Bendok, B. R. , Cushman, M. , … Woo, D. (2015). American Heart Association Stroke, Council; Council on Cardiovascular and Stroke, Nursing; Council on Clinical, Cardiology. Guidelines for the management of spontaneous intracerebral hemorrhage: A Guideline for healthcare professionals from the American Heart Association/American Stroke Association. Stroke: A Journal of Cerebral Circulation, 46(7), 2032–2060. [DOI] [PubMed] [Google Scholar]
  10. Joe, Y. , Kim, S. K. , Chen, Y. , Yang, J. W. , Lee, J. H. , Cho, G. J. , … Chung, H. T. (2015). Tristetraprolin mediates anti‐inflammatory effects of carbon monoxide on lipopolysaccharide‐induced acute lung injury. American Journal of Pathology, 185, 2867–2874. 10.1016/j.ajpath.2015.07.002 [DOI] [PubMed] [Google Scholar]
  11. Lubbers, E. R. , & Mohler, P. J. (2016). Roles and regulation of protein phosphatase 2A (PP2A) in the heart. Journal of Molecular and Cellular Cardiology, 101, 127–133. 10.1016/j.yjmcc.2016.11.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Mahtani, K. R. , Brook, M. , Dean, J. L. , Sully, G. , Saklatvala, J. , & Clark, A. R. (2001). Mitogen‐activated protein kinase p38 controls the expression and posttranslational modification of tristetraprolin, a regulator of tumor necrosis factor alpha mRNA stability. Molecular and Cellular Biology, 21, 6461–6469. 10.1128/MCB.21.9.6461-6469.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Masatoshi, M. , Nobuo, O. , Shinichi, S. , Shahabuddin, A. , Jen‐Yue, T. , Peter, F. K. , & Sanai, S. (2001). The role of aldose reductase in sugar cataract formation: Aldose reductase plays a key role in lens epithelial cell death (apoptosis). Chemico‐Biological Interactions, 130–132, 617–625. [DOI] [PubMed] [Google Scholar]
  14. Niwa, A. , Osuka, K. , Nakura, T. , Matsuo, N. , Watabe, T. , & Takayasu, M. (2016). Interleukin‐6, MCP‐1, IP‐10, and MIG are sequentially expressed in cerebrospinal fluid after subarachnoid hemorrhage. Journal of Neuroinflammation, 13, 217 10.1186/s12974-016-0675-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Pandiri, I. , Chen, Y. , Joe, Y. , Kim, H. J. , Park, J. , Chung, H. T. , & Park, J. W. (2016). Tristetraprolin mediates the anti‐proliferative effects of metformin in breast cancer cells. Breast Cancer Research and Treatment, 156, 57–64. 10.1007/s10549-016-3742-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Sanders, M. J. , & McKenna, K. (2001). Mosby's Paramedic Textbook (2nd revised Ed). Chapter 22, "Head and Facial Trauma." St. Louis, MO: Mosby. [Google Scholar]
  17. Schaar, K. L. , Brenneman, M. M. , & Savitz, S. I. (2010). Functional assessments in the rodent stroke model. Experimental & Translational Stroke Medicine, 2, 13 10.1186/2040-7378-2-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Seshacharyulu, P. , Pandey, P. , Datta, K. , & Batra, S. K. (2013). Phosphatase: PP2A structural importance, regulation and its aberrant expression in cancer. Cancer Letters, 335(1), 9–18. 10.1016/j.canlet.2013.02.036 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Stoecklin, G. , & Anderson, P. (2006). Posttranscriptional mechanisms regulating the inflammatory response. Advances in Immunology, 89, 1–37. [DOI] [PubMed] [Google Scholar]
  20. Suswam, E. , Li, Y. , Zhang, X. , Gillespie, G. Y. , Li, X. , Shacka, J. J. , … King, P. H. (2008). Tristetraprolin down‐regulates interleukin‐8 and vascular endothelial growth factor in malignant glioma cells. Cancer Research, 68, 674–682. 10.1158/0008-5472.CAN-07-2751 [DOI] [PubMed] [Google Scholar]
  21. Wu, W. , Guan, Y. , Zhao, G. , Fu, X. J. , Guo, T. Z. , Liu, Y. T. , … Li, Y. Q. (2016). Elevated il‐6 and TNF‐alpha levels in cerebrospinal fluid of subarachnoid hemorrhage patients. Molecular Neurobiology, 53, 3277–3285. [DOI] [PubMed] [Google Scholar]
  22. Xie, Z. , Huang, L. , Enkhjargal, B. , Reis, C. , Wan, W. , Tang, J. , … Zhang, J. H. (2017). Intranasal administration of recombinant netrin-1 attenuates neuronal apoptosis by activating dcc/appl-1/akt signaling pathway after subarachnoid hemorrhage in rats. Neuropharmacology, 119, 123–133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Yan, J. , Manaenko, A. , Chen, S. , Klebe, D. , Ma, Q. , Caner, B. , … Zhang, J. H. (2013). Role of sch79797 in maintaining vascular integrity in rat model of subarachnoid hemorrhage. Stroke, 44, 1410–1417. 10.1161/STROKEAHA.113.678474 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Yin, C. , Huang, G. F. , Sun, X. C. , Guo, Z. , & Zhang, J. H. (2017). Dlk silencing attenuated neuron apoptosis through the jip3/ma2k7/jnk pathway in early brain injury after sah in rats. Neurobiology of Diseases, 103, 133–143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Yin, J. , Li, R. , Liu, W. , Chen, Y. , Zhang, X. , Li, X. , & Duan, C. (2018). Neuroprotective effect of protein phosphatase 2A/Tristetraprolin following subarachnoid hemorrhage in rats. Frontiers in Neuroscience, 12, 96 10.3389/fnins.2018.00096 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  26. Zhuang, Z. , Ye, G. , & Huang, B. (2017). Kaempferol alleviates the interleukin‐1β‐induced inflammation in rat osteoarthritis chondrocytes via suppression of NF‐κB. Medical Science Monitor International Medical Journal of Experimental and Clinical Research, 23, 3925–3931. 10.12659/MSM.902491 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Brain and Behavior are provided here courtesy of Wiley

RESOURCES