Skip to main content
Microbiology Resource Announcements logoLink to Microbiology Resource Announcements
. 2019 Mar 14;8(11):e00004-19. doi: 10.1128/MRA.00004-19

Complete Genome Sequence of the Telford Type S Strain of Mycobacterium avium subsp. paratuberculosis

Rudiger Brauning a, Karren Plain b, Milan Gautam c, Tonia Russell d, C Carolina Correa d, Patrick Biggs e, Richard Whittington b, Alan Murray f, Marian Price-Carter g,✉
Editor: Christina Cuomoh
PMCID: PMC6424202  PMID: 30938318

Mycobacterium avium subsp. paratuberculosis is the causative agent of Johne’s disease (JD).

ABSTRACT

Mycobacterium avium subsp. paratuberculosis is the causative agent of Johne’s disease (JD). Here, we report the complete genome sequence of Telford 9.2, a well-characterized representative strain of the M. avium subsp. paratuberculosis S subtype that is endemic in New Zealand and Australian sheep.

ANNOUNCEMENT

Mycobacterium avium subsp. paratuberculosis is the causative agent of Johne’s disease (JD), a chronic, generally subclinical but sometimes fatal granulomatous enteritis of ruminants (1). M. avium subsp. paratuberculosis subtype S (also called either subtype I or subtype III) has been isolated primarily from sheep but also from other ruminant species (reviewed in reference 2). Only draft genomes (3–5) of M. avium subsp. paratuberculosis type S are currently available. Here, we announce the complete genome sequence of Telford 9.2, an IS1311 type S IS900 restriction fragment length polymorphism (RFLP) type S1 strain. This is a clonal culture (passage level 5, including its primary isolation from sheep feces) of an isolate from a clinically infected sheep from New South Wales, Australia. It has been used as inoculum in an experimental model for clinical JD in sheep (6, 7), characterized genetically (8), and is representative of the M. avium subsp. paratuberculosis type endemic in Australian and New Zealand (NZ) sheep (9–11).

For Illumina and PacBio sequencing, bacterial stock was inoculated into either supplemented Middlebrook 7H9 (12) (Illumina) or M7H9C (PacBio) (13) liquid medium, cultured for 3 to 4 weeks, and then cultivated on modified Middlebrook 7H10 solid medium (12), harvested, and stored at −80°C.

Genomic DNA was prepared for both PacBio and Illumina sequencing by isopropanol precipitation and 70% ethanol wash of cetyltrimethylammonium bromide (CTAB)/phenol-chloroform-extracted cellular material after stepwise enzymatic digestion with lysozyme, RNase A, and proteinase K. For PacBio sequencing, the DNA was also digested with mutanolysin prior to proteinase K digestion and subjected to extra cleanup and concentration on Ampure PB magnetic beads.

A PacBio library was constructed and sequenced at the Ramaciotti Centre in Sydney, Australia, using P6-C4 chemistry, and sequenced to a coverage depth of 80× on the PacBio RS II platform on a single-molecule real-time (SMRT) cell. It was improved with Illumina MiSeq 250-bp paired-end (PE) reads generated by sequencing two cultures of the Telford 9.2 reference strain. MiSeq-indexed libraries were created at New Zealand Genomics Limited using Nextera XT DNA kits (Illumina, San Diego, CA). Average coverage was 120× from PacBio data and 135× from Illumina data. There were 2.5 million Illumina PE reads (909 Mbp) and 150,000 PacBio reads prefilter (555 Mbp; N50 value, 10.5 kbp). PacBio reads went through default filtering steps in SMRTPipe v1.87.139483, which reduced read numbers to 63,000 (491 Mbp; N50 value, 10.8 kbp), and were assembled using PacBio Hierarchical Genome Assembly Process v3 (HGAP3; SMRT analysis v2.3.0) into a single contig (Telford1) of the size expected for a complete M. avium subsp. paratuberculosis genome and with a GC content of 69.2%, which is typical of M. avium subsp. paratuberculosis (3–5, 14). The PacBio-based assembly was improved by removing a 9-kbp overlap between the start and the end of the genome, orienting the genome with the start position at the beginning of the dnaA gene and mapping Illumina reads onto the PacBio assembly to detect and repair small-scale variations, as described in Table 1.

TABLE 1.

Discrepancies between Illumina and PacBio dataa

Position before fix Variant type Accepted solution PacBio allele Illumina allele Applied fix
780880b Indel Illumina T TG Insertion
931746 SNP PacBio C G na
1112469 Indel Illumina GCCCCC GCCCCCC Insertion
1302183 Indel Illumina AGGGG AGGGGG Insertion
1969375 Indel Illumina GCCCCC GCCCCCC Insertion
2128150 Indel Illumina ACCCCC ACCCCCC Insertion
2276090 Indel Illumina CGGGGG CGGGGGG Insertion
2577759 SNP PacBio G A na
2635929 Indel Illumina GCCCC GCCCCC Insertion
2642118 SNP PacBio C T na
2705636 Indel Illumina GCCCCC GCCCCCC Insertion
3024648 Indel Illumina T TC Insertion
3201490 SNP PacBio C G na
3201602 SNP PacBio A G na
3211597 Indel Illumina CGGGGGGG CGGGGGGGG Insertion
3450836 Indel PacBio CATCGTCGCGCCGTGCTGGGCGGCCAGCGCGTCGCCGACCAGGCTGCGCGCCGGCTCGACGCGCCGCGCGGCCCGCAGCGCCTGCTGGG C na
4313098 SNP Illumina N G Base change
4314018 Indel Illumina GTTT GTT Deletion
4318473 Indel Illumina AC A Deletion
4319018 Indel Illumina AC A Deletion
4319236 Indel Illumina GTTT GTT Deletion
4319286 Indel Illumina CGGGG CGGG Deletion
4320148 Indel Illumina ACGCGCGC ACGCGC Deletion
4371898 SNP PacBio G T na
4416918 Indel PacBio CCGTTCGGCGCCGAGCGTCACGCCAGCGTGGCGCTCGCGGGCCGGCGCCACGCTGGCGTGACG CCG na
4421523 Indel Illumina GCCCC GCCCCC Insertion
4572001 SNP PacBio G A na
4594338 Indel Illumina ACCCC ACCCCC Insertion
a

Illumina reads were mapped onto the PacBio assembly using BWA-MEM (17) v0.7.17-r1188 with parameter “-M,” and then variants (SNPs and indels) were detected (SAMtools [18] v1.3 with parameters “view -q 30 -F 256,” SAMtools v1.3 with parameters “mpileup -t DP,AD,” BCFtools v0.1.16 with parameters “call –cv,” BCFtools v0.1.16 with parameters “view -M2”). For each variant, a read depth greater than 10 was required, and a visual check of mapq values as well as the reference and alternative allele counts was performed. As a result of this analysis, for SNPs the PacBio alleles were accepted, for short indels the Illumina alleles were accepted, and for longer indels the PacBio alleles were accepted. All variants were verified by comparing 200 bp of flanking sequence (centered on the variants) to very closely related map strains (3, 4) using the “map to a reference” function in Geneious (19) and also comparing this fragment to M. avium subsp. paratuberculosis strains included in NCBI taxid 1770 using the NCBI BLAST service with default settings. SNP, single nucleotide polymorphism; na, no action.

b

For the indel at position 780880, the Telford1 sequence differed from closely related strains in both PacBio and Illumina alleles; Sanger sequencing confirmed the Illumina call.

Telford1 has a sequence length of 4,907,428 bases, 4,377 coding sequences as predicted with the NCBI Prokaryotic Genome Annotation Pipeline (15), and an in silico IS1311 type S IS900 RFLP type S1 type (16).

Data availability.

The genome assembly is available at GenBank under accession number CP033688 and the BioProject accession number PRJNA504678; raw data are available under SRA accession numbers SRX4997502 (Illumina) and SRX4997501 (PacBio), and in silico typing results can be found at https://doi.org/10.6084/m9.figshare.7635977.

ACKNOWLEDGMENTS

We thank Rebecca Maurer for her technical assistance with extraction of DNA for PacBio analysis.

Funding for this work was from a Merial SAS grant, Massey University project number RM16643.

REFERENCES

  • 1.Garcia AB, Shalloo L. 2015. Invited review: the economic impact and control of paratuberculosis in cattle. J Dairy Sci 98:5019–5039. doi: 10.3168/jds.2014-9241. [DOI] [PubMed] [Google Scholar]
  • 2.Stevenson K. 2015. Genetic diversity of Mycobacterium avium subspecies paratuberculosis and the influence of strain type on infection and pathogenesis: a review. Vet Res 46:64. doi: 10.1186/s13567-015-0203-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Mobius P, Holzer M, Felder M, Nordsiek G, Groth M, Kohler H, Reichwald K, Platzer M, Marz M. 2015. Comprehensive insights in the Mycobacterium avium subsp. paratuberculosis genome using new WGS data of sheep strain JIII-386 from Germany. Genome Biol Evol 7:2585–2601. doi: 10.1093/gbe/evv154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bannantine JP, Wu CW, Hsu C, Zhou S, Schwartz DC, Bayles DO, Paustian ML, Alt DP, Sreevatsan S, Kapur V, Talaat AM. 2012. Genome sequencing of ovine isolates of Mycobacterium avium subspecies paratuberculosis offers insights into host association. BMC Genomics 13:89. doi: 10.1186/1471-2164-13-89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Wynne JW, Bull TJ, Seemann T, Bulach DM, Wagner J, Kirkwood CD, Michalski WP. 2011. Exploring the zoonotic potential of Mycobacterium avium subspecies paratuberculosis through comparative genomics. PLoS One 6:e22171. doi: 10.1371/journal.pone.0022171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Begg DJ, de Silva K, Di Fiore L, Taylor DL, Bower K, Zhong L, Kawaji S, Emery D, Whittington RJ. 2010. Experimental infection model for Johne's disease using a lyophilised, pure culture, seedstock of Mycobacterium avium subspecies paratuberculosis. Vet Microbiol 141:301–311. doi: 10.1016/j.vetmic.2009.09.007. [DOI] [PubMed] [Google Scholar]
  • 7.Dukkipati VSR, Ridler AL, Thompson KG, Buddle BM, Hedgespeth BA, Price-Carter M, Begg DJ, Whittington RJ, Gicquel B, Murray A. 2016. Experimental infection of New Zealand Merino sheep with a suspension of Mycobacterium avium subspecies paratuberculosis (Map) strain Telford: kinetics of the immune response, histopathology and Map culture. Vet Microbiol 195:136–143. doi: 10.1016/j.vetmic.2016.09.018. [DOI] [PubMed] [Google Scholar]
  • 8.Marsh IB, Bannantine JP, Paustian ML, Tizard ML, Kapur V, Whittington RJ. 2006. Genomic comparison of Mycobacterium avium subsp. paratuberculosis sheep and cattle strains by microarray hybridization. J Bacteriol 188:2290–2293. doi: 10.1128/JB.188.6.2290-2293.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Verdugo C, Pleydell E, Price-Carter M, Prattley D, Collins D, de Lisle G, Vogue H, Wilson P, Heuer C. 2014. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis isolated from sheep, cattle and deer on New Zealand pastoral farms. Prev Vet Med 117:436–446. doi: 10.1016/j.prevetmed.2014.09.009. [DOI] [PubMed] [Google Scholar]
  • 10.Gautam M, Ridler A, Wilson PR, Heuer C. 2018. Control of clinical paratuberculosis in New Zealand pastoral livestock. N Z Vet J 66:1–8. doi: 10.1080/00480169.2017.1379914. [DOI] [PubMed] [Google Scholar]
  • 11.Whittington RJ, Hope AF, Marshall DJ, Taragel CA, Marsh I. 2000. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis: IS900 restriction fragment length polymorphism and IS1311 polymorphism analyses of isolates from animals and a human in Australia. J Clin Microbiol 38:3240–3248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Whittington RJ. 2010. Cultivation of Mycobacterium avium subspecies paratuberculosis, p 244–266. In Behr M, Collins D (eds), Paratuberculosis: organism, disease, control. CABI, Wallingford, United Kingdom. [Google Scholar]
  • 13.Whittington RJ, Whittington A-M, Waldron A, Begg DJ, de Silva K, Purdie AC, Plain KM. 2013. Development and validation of a liquid medium (M7H9C) for routine culture of Mycobacterium avium subsp. paratuberculosis to replace modified Bactec 12B medium. J Clin Microbiol 51:3993–4000. doi: 10.1128/JCM.01373-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Li L, Bannantine JP, Zhang Q, Amonsin A, May BJ, Alt D, Banerji N, Kanjilal S, Kapur V. 2005. The complete genome sequence of Mycobacterium avium subspecies paratuberculosis. Proc Natl Acad Sci U S A 102:12344–12349. doi: 10.1073/pnas.0505662102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.NCBI. 2013. NCBI Prokaryotic Genome Annotation Pipeline. https://www.ncbi.nlm.nih.gov/genome/annotation_prok/. [DOI] [PMC free article] [PubMed]
  • 16.Price-Carter M, Whittington RJ. 2019. In silico typing of Telford. Figshare 10.6084/m9.figshare.7635977.v1. [DOI] [Google Scholar]
  • 17.Li H, Durbin R. 2010. Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics 26:589–595. doi: 10.1093/bioinformatics/btp698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Li H. 2011. A statistical framework for SNP calling, mutation discovery, association mapping and population genetical parameter estimation from sequencing data. Bioinformatics 27:2987–2993. doi: 10.1093/bioinformatics/btr509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28:1647–1649. doi: 10.1093/bioinformatics/bts199. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The genome assembly is available at GenBank under accession number CP033688 and the BioProject accession number PRJNA504678; raw data are available under SRA accession numbers SRX4997502 (Illumina) and SRX4997501 (PacBio), and in silico typing results can be found at https://doi.org/10.6084/m9.figshare.7635977.


Articles from Microbiology Resource Announcements are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES