Skip to main content
NCBI home page
Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology logoLink to Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology
. 2018 Nov 20;43(1):39–45. doi: 10.1007/s12639-018-1052-5

J-binding protein 1 and J-binding protein 2 expression in clinical Leishmania major no response-antimonial isolates

Salman Ahmadian 1,2, Gilda Eslami 1,2,✉, Ali Fatahi 2, Saeede Sadat Hosseini 1, Mahmoud Vakili 3, Vahid Ajamein Fahadan 1,2, Mourad Elloumi 4
PMCID: PMC6423244  PMID: 30956444

Abstract

Cutaneous leishmaniasis (CL) is a major disease in many parts of the world. Since no vaccine has been developed, treatment is the best way to control it. In most areas, antimonial resistance whose mechanisms have not been completely understood has been reported. The main aim of this study is gene expression assessing of J-binging protein 1 and J-binding protein 2 in clinical Leishmania major isolates. The patients with CL from central and north Iran were considered for this study. The samples were transferred in RNAlater solution and stored in − 20 °C. RNA extraction and cDNA synthesis were performed. The gene expression analysis was done with SYBR Green real-time PCR using ∆∆CT. Written informed consent forms were filled out by patients, and then, information forms were filled out based on the Helsinki Declaration. Statistical analysis was done with SPSS (16.0; SPSS Inc, Chicago) using independent t test, Shapiro–Wilk, and Pearson’s and Spearman’s rank correlation coefficients. P ≤ 0.05 was considered significant. The gene expression of JBP1 and JBP2 had no relation with sex and age. The JBP1 gene expression was high in sensitive isolates obtained from north of the country. The JBP2 gene expression was significant in sensitive and no response-antimonial isolates from the north, but no significant differences were detected in sensitive and resistant isolates from central Iran. Differential gene expression of JBP1 and JBP2 in various clinical resistances isolates in different geographical areas shows multifactorial ways of developing resistance in different isolates.

Keywords: Cutaneous leishmaniasis, Drug resistance, JBP1, JBP2

Introduction

Leishmania is a protozoan parasite with worldwide distribution. It is the agent of leishmaniasis that has wide spectrum of manifestations, including cutaneous leishmaniasis (CL), visceral leishmaniasis (kala-azar), and muco-cutaneous leishmaniasis. CL is endemic in many parts of the world, including anthroponotic CL (ACL) and zoonotic CL (ZCL) (Yaghoobi-Ershadi et al. 2004). To date, there is no suitable vaccine, so chemotherapy is the main treatment. Pentavalent antimony (SbV) compound is the first-line treatment and is comprised of sodium stibogluconate, meglumine antimoniate, or generic formulations. Unfortunately, though, antimony resistance has occurred, especially in endemic regions (Guerin et al. 2002; Herwaldt 1999).

Drug resistance in CL may be due to several factors, including drug–host immune interaction, pharmacokinetic differentials, and the variant genetics of the agent species of Leishmania. The gene dosage may have affective results in response to drugs, including intrachromosomal rearrangements (Mukherjee et al. 2013), whole chromosome copy numbers (Downing et al. 2011), and aneuploidy (Ubeda et al. 2008). Silencing or expression of genes may be another important factor that changes the drug responses that regulate with RNA polymerase II. The final factor is under regulation of DNA modifications and synthesis of base J (β-D-glucosyl-hydroxymethyluracil) in kinetoplastida. Base J commonly localizes at terminator sites (van Luenen et al. 2012) and is critical for terminating RNA polymerase II (RNAP II) transcription which is responsible for transcription of protein-coding genes. Base J is common in either repetitive DNA, such as telomeric repeats (Gommers-Ampt et al. 1993; Genest et al. 2007) or some other regions inside the genome (van Luenen et al. 2012). Biosynthesis of base J is a potential target for chemotherapy of pathogenic kinetoplastids (Borst and Sabatini 2008).

Base J is synthesized by J-binding protein 1 (JBP1) and J-binding protein 2 (JBP2) (DiPaolo et al. 2005; Yu et al. 2007). JBP1 binds base J through the duplex DNA and then affects J levels. JBP2 does not bind to J-DNA (DiPaolo et al. 2005), but acts instead on the SWI/SNF domain (DiPaolo et al. 2005). Both JBP1 and JBP2 belong to TET/JBP subfamily of dioxygenases in that their activity depends on Fe2+ and 2-oxoglutarate (Iyer et al. 2009, Tahiliani et al. 2009). The main focus of this study was the relationship between JBP1 and JBP2 gene expression in antimonial resistance and susceptible clinical isolates of L. major.

Materials and methods

Designing

Nine clinical isolates with antimonial-resistant phenotype were obtained from patients referred to Navab Safavi Clinical Center, Isfahan, and Clinical Center of Golestan, Iran, from October 2015 to September 2018. The CL primary diagnosis was done using microscopic observation of Giemsa-stained slides. The final detection and identification were performed using internal transcribed spacer (ITS) 1-PCR–RFLP. The L. major isolates were included in this study. Each patient was informed about the project, and after agreement, was given the written informed consent form to sign in order to participate in this study. Sampling was done based on Helsinki Declaration. Another nine isolates of antimonial-sensitive L. major were included in this study for comparison with our interested isolates. Totally, 18 samples were considered for this study, including seven isolates from Navab Safavi Clinical Center, Isfahan, Central of the country (Lm1 to Lm7); and 11 samples from Clinical Center of Golestan, north of Iran (Lm8–Lm18).

Sampling

The samples obtained from the edges of skin lesions were immediately transferred into RNAlater storage solution (Merck, Darmstadt, Germany) and stored at − 20 °C for later steps. The clinical data, along with characteristics of all included patients, were collected from each patient. All studied patients were observed for 3 months in order to determine whether the L. major was antimonial-sensitive or antimonial-resistant. This study was approved by the Ethics committe from Research Vice Chancellor of the Shahid Sadoughi University of Medical Sciences, Yazd, Iran.

RNA extraction and cDNA synthesis

All 18 isolates were included for total RNA extraction using the total RNA extraction kit (Vivantis, Malaysia) based on the manufacturer’s instructions. The RNA quality and quantity were assessed using 1% agarose gel electrophoresis and spectrophotometer (Thermo Fisher Scientific, USA), respectively. Then, cDNA synthesis was performed using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA) with reverse transcriptase enzyme and primers either oligo dT or random hexamer, based on the manufacturer’s instructions.

Target genes and primers

The gene expression of JBP1 and JBP2 was assessed using SYBR Green real-time PCR. The GAPDH (Eslami et al. 2016) was considered as endogenous control in gene expression analysis. All primer pairs related to the JBP1 and JBP2 were designed using Primer3 software (Table 1) and then checked by BLAST (Altschul et al. 1997, 2005).

Table 1.

The primer name and their sequences for gene expression of JBP1, JBP2, RNAP II, and GAPDH that were used in this study

Sequences (5′–3′) Primer name
ATCTTTAACTTCCCGACCGCCA JBP1-F
CTCGCAGCACAACACCAATGAT JBP1-R
AGGACATTCTCGGCTTCACCAA GAPDHL-F
GCCCCACTCGTTGTCATACCA GAPDHL-R
CTCAACACGATGATCCAACTCTGC JBP2-F
GCCGCCATCTTCCTCGTTCTTC JBP2-R
Open in a new tab

Real-time PCR

Amplifications were reacted in a total volume of 20 μl containing 2 μl cDNA, 10 μl SYBR Green I master mix, and 200 nM each of primer (Table 1) using a Step One thermocycler (Applied Biosystem, USA). The thermal conditions of reaction were 95 °C for 10 s in order to first achieve denaturation, followed by 40 cycles of 95 °C for 10 s and 60 °C for 10 s. The final extension was done at 72 °C for 10 min. Specificity of the reaction products was confirmed by analysis of the dissociation curve using melting curve, which consisted of temperatures between 60 and 95 °C with a heating rate of 0.3 °C/s. In addition, the amplicons size in each specific primer pair was confirmed by analysis of the amplicons using 3% agarose gels in 0.5 × TBE, stained with DNA Green viewer and visualized under UV light.

Statistical analysis

Comparisons of JBP1 and JBP2 gene expression levels (showed with relative quantification (RQ) of each gene), were done using the 2^−∆∆CT method. Analysis of other characteristics was done with the independent t-test in the statistical package for the social sciences version 20 (SPSS, Version 16.0; SPSS Inc, Chicago, IL). The Shapiro–Wilk test was used to verify that the data were normally distributed. The Pearson’s and Spearman’s rank correlation coefficients were used to evaluate the correlation between normalized expression of all studied genes with the age of patients using GraphPad Prism 6.01 (GraphPad Software, Inc., San Diego, CA, USA). The p ≤ 0.05 was considered significant.

Results

The mean size of lesions in patients with no response-antimonial isolates was 11.7 ± 7.3 × 8.71 ± 5.16 cm2, but it was 2.9 ± 3.2 × 2.7 ± 3.3 cm2 in patients with antimonial-sensitive isolates. The lesion numbers in resistant cases was in the range of 1 (2 cases) to 9 (1 case), and in sensitive ranged from minimum 1 (5 cases) to maximum 4 (1 case). The samples of Lm2, Lm3, Lm5, Lm6, Lm11 and Lm12, Lm13, Lm15, Lm18 were considered as antimonial-resistant isolates. The residual ones were sensitive to antimonial therapy.

The gene expression (RQ) of JBP1 for all 18 isolates is shown in Fig. 1. Among the no response-antimonial isolates, Lm11, Lm12, Lm13, Lm15, and Lm18 were obtained from the north of Iran and the others were from the central region of the country. Among the sensitive isolates, Lm1, Lm4, and Lm7 were isolated from the central region of Iran and Lm8, Lm9, Lm10, Lm14, Lm16, and Lm17 were obtained from the north of Iran. For calculation of delta–delta CT and then RQ of the mentioned gene, Lm4 was the one isolate that was considered as the standard isolate. The gene expression analysis showed that out of 11 isolates from the north of Iran (Lm8–Lm18), just six isolates (Lm8, Lm-9, Lm10, Lm14, Lm16, Lm17) showed higher RQ for JBP1 that all of them were antimonial-sensitive (Fig. 1).

Fig. 1.

Fig. 1

Open in a new tab

The RQ of JBP1 in 12 isolates of L. major obtained from patients with cutaneous leishmaniasis (CL). The isolates of Lm2, Lm3, Lm5, Lm6, Lm11, Lm12, Lm13, Lm15

Among the isolates obtained from patients with CL in the central of Iran, the RQ of JBP1 is shown in Table 2. Statistical analysis showed that the differences in RQ of JBP1 between the resistance and sensitive groups of the isolates from the central of the country were not significant (p = 0.7654).

Table 2.

The RQ of JBP1 and JBP2 in isolates obtained from patients with cutaneous leishmaniasis (CL) from the central of the country. Lm2, Lm3, Lm5, and Lm6 were the antimonial failure isolates

Isolates
Lm1 Lm2 Lm3 Lm4 Lm5 Lm6 Lm7
RQ of JBP1 2.56 4.23 − 1.23 1 − 1.26 1.1 1.67
RQ of JBP2 2.48 − 33.33 1.35 1 2.48 1.06 2.55
Open in a new tab

The delta–delta CT method showed that the expression level of JBP1 in sensitive patients from the north of Iran was 206.15 times higher than no response-antimonial ones in same region. Moreover, statistical analysis showed that the gene expression of JBP1 gene was not significantly different between female and male patients (p = 0.28). Also, no correlation was reported between age and JBP1 gene expression (p = 0.28).

The gene expression (RQ) of JBP2 for all 18 isolates is shown in Fig. 2. Overall, JBP2 gene expression was not significantly different among the resistant and sensitive isolates observed in this study (p = 0.2470). Lm2 showed a 33.33-fold decrease in JBP2 expression. The mentioned isolate was obtained from a 10-year-old child that had been referred to the Health Centre of the central region of the country about 20 days after the onset of disease harboring three lesions.

Fig. 2.

Fig. 2

Open in a new tab

The RQ of JBP2 in 12 isolates of L. major obtained from patients with cutaneous leishmaniasis (CL). The isolates of Lm2, Lm3, Lm5, Lm6, Lm11, Lm12

Among the isolates obtained from patients with CL in central Iran, the gene expression (RQ) of JBP2 is shown in Table 2. Statistical analysis showed that the differences in RQ of JBP2 between the resistance and sensitive groups of the isolates from the central of the country were not significant (p = 0.5371).

The delta–delta CT method showed that the expression level of JBP2 in sensitive patients from the north Iran was 2.43 times higher than no response-antimonial ones in same region (p = 0.003). Moreover, statistical analysis showed that the gene expression of JBP2 was not significantly different between female and male patients (p = 0.28). Also, no correlation was shown between age and JBP2 gene expression level (p = 0.28).

Discussion and conclusion

In this study, the gene expression of JBP1 and JBP2 was analyzed among the antimonial-sensitive and no response-antimonial isolates obtained from different parts of Iran as an endemic area for ZCL, including the central and northern regions. The results showed that it is likely that JBP1 would be related to the response to antimonial drugs. JBP1 and JBP2 encode JBP1 and JBP2, respectively, whose roles are different in various kinetoplastids. Cliffe et al. (2009) reported that JBP1 and JBP2 had no effect on viability and phenotype of Trypanosoma brucei. However, Ekanayake and Sabatini (2011) showed that both genes of JBP1 and JBP2 affected on viability in T. cruzi. JBP1 has a critical role in L. tarentolae (Genest et al. 2005), and JPB2 causes differences in gene expression in Leishmania (van Luenen et al. 2012). Our results showed differences in JBP1 gene expression among the no response-antimonial isolates, too. Also, we previously showed different patterns of gene expression of AQP1 in various no response-antimonial isolates in different parts of the country (Eslami et al. 2016). We previously showed that the gene expression of AQP1 in no response-antimonial isolates in the central part of the country has higher expression of AQP1 gene in comparison with the antimonial-sensitive isolates (Eslami et al. 2016), but the no response-antimonial isolates obtained from patients with CL in the north of the country showed lower AQP1 gene expression in comparison with the sensitive ones (in press). Some other studies showed decreased gene expression of AQP1 in clinical no response-antimonial isolates (Decuypere et al. 2005; Mandal et al. 2010; Marquis et el. 2005; Mukherjee et al. 2007). Jeddi et al. (2014) showed various gene patterns in clinical no response-antimonial isolates from Mediterranean region, resulting in different metabolic pathways (Jeddi et al. 2014). They showed that just three isolates had overexpression of GSH1 and TRPER, and one isolate had overexpression of GDH1 and MRPA (Jeddi et al. 2014). They also showed that no predominant gene or pathways are involved in making drug resistance. Our study showed that the clinical no response-antimonial isolates had no dominant gene for making resistance to antimonials from the central region of the country. The resistance in isolates from the central seems to be multifactorial. These data are in accordance with the other studies (Adaui et al. 2011; Kumar et al. 2012). The other studies also showed genetic variation in L. major isolates in Iran (Eslami et al. 2014; Eslami and Salehi 2014; Eslami et al. 2011, 2012). These literatures were in agreement with our results in this study regarding the difference in gene expression in various geographical parts of the country. It seems that different JBP1 and JBP2 gene expressions in clinical isolates from different regions of the endemic area relate to different ways in transcription regulation. Based on our knowledge, kinetoplastida and especially Leishmania are the only organisms that have different ways for transcription regulation (Kramer 2012).

In this study, we showed that the sensitive isolates from the north of Iran showed the same pattern in gene expression of JBP1 and JBP2 in comparison with the no response-antimonial isolates. The higher gene expression of the mentioned genes corresponds to an increase in the J base synthesis. Higher synthesis of J base causes blockage of the RNA polymerase II protein (Hazelbaker and Buratowski 2012). Leishmania and the other trypanosomatids have unique ways for gene organization and transcription in comparison with the other eukaryotes (Campbell et al. 2003; Clayton 2002; Martinez-Calvillo et al. 2003). Based on our knowledge, three classes of nuclear RNA polymerase (RNAP) are present in eukaryotic cells, including RNAP I, II, and III. Each type of RNAP involved in different processes: RNAP I in production of 18S, 5.8S, and 28S rRNAs; RNAP II in generation of mRNAs; and RNAP III in synthesis of small essential RNAs (Lee and Young 2000; Paule and White 2000). RNAP II gene expression in Leishmania is the main RNAP for mRNA production in kinetoplastida that is under control of the number of base J production. Multidrug resistance (MDR) loci (Legare et al. 2001), AQP1 (Gourbal et al. 2004), HSP70 and HSP90 (Brochu et al. 2004; Vergnes et al. 2007), P299 (Choudhury et al. 2008), and ARM58 (Nühs et al. 2014) are the important molecules related to antimonial resistance in Leishmania spp. All of the mentioned proteins are under regulation of RNAP II. It seems that increasing the JBP1 and JBP2 genes expression level may increase J base synthesis in sensitive isolates in the north of Iran. Massive J base results in decreasing the RNAP II gene expression, following decreasing gene expression by RNAP II pathway. In this study, the isolates from the central regions of the country did not show the same events; therefore, the various pathways may involve in making no response-antimonial isolates such as findings in the other studies (Eslami et al. 2016; Kazemi-rad et al. 2013).

Overall, heterogeneous gene expressions in clinical no response-antimonial isolates showed that various genes and pathways may be involved in causing drug resistance. Therefore, it is recommended to analyze the different gene expression patterns in various geographical areas that could help for designing the program strategies for prevention and control of the disease.

Acknowledgements

The authors would like to thank the technical support from Research Center for Food Hygiene and Safety, Shahid Sadoughi University of Medical Sciences, Yazd, Iran. This research was financially supported by Shahid Sadoughi University of Medical Sciences, Yazd, Iran.

Abbreviations

CL

Cutaneous leishmaniasis (CL)

ACL

Anthroponotic cutaneous leishmaniasis

ZCL

Zoonotic cutaneous leishmaniasis

JBP

J-binding protein

RNAP II

RNA polymerase II

ITS

Internal transcribed spacer

GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

Authors’ contributions statement

GE conceived, designed, and drafted this manuscript. MV performed the statistical analysis. VA obtained the samples. AF drafted the manuscript. SSH and SA performed the laboratory techniques and quality control. ME reviewed the manuscript. All authors read and approved the final manuscript.

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflict of interest.

References

  1. Adaui V, Schnorbusch K, Zimic M, Gutiérrez A, Decuypere S, Vanaerschot M, et al. Comparison of gene expression patterns among Leishmania braziliensis clinical isolates showing a different in vitro susceptibility to pentavalent antimony. Parasitology. 2011;138:183–193. doi: 10.1017/S0031182010001095. [DOI] [PubMed] [Google Scholar]
  2. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Altschul SF, Wootton JC, Gertz EM, Agarwala R, Morgulis A, Schäffer AA, et al. Protein database searches using compositionally adjusted substitution matrices. FEBS J. 2005;272:5101–5109. doi: 10.1111/j.1742-4658.2005.04945.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Borst P, Sabatini R. Base J: discovery, biosynthesis, and possible functions. Annu Rev Microbiol. 2008;62:235–251. doi: 10.1146/annurev.micro.62.081307.162750. [DOI] [PubMed] [Google Scholar]
  5. Brochu C, Haimeur A, Ouellette M. The heat shock protein HSP70 and heat shock cognate protein HSC70 contribute to antimony tolerance in the protozoan parasite Leishmania. Cell Stress Chaperones. 2004;9:294–303. doi: 10.1379/CSC-15R1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Campbell DA, Thomas S, Sturm N. Transcription in kinetoplastid protozoa: why be normal? Microbes Infect. 2003;5:1231–1240. doi: 10.1016/j.micinf.2003.09.005. [DOI] [PubMed] [Google Scholar]
  7. Choudhury K, Zander D, Kube M, Reinhardt R, Clos J. Identification of a Leishmania infantum gene mediating resistance to miltefosine and SbIII. Int J Parasitol. 2008;38:1411–1423. doi: 10.1016/j.ijpara.2008.03.005. [DOI] [PubMed] [Google Scholar]
  8. Clayton CE. Life without transcriptional control? from fly to man and back again. EMBO J. 2002;21:1881–1888. doi: 10.1093/emboj/21.8.1881. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cliffe LJ, Kieft R, Southern T, Birkeland SR, Marshall M, Sweeney K, et al. JBP1 and JBP2 are two distinct thymidine hydroxylases involved in J biosynthesis in genomic DNA of African trypanosomes. Nucleic Acids Res. 2009;37:1452–1462. doi: 10.1093/nar/gkn1067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Decuypere S, Rijal S, Yardley V, De Doncker S, Laurent T, Khanal B, et al. Gene expression analysis of the mechanism of natural Sb (V) resistance in Leishmania donovani isolates from Nepal. Antimicrob Agents Chemother. 2005;49:4616–4621. doi: 10.1128/AAC.49.11.4616-4621.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. DiPaolo C, Kieft R, Cross M, Sabatini R. Regulation of trypanosome DNA glycosylation by a SWI2/SNF2-like protein. Mol Cell. 2005;17:441–451. doi: 10.1016/j.molcel.2004.12.022. [DOI] [PubMed] [Google Scholar]
  12. Downing T, Imamura H, Decuypere S, Clark TG, Coombs GH, Cotton JA, et al. Whole genome sequencing of multiple Leishmania donovani clinical isolates provides insights into population structure and mechanisms of drug resistance. Genome Res. 2011;21:2143–2156. doi: 10.1101/gr.123430.111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Ekanayake DK, Sabatini R. Epigenetic regulation of polymerase II transcription initiation in Trypanosoma cruzi: modulation of nucleosome abundance, histone modification, and polymerase occupancy by O-linked thymine DNA glucosylation. Eukaryot Cell. 2011;10:1465–1472. doi: 10.1128/EC.05185-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Eslami G, Salehi R. Genetic variation in RPOIILS gene encoding RNA polymerase II largest subunit from Leishmania major. Mol Biol Rep. 2014;41:2585–2589. doi: 10.1007/s11033-014-3116-7. [DOI] [PubMed] [Google Scholar]
  15. Eslami G, Frikha F, Salehi R, Khamesipour A, Hejazi H, Nilforoushzadeh MA. Cloning, expression and dynamic simulation of TRYP6 from Leishmania major (MRHO/IR/75/ER) Mol Biol Rep. 2011;38:3765–3776. doi: 10.1007/s11033-010-0492-5. [DOI] [PubMed] [Google Scholar]
  16. Eslami G, Salehi R, Khosravi S, Doudi M. Genetic analysis of clinical isolates of Leishmania major from Isfahan, Iran. J Vector Borne Dis. 2012;49:168–174. [PubMed] [Google Scholar]
  17. Eslami G, Hajimohammadi B, Jafari AA, Mirzaei F, Gholamrezai M, Anvari H, et al. Molecular identification of Leishmania tropica infections in patients with cutaneous leishmaniasis from an endemic central of Iran. Trop Biomed. 2014;31:592–599. [PubMed] [Google Scholar]
  18. Eslami G, Zarchi MV, Moradi A, Hejazi SH, Sohrevardi SM, Vakili M, et al. Aquaglyceroporin1 gene expression in antimony resistance and susceptible Leishmania major isolates. J Vector Borne Dis. 2016;53:370–374. [PubMed] [Google Scholar]
  19. Genest PA, ter Riet B, Dumas C, Papadopoulou B, van Luenen HGAM, Borst P. Formation of linear inverted repeat amplicons following targeting of an essential gene in Leishmania. Nucleic Acids Res. 2005;33:1699–1709. doi: 10.1093/nar/gki304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Genest PA, Ter Riet B, Cijsouw T, van Luenen HG, Borst P. Telomeric localization of the modified DNA base J in the genome of the protozoan parasite Leishmania. Nucleic Acids Res. 2007;35:2116–2124. doi: 10.1093/nar/gkm050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Gommers-Ampt JH, Van Leeuwen F, de Beer AL, Vliegenthart JF, Dizdaroglu M, Kowalak JA, et al. Beta-D-glucosyl-hydroxymethyluracil: a novel modified base present in the DNA of the parasitic protozoan T. brucei. Cell. 1993;75:1129–1136. doi: 10.1016/0092-8674(93)90322-H. [DOI] [PubMed] [Google Scholar]
  22. Gourbal B, Sonuc N, Bhattacharjee H, Legare D, Sundar S, Ouellette M, et al. Drug uptake and modulation of drug resistance in Leishmania by an aquaglyceroporin. J Biol Chem. 2004;279:31010–31017. doi: 10.1074/jbc.M403959200. [DOI] [PubMed] [Google Scholar]
  23. Guerin PJ, Olliaro P, Sundar S, Boelaert M, Croft SL, Desjeux P, et al. Visceral leishmaniasis: current status of control, diagnosis, and treatment, and a proposed research and development agenda. Lancet Infect Dis. 2002;2:494–501. doi: 10.1016/S1473-3099(02)00347-X. [DOI] [PubMed] [Google Scholar]
  24. Hazelbaker DZ, Buratowski S. Base J: blocking RNA polymerase’s way. Curr Biol. 2012;22:R960–R962. doi: 10.1016/j.cub.2012.10.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Herwaldt BL. Leishmaniasis. Lancet. 1999;354:1191–1199. doi: 10.1016/S0140-6736(98)10178-2. [DOI] [PubMed] [Google Scholar]
  26. Iyer LM, Tahiliani M, Rao A, Aravind L. Prediction of novel families of enzymes involved in oxidative and other complex modifications of bases in nucleic acids. Cell Cycle. 2009;8:1698–1710. doi: 10.4161/cc.8.11.8580. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Jeddi F, Mary C, Aoun K, Harrat Z, Bouratbine A, Faraut F, et al. Heterogeneity of molecular resistance patterns in antimony-resistant field isolates of Leishmania species from the Western Mediterranean area. Antimicrob Agents Chemother. 2014;58:4866–4874. doi: 10.1128/AAC.02521-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kazemi-Rad E, Mohebali M, Khadem-Erfan MB, Saffari M, Raoofian R, Hajjaran H, et al. Identification of antimony resistance markers in Leishmania tropica field isolates through a cDNA-AFLP approach. Exp Parasitol. 2013;35:344–349. doi: 10.1016/j.exppara.2013.07.018. [DOI] [PubMed] [Google Scholar]
  29. Kramer S. Developmental regulation of gene expression in the absence of transcriptional control: the case of kinetoplastids. Mol Biochem Parasitol. 2012;181:61–72. doi: 10.1016/j.molbiopara.2011.10.002. [DOI] [PubMed] [Google Scholar]
  30. Kumar D, Singh R, Bhandari V, Kulshrestha A, Negi NS, Salotra P. Biomarkers of antimony resistance: need for expression analysis of multiple genes to distinguish resistance phenotype in clinical isolates of Leishmania donovani. Parasitol Res. 2012;111:223–230. doi: 10.1007/s00436-012-2823-z. [DOI] [PubMed] [Google Scholar]
  31. Lee TI, Young RA. Transcription of eukaryotic protein-coding genes. Annu Rev Genet. 2000;34:77–137. doi: 10.1146/annurev.genet.34.1.77. [DOI] [PubMed] [Google Scholar]
  32. Legare D, Cayer S, Singh AK, Richard D, Papadopoulou B, Ouellette M. ABC proteins of Leishmania. J Bioenerg Biomembr. 2001;33:469–474. doi: 10.1023/A:1012870904097. [DOI] [PubMed] [Google Scholar]
  33. Mandal S, Maharjan M, Singh S, Chatterjee M, Madhubala R. Assessing aquaglyceroporin gene status and expression profile in antimony-susceptible and-resistant clinical isolates of Leishmania donovani from India. J Antimicrob Chemother. 2010;65:496–507. doi: 10.1093/jac/dkp468. [DOI] [PubMed] [Google Scholar]
  34. Marquis N, Gourbal B, Rosen BP, Mukhopadhyay R, Ouellette M. Modulation in aquaglyceroporin AQP1 gene transcript levels in drug-resistant Leishmania. Mol Microbiol. 2005;57:1690–1699. doi: 10.1111/j.1365-2958.2005.04782.x. [DOI] [PubMed] [Google Scholar]
  35. Martinez-Calvillo S, Yan S, Nguyen D, Fox M, Stuart KD, Myler PJ. Transcription of Leishmania major Friedlin chromosome 1 initiates in both directions within a single region. Mol Cell. 2003;11:1291–1299. doi: 10.1016/S1097-2765(03)00143-6. [DOI] [PubMed] [Google Scholar]
  36. Mukherjee A, Padmanabhan PK, Singh S, Roy G, Girard I, Chatterjee M, et al. Role of ABC transporter MRPA, γ-glutamylcysteine synthetase and ornithine decarboxylase in natural antimony-resistant isolates of Leishmania donovani. J Antimicrob Chemother. 2007;59:204–211. doi: 10.1093/jac/dkl494. [DOI] [PubMed] [Google Scholar]
  37. Mukherjee A, Boisvert S, Monte-Neto RL, Coelho AC, Raymond F, Mukhopadhyay R, et al. Telomeric gene deletion and intrachromosomal amplification in antimony-resistant Leishmania. Mol Microbiol. 2013;88:189–202. doi: 10.1111/mmi.12178. [DOI] [PubMed] [Google Scholar]
  38. Nühs A, Schäfer C, Zander D, Trübe L, Nevado PT, Schmidt S, et al. A novel marker, ARM58, confers antimony resistance to Leishmania spp. Int J Parasitol Drugs Drug Resist. 2014;4:37–47. doi: 10.1016/j.ijpddr.2013.11.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Paule MR, White RJ. Survey and summary: transcription by RNA polymerases I and III. Nucleic Acids Res. 2000;28:1283–1298. doi: 10.1093/nar/28.6.1283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Tahiliani M, Koh KP, Shen Y, Pastor WA, Bandukwala H, Brudno Y, et al. Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1. Science. 2009;324:930–935. doi: 10.1126/science.1170116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Ubeda JM, Legare D, Raymond F, Ouameur AA, Boisvert S, Rigault P, et al. Modulation of gene expression in drug resistant Leishmania is associated with gene amplification, gene deletion and chromosome aneuploidy. Genome Biol. 2008;9:R115. doi: 10.1186/gb-2008-9-7-r115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. van Luenen HG, Farris C, Jan S, Genest PA, Tripathi P, Velds A, et al. Glucosylated hydroxymethyluracil, DNA base J, prevents transcriptional readthrough in leishmania. Cell. 2012;150:909–921. doi: 10.1016/j.cell.2012.07.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Vergnes B, Gourbal B, Girard I, Sundar S, Drummelsmith J, Ouellette M. A proteomics screen implicates HSP83 and a small kinetoplastid calpain-related protein in drug resistance in Leishmania donovani clinical field isolates by modulating drug-induced programmed cell death. Mol Cell Proteomics. 2007;6:88–101. doi: 10.1074/mcp.M600319-MCP200. [DOI] [PubMed] [Google Scholar]
  44. Yaghoobi-Ershadi MR, Jafari R, Hanafi-Bojd AA. A new epidemic focus of zoonotic cutaneous leishmaniasis in central Iran. Ann Saudi Med. 2004;24:98–101. doi: 10.5144/0256-4947.2004.98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Yu Z, Genest PA, ter Riet B, Sweeney K, DiPaolo C, Kieft R, et al. The protein that binds to DNA base J in trypanosomatids has features of a thymidine hydroxylase. Nucleic Acids Res. 2007;35:2107–2115. doi: 10.1093/nar/gkm049. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology are provided here courtesy of Springer

RESOURCES