Skip to main content
NCBI home page
Molecular Plant Pathology logoLink to Molecular Plant Pathology
. 2018 Oct 11;20(1):69–77. doi: 10.1111/mpp.12740

Involvement of lipid transfer proteins in resistance against a non‐host powdery mildew in Arabidopsis thaliana

Per Fahlberg 1, Nathalie Buhot 1, Oskar N Johansson 1, Mats X Andersson 1,✉
PMCID: PMC6430466  PMID: 30102837

SUMMARY

Non‐specific lipid transfer proteins (LTPs) are involved in the transport of lipophilic compounds to the cuticular surface in epidermal cells and in the defence against pathogens. The role of glycophosphatidylinositol (GPI)‐anchored LTPs (LTPGs) in resistance against non‐host mildews in Arabidopsis thaliana was investigated using reverse genetics. Loss of either LTPG1, LTPG2, LTPG5 or LTPG6 increased the susceptibility to penetration of the epidermal cell wall by Blumeria graminis f. sp. hordei (Bgh). However, no impact on pre‐penetration defence against another non‐host mildew, Erysiphe pisi (Ep), was observed. LTPG1 was localized to papillae at the sites of Bgh penetration. This study shows that, in addition to the previously known functions, LTPGs contribute to pre‐invasive defence against certain non‐host powdery mildew pathogens.

Keywords: Arabidopsis thaliana, lipid transfer proteins, non‐host resistance, powdery mildew

Introduction

Although plants are constantly exposed to potential pathogens, few plants are ever actually successfully colonized by pathogens. As a result of incompatibilities between the pathogen and the plant, most plants are resistant to most pathogens. This type of resistance, in which all cultivars of a certain plant species are immune to all pathovars of a certain pathogen, is known as non‐host resistance (NHR) (Thordal‐Christensen, 2003), and depends on both the constitutive barriers of the plant and inducible defences (Lipka et al., 2008). The recognition of so‐called microbe‐associated molecular patterns (MAMPs), which are conserved molecules present in large groups of microorganisms, leads to defence reactions in plant cells (Tsuda and Somssich, 2015). The interactions between Arabidopsis thaliana (hereafter Arabidopsis) and the non‐adapted powdery mildew fungus Blumeria graminis f. sp. hordei (Bgh) have been established as a model system for NHR (Micali et al., 2008; Thordal‐Christensen, 2003). When a powdery mildew conidial spore germinates on the leaf surface, a specialized structure, the appressorium, is used by the fungus to penetrate the cuticle and the underlying cell wall. Many non‐host powdery mildews are perceived by the plant as they attempt to penetrate the cell wall, and the epidermal cell responds by defending itself against the attacker. This defence usually comprises the accumulation of the polysaccharide callose, phenolic compounds and other antimicrobial chemicals adjacent to the penetration point, producing a thick reinforcement of the cell wall, known as a papilla, a physical barrier with a built‐in chemical defence (Hardham et al., 2007; Hückelhoven, 2007), which successfully stops most spores from infecting. The few spores that successfully penetrate the cell and proceed to produce the haustorial feeding structure will usually trigger additional plant defences. The haustorium may then be encased in callose to prevent it from growing and the epidermal cell wall will ultimately undergo programmed cell death (PCD) (Lipka et al., 2008). Normally, most of the Bgh spores will not succeed in penetrating the epidermal cells of Arabidopsis and, in the minority of occasions in which penetration succeeds, the infection is stopped by callose encasement and PCD (Collins et al., 2003; Lipka et al., 2005; Micali et al., 2008; Stein et al., 2006). Forward genetic screens have identified mutations in three different genes that result in a higher ratio of successful penetrations by Bgh: the penetration mutants pen1 (Collins et al., 2003), pen2 (Lipka et al., 2005) and pen3 (Stein et al., 2006). These genes are involved in defence against powdery mildews through at least two different pathways (Hückelhoven and Panstruga, 2011), both probably triggered by the recognition of MAMPs. PEN1 is a syntaxin that is involved in the formation of the papilla through the secretion of exosomes (Nielsen and Thordal‐Christensen, 2013). PEN2 is believed to produce active substances by the hydrolysis of indole glucosinolates (Bednarek et al., 2009; Lipka et al., 2005), which PEN3, an ABC transporter localized at the plasma membrane (Stein et al., 2006), is thought to deliver into the apoplast to hinder fungal infection.

Lipid transfer proteins (LTPs) belong to a large multigene family present in all land plant species. The Arabidopsis genome contains more than 50 members (Boutrot et al., 2008; Edstam et al., 2011). LTPs are small (7–10.5 kDa) basic proteins with a high content of α‐helices stabilized with a common eight‐cysteine (Cys) motif, with the general form: C‐Xn‐C‐Xn‐CC‐Xn‐CXC‐Xn‐C‐Xn‐C (Kader, 1997; Liu et al., 2015). All LTPs have a hydrophobic cavity which can bind various lipids and other non‐polar compounds (Charvolin et al., 1999). The in vivo functions of plant LTPs are generally not well understood, but they are implicated in several important processes in plants. These include seed development and pollen germination (Edstam and Edqvist, 2014), and cutin and wax metabolism (de Oliveira Carvalho and Gomes, 2007; DeBono et al., 2009; Kader, 1997; Liu et al., 2015). The Arabidopsis LTP2 apparently contributes to the overall organization of the cuticle in Arabidopsis hypocotyls (Jacq et al., 2017). In addition, LTPs play a major role in biotic and abiotic stresses (Liu et al., 2015; Yeats and Rose, 2008). Several LTPs are known to have direct antimicrobial activity (Finkina et al., 2016; Segura et al., 1993; Zottich et al., 2011). The LTP DIR1 is linked to long‐distance signalling in the establishment of systemic acquired resistance (Champigny et al., 2013; Maldonado et al., 2002). LTPs are synthesized with an N‐secretory signalling peptide, targeting them to the plant apoplast (Liu et al., 2015). LTPs have been historically classified into two types: LTP1 type I of approximately 9 kDa and LTP2 type II of approximately 7 kDa. A new classification system introduced by Edstam et al. (2011), based on sequence similarity, molecular weight, the presence or absence of a glycophosphatidylinositol (GPI) modification site, the position of a conserved intron and spacing between the Cys residues in the eight‐Cys motif, has led to ten subfamilies of proteins (Edstam et al., 2011; Liu et al., 2015; Salminen et al., 2016). Overexpression of antimicrobial LTPs in planta often results in enhanced resistance to selected pathogens. A recent study, for instance, has shown that it is possible to modulate the response to clubroot disease in Arabidopsis using mutants or transgenic plants with modified levels of selected LTPs (Julke and Ludwig‐Muller, 2015).

GPI‐anchored LTPs (LTPGs) represent a subgroup of LTPs (Edstam et al., 2011). The GPI anchor presumably attaches these proteins to the plasma membrane facing the apoplast. Previous studies have indicated that the Arabidopsis LTPG1 (DeBono et al., 2009; Kim et al., 2012; Lee et al., 2009) and LTPG2 (Kim et al., 2012) contribute to the accumulation of cuticular lipids, with LTPG1 also being involved in protection against Alternaria brassicicola (Lee et al., 2009). Analysis of the transcriptional regulation of the 34 LTPGs encoded by the Arabidopsis genome placed several of them into three distinct clusters (Edstam et al., 2013).

Given the importance of the outer perimeter defence, it seems reasonable to believe that components involved in cuticle composition, such as LTPGs, could play a role in NHR against powdery mildews. In this study, we investigated the roles of Arabidopsis LTPGs in penetration resistance against the non‐host powdery mildews Bgh and Erysiphe pisi (Ep).

Results

Loss of function of LTPG1, LTPG2, LTPG5 and LTPG6 leads to decreased pre‐penetration resistance against Bgh

As LTPGs are linked to pathogen resistance and processes at the epidermal surface, and all appear to have an apoplastic localization, we decided to test their involvement in NHR in Arabidopsis. To this end, a panel of T‐DNA insertion lines for six known Arabidopsis LTPGs was obtained (Fig. S1; Table S1, see Supporting Information). Mutant lines representing at least one LTPG gene found in each distinct transcriptional cluster, as reported previously (Edstam et al., 2013), were selected. The loss of the respective transcripts in these different lines, except the ltpg4‐3 and ltpg6‐3 mutants, has been reported previously (Edstam and Edqvist, 2014; Kim et al., 2012). The ltpg5‐1 line has a T‐DNA insertion in the 5′‐untranslated region, and expression of the gene is reportedly knocked down to approximately half of that found in the wild‐type (Edstam and Edqvist, 2014).

The mutant lines were inoculated with Bgh or Ep, and the number of germinated spores which successfully penetrated the epidermal cell wall was determined at 3 days after inoculation (Fig. 1). The ltpg1‐1, ltpg1‐2, ltpg2‐1, ltpg5‐1 and ltpg6‐3 mutants all demonstrated an increased frequency of successful penetrations by Bgh compared with the wild‐type Col‐0 (Fig. 1A). This phenotype was strongest for the ltpg1‐1 and ltpg2‐1 mutants, which displayed an almost doubled penetration frequency of Bgh compared with the wild‐type.

Figure 1.

Figure 1

Open in a new tab

Effects of loss of glycophosphatidylinositol (GPI)‐anchored lipid transfer proteins (LTPGs) on non‐host resistance. The indicated lines were inoculated with Blumeria graminis f. sp. hordei (Bgh) (A, C) or Erysiphe pisi (Ep) (B) and the penetration frequency was determined at 3 days post‐inoculation (dpi). The average and standard deviation of three replicates are shown. Letters denote statistically significantly different groups (P < 0.05) as determined by one‐way analysis of variance (ANOVA) (n = 6 for A and B, n = 3 for C).

The ltpg3‐1 and ltpg4‐3 knockouts did not display any difference in penetration resistance to Bgh when compared with the wild‐type. None of the tested mutants displayed any significant difference in penetration resistance to the pea powdery mildew Ep (Fig. 1B). As the ltpg1‐1 and ltpg2‐1 mutants displayed the largest decrease in penetration resistance to Bgh, a double mutant was tested (Fig. 1C). However, the double mutant ltpg1‐1 ltpg2‐1 demonstrated the same increase in Bgh penetration compared with the wild‐type as the single ltpg1‐1 and ltpg2‐1 mutants. In addition, the ltpg1‐1 mutant was tested with the adapted powdery mildew Golovinomyces cichoracearum. The mutant did not display any change in overall disease progress and penetration frequency compared with the wild‐type.

Loss of LTPG1 does not have an additive effect on the loss of pre‐invasive defence in the pen1 and pen3 mutations

To investigate the genetic relationship between LTPG1 and the known mediators of penetration resistance, PEN1 and PEN3, the double mutants ltpg1‐1 pen1‐1 and ltpg1‐1 pen3‐1 were generated and inoculated with Bgh. Neither of the double knockout mutants ltpg1‐2 pen1‐1 or ltpg1‐2 pen3‐1 demonstrated any increase in penetration frequency compared with the single pen1‐1 or pen3‐1 mutations alone (Fig. 2).

Figure 2.

Figure 2

Open in a new tab

Effects of combined loss of glycophosphatidylinositol (GPI)‐anchored lipid transfer proteins (LTPGs) and PENs on the penetration resistance against Blumeria graminis f. sp. hordei (Bgh). The indicated lines were inoculated with Bgh and the penetration frequency was determined at 3 days post‐inoculation (dpi). The average and standard deviation of three replicates are shown. Letters denote statistically significantly different groups (P < 0.05) as determined by one‐way analysis of variance (ANOVA) (n = 6).

Large bulk changes in wax load or composition do not affect pre‐penetration defence

To test whether the bulk epicuticular wax load and composition had an impact on the penetration resistance, the cer1 and cer4 mutants were analysed for their ability to restrict the penetration of Bgh. The CER1 gene encodes a putative fatty aldehyde reductase and the mutant displays severely reduced epicuticular wax load, in particular reductions in alkanes, secondary alcohols and ketones (Hannoufa et al., 1993; Samuels et al., 2008). The CER4 gene encodes a fatty acyl‐CoA reductase which is involved in the synthesis of the long‐chain primary fatty alcohols of the epicuticular wax (Rowland et al., 2006). Loss of CER4 removes almost all formation of primary fatty alcohols in stems and leaves (Rowland et al., 2006). The cer1‐1 and cer4‐3 mutants, however, did not show a significantly increased penetration frequency of Bgh compared with the wild‐type (Fig. 3). This indicates that bulk changes in epicuticular wax load or composition are probably not responsible for the increased penetration frequency found in the ltpg mutants. The analysis of leaf wax load and composition in the ltpg mutants revealed no specific changes in total wax load or composition that coincided with the penetration phenotype (Fig. S2, see Supporting Information).

Figure 3.

Figure 3

Open in a new tab

Effects of loss of CER4 (A) or CER1 (B) on non‐host resistance. The indicated lines were inoculated with Blumeria graminis f. sp. hordei (Bgh) and the penetration frequency was determined at 3 days post‐inoculation (dpi). The average and standard deviation of three replicates are shown. Letters denote statistically significantly different groups (P < 0.05) as determined by one‐way analysis of variance (ANOVA) (n = 6).

Localization of LTPG1 to sites of interaction with the non‐host powdery mildew Bgh

To further investigate the role of LTPG1 in penetration defence against Bgh, we used a yellow fluorescent protein (YFP)‐tagged LTPG1 protein with a native promoter in the ltpg1‐2 background (DeBono et al., 2009). The YFP fusion construct clearly complemented the penetration phenotype of ltpg1‐2 (Fig. 4C). The localization of the YFP fusion construct was investigated using confocal microscopy of uninfected and material infected with Bgh (Fig. 4A) or Ep (Fig. 4B). YFP‐LTPG1 in uninfected cells was predominantly localized next to the borders of adjoining epidermal cells, consistent with previous reports (Ambrose et al., 2013; DeBono et al., 2009). At 1 day post‐inoculation (dpi) with Bgh or Ep, YFP‐LTPG1 was found to localize to sites of attempted penetration by the fungal appressoria. Reconstruction in three dimensions of the captured images in Z‐stacks shows that YFP‐LTPG1 localizes around the forming papilla at attempted Bgh penetration sites (Fig. 4D).

Figure 4.

Figure 4

Open in a new tab

Localization of glycophosphatidylinositol (GPI)‐anchored lipid transfer protein 1 (LTPG1) during penetration resistance. Tissues were investigated by confocal microscopy at 24 h post‐inoculation (hpi) with Blumeria graminis f. sp. hordei (Bgh) (A) or Erysiphe pisi (Ep) (B) to visualize the fungal structures stained with FM 4‐64 (red channel), yellow fluorescent protein (YFP) (yellow channel) and bright field (BF). Scale bars denote 5 µm. The indicated lines were inoculated with Bgh and the percentage of germinated spores was determined at 3 days post‐inoculation (dpi) (C). Bars not annotated with the same letter are significantly different (P < 0.05) as determined by one‐way analysis of variance (ANOVA) (n = 3). Error bars denote the standard deviation from the mean. (D) Three‐dimensional reconstruction of YFP‐LTPG1 accumulation around the papilla formed as a defence against invading Bgh hyphae at 24 hpi. Fungal structures are stained with FM 4‐64 (red channel) and YFP fluorescence is shown in yellow. [Color figure can be viewed at wileyonlinelibrary.com]

Discussion

Penetration resistance against non‐host powdery mildews in Arabidopsis has been linked previously to at least two different pathways: transcytosis involving the syntaxin PEN1 (Nielsen and Thordal‐Christensen, 2013), and the synthesis and secretion of toxic metabolites through the action of PEN2, PEN3 and several other biosynthetic enzymes (Bednarek, 2012). In addition, phospholipase D (Pinosa et al., 2013) has been linked to MAMP recognition inducing penetration resistance and, recently, a potential second exocytotic pathway has been implicated in penetration resistance (Nielsen et al., 2017). This study shows that penetration resistance to Bgh is partially conferred by the presence of LTPG1, LTPG2, LTPG5 and LTPG6. Interestingly, although the previously described PEN pathways are active against both Bgh and Ep, the loss of penetration resistance in the ltpg mutants was evident only in defence against Bgh. This points to an interesting difference in the defence reactions against the two different non‐host mildews. Important differences in the ability of Arabidopsis to resist these two different pathogens have been highlighted previously using the double mutant pen3 eds1, in which the double mutant allows Ep to complete its life cycle, whereas NHR is maintained against Bgh (Stein et al., 2006). Thus, there might be important differences in how Arabidopsis senses and responds to these pathogens during the two superficially similar defence reactions to Ep and Bgh. Interestingly, loss of LTPG1 has no additive effect to the loss of penetration resistance against Bgh in the pen1 and pen3 mutants. The most straightforward explanation of this is that LTPGs contribute to activation of both penetration resistance pathways described previously. This needs to be taken into account in hypotheses describing exactly how LTPGs contribute mechanistically to penetration resistance. At this point, a definite mechanistic explanation of how LTPGs in Arabidopsis confer penetration resistance against Bgh cannot be provided. However, the presented findings allow a few possible hypotheses to be proposed.

It has been shown that the amount of very‐long‐chain aldehydes promotes both the germination and differentiation of Bgh conidia (Hansjakob et al., 2010). Hexacosanal, found in the epicuticular wax layer of barley, has been found to be the most effective aldehyde in this respect. Several other studies have reported that such very‐long‐chain aldehydes are important for the pre‐penetration processes of powdery mildews (Hansjakob et al., 2011; Weis et al., 2014). Changes in such compounds could provide an explanation for the penetration phenotype displayed by LTPGs with Bgh. The ltpg1 mutants possess a reduced content of C29 alkane (nonacosane) in the epicuticular wax of stems and siliques (DeBono et al., 2009; Lee et al., 2009), but no difference in this or the total wax load has been reported for the leaf epidermis (Kim et al., 2012; Lee et al., 2009). The wax analysis performed in this study did not provide any results that could be connected with the penetration phenotype. Thus, the composition of cuticular wax does not appear to be the primary reason for the penetration phenotype of the lptg mutants. In addition, the lack of penetration phenotype of the cer4 and cer1 mutants also indicates that the long‐chain fatty alcohols and the total wax load are of very minor importance for the penetration resistance against Bgh. Although we found no difference in the wax profile that could explain the penetration phenotype, it cannot be ruled out that subtle differences in minor components might play a role in the penetration resistance processes. Some LTPs have been shown to have direct anti‐pathogenic effects in vitro (Cammue et al., 1995); this could also be the case for the Arabidopsis LTPGs. However, this hypothesis would be more difficult to reconcile with the very high specificity of Bgh penetration resistance shown by the ltpg mutants.

The loss of several LTPGs resulted in similar phenotypic effects on the penetration resistance, and the combination of two mutants caused no further increase. It has been suggested that LTPGs can be classified into co‐expression modules reflecting genes involved in the same biological processes (Edstam et al., 2013). For example, LTPG1, LTPG2 and LTPG6 form the Arabidopsis module AtI involved in the deposition and biosynthesis of cuticular waxes or cutin. We showed that the penetration resistance to Bgh is partially conferred by the presence of LTPG1, LTPG2 and LTPG6. It has been shown previously that the role of LTPG1 in the export of epicuticular wax overlaps with that of LTPG2 (Kim et al., 2012). Thus, higher order mutants or other combinations of loss‐of‐function mutations in LTPGs might demonstrate a stronger phenotype in penetration resistance. Interestingly, other LTPGs (LTPG3 and LTPG4) that could be linked to sporopollenin biosynthesis in pollen grains (Edstam et al., 2013) did not show any increase in penetration resistance to Bgh, suggesting an additional function in defence for LTPG1, LTPG2 and LTPG6 present at the plant–fungus interface. It could also be construed that the phenotype is caused by a threshold effect; a certain amount of LTPGs must be present to confer an effect on penetration resistance, and the loss of just a portion causes the protein level to drop below the threshold. Thus, any additional loss of LTPGs of the same function would cause no additional loss of penetration resistance.

As LTPGs are most probably apoplastic, it is possible that these proteins function by binding to substances in the fungal membrane on the penetration peg, facilitating the transport of other substances to that site. Alternatively, LTPGs could function as reporters or as part of signal transduction when they encounter and bind to fungal membranes or components, which could then be presented to MAMP receptors in the plasma membrane. This hypothesis represents a single explanation most easily compatible with the difference in effect on penetration resistance between Bgh and Ep, as well as the lack of additive effect of ltpg double mutants and double mutants with pen1 and pen3.

A fusion construct of YFP and LTPG1 clearly localizes at the site of formation of papillae during interactions with both Ep and Bgh. It would also be interesting to investigate the localization of the other LTPGs during the penetration resistance reaction. An interesting question is how LTPG1 accumulates around the papillae. Is this an active process or is it achieved passively by changes in the geometry of the apoplastic space caused by the attempted penetration of the powdery mildew? According to the ‘balloon in a box model’ (Ambrose et al., 2013), the YFP‐LTPG1 proteins could accumulate at locations at which there is a widening between the plasma membrane and cell wall. As the penetration peg pushes down on the cell wall, there would be an increased apoplastic space around the point of attempted penetration, in which YFP‐LTPG1 could accumulate. If the penetration peg breaks through, it will push down on the plasma membrane to form a haustorium, creating even more space around itself in the apoplast. An alternative route for the accumulation of LTPG1 at the papillae would be to follow the transcytosis route described for several other proteins (PEN1 for example) to the papillae (Nielsen and Thordal‐Christensen, 2013). Further studies are required to investigate this in more detail. It would also be of great interest to investigate the role of the GPI anchor of LTPGs in penetration resistance.

To conclude, it is clear that several closely related Arabidopsis LTPG proteins function in penetration resistance against the non‐host powdery mildew Bgh, but not against the other non‐host mildew Ep. Further analysis of the molecular details of the LTPGs and their involvement in other defence processes might shed more light on the details of this.

Experimental Procedures

Plant material and genotyping of mutants

Arabidopsis lines were cultivated in climate chambers (CLF Plant Climatics GmbH, Wertingen, Germany) with short‐day conditions (8 h, 120 µE light, 22 °C, 60% humidity, day; 18 °C, night) in soil premixed with perlite (S‐jord, Hasselfors Garden, Örebro, Sweden; https://www.hasselforsgarden.se/) with added nutrients (‘Blomstra’, Cederoth International, Upplands Väsby, Sweden; https://www.cederroth.com/en/), diluted according to the manufacturer’s instructions.

Seeds for T‐DNA insertion mutants of SALK (Alonso et al., 2003) and SAIL (Sessions et al., 2002) type were acquired from the Nottingham Arabidopsis Stock Centre (NASC) (Scholl et al., 2000), unless stated otherwise (Table S1). DNA extractions were performed using the protocol of Edwards et al. (1991), and T‐DNA insertions were confirmed by polymerase chain reaction using Platinum Taq polymerase (Clontech Laboratories, Mountain View, CA, USA; https://www.clontech.com/) with T‐DNA left border primers for SALK (LBb1.3; 5′‐ATTTTGCCGATTTCGGAAC‐3′) or SAIL (LB3; 5′‐TAGCATCTGAATTTCATAACCAATCTCGATACAC‐3′), combined with gene‐specific primers (Table S1), according to the manufacturer’s instructions, except only one‐quarter of the recommended amount of polymerase was used.

The single ltpg1‐1 and ltpg2‐1 mutants, and the double ltpg1‐1 ltpg2‐1 knockout mutant, were described in Kim et al. (2012), YFP‐LTPG1 (in the ltpg1‐2 background) and ltpg1‐2 in DeBono et al. (2009), pen1‐1 in Collins et al. (2003), and pen3‐1 in Stein et al. (2006). The cer4‐3 line was described in Rowland et al. (2006) (Table S1). The cer1‐1 T‐DNA insertion mutant line was obtained from NASC (Table S1), and the wax phenotype of this line was verified by epicuticular wax analysis by gas chromatography‐mass spectrometry (GC‐MS).

Pathogen inoculation

Blumeria graminis f. sp. hordei (isolate DH14) was propagated on barley (Hordeum vulgare cv. Barbro) and used after 1 week of growth at room temperature from the time of inoculation. Erysiphe pisi (isolate CO‐01) was propagated on pea plants (Pisum sativum cv. Kelvedon Wonder). Four‐ to five‐week‐old Arabidopsis plants were infected as described previously (Pinosa et al., 2013). Golovinomyces cichoracearum was cultivated on zucchini (Cucurbita pepo L. cv. F1 Diamant) and inoculated as described previously (Collins et al., 2003).

Staining and bright‐field microscopy

Trypan blue staining was performed as described by Koch and Slusarenko (1990), with some modifications. Briefly, the leaves were collected in Eppendorf tubes, covered in trypan blue staining solution and incubated at 95 °C for 3–5 min (time depending on the amount of material); they were then rinsed once with deionized water before the addition of aqueous chloral hydrate solution for de‐staining and clearing. When the leaf material had completely cleared, it was rinsed with water and mounted on microscopy glass slides in 60% glycerol. Penetration and/or cell death was scored as described previously (Pinosa et al., 2013). The average frequency of penetrations from each count was analysed by one‐way analysis of variance multiple comparisons, using Tukey’s honestly significant difference test and the software package JMP (JMP®, Version 12.0.1, SAS Institute Inc., Cary, NC, USA).

Confocal microscopy

To visualize the mildew spores, 1‐dpi leaf tissue was mounted in a solution of 0.1% (v/v) Silwet and 10 µm FM 4‐64 (SynaptoRed, Merck Millipore Burlington, MA, USA; https://www.merckmillipore.com/) on microscope glass, and viewed with a Zeiss (Oberkochen, Germany) LSM 700 on an inverted Axio Observer.Z1 microscope with a 40× water‐immersion objective (LD C‐Apochromat; numerical aperture, 1.1). Excitation was with 488‐ and 555‐nm lasers, and emission was recorded at 518 and 585 nm for YFP and FM 4‐64, respectively. The microscope was controlled with ZEN 2010 software (Zeiss Oberkochen, Germany), from which single images and image arrays were saved. Maximum intensity three‐dimensional reconstruction and image processing were performed with ZEN 2012 (Zeiss GmbH).

Analysis of leaf cuticular wax

The extraction and analysis method was performed as described by Haslan and Kunst (2013) on 6‐week‐old plants, using 5 µg tetracosane as internal standard. After extraction, the sample was split into two: one sample was trimethylsilylated using N,O‐bis(trimethylsilyl)trifluoroacetamide (Supelco, Sigma‐Aldrich, Saint Louis, MO, USA) in pyridine (1 : 1, v/v), and the other was analysed directly. The samples were analysed using an Agilent (Santa Clara, CA, USA) 7820A GC coupled to an Agilent 5975 mass‐selective detector. A DB‐5 capillary column (30 m × 0.25 mm; J&W Scientific, Inc., Folsom, CA, USA) was used with helium as carrier gas with a constant flow of 0.7 mL/min. Injector and detector transfer lines were kept at 250 °C and 280 °C, respectively. The oven temperature was increased from 75 °C to 325 °C with a linear increase of 10 °C/min, and held at 325 °C for 10 min. The detector was operated in full scan mode from 50 to 600 m/z. Individual wax components were quantified against the peak area of the internal standard and the leaf area.

Author Contributions

M.X.A., P.F. and N.B. designed the study. P.F., N.B. and O.N.J. performed the experiments and calculations. P.F. and M.X.A. wrote the manuscript. N.B. and O.N.J. made manuscript revisions.

Supporting information

Fig. S1   Structure of the glycophosphatidylinositol (GPI)‐anchored lipid transfer protein (LTPG) genes and T‐DNA insertions used in this study.

Click here for additional data file. (62.8KB, docx)

Fig. S2   Analysis of leaf total cuticular wax content.

Click here for additional data file. (69.7KB, docx)

Table S1  Mutant lines and primers used for genotyping in this study.

Click here for additional data file. (33.2KB, docx)

Acknowledgements

We wish to thank Professor Mi Chung Suh (Chonnam National University, Gwangju, South Korea) for the kind donation of seeds for ltpg1‐1, ltpg2‐1 and double ltpg1‐1 ltpg2‐1 mutants; Professor Lacey Samuels (University of British Columbia, Canada) for the donation of cer4‐3 seeds; and both Lacey Samuels and Allan DeBono for the ltpg1‐2 and YFP‐LTPG1 seeds. We also wish to thank Lantmännen SW Seed GmbH for the donation of seeds for the Barbro barley variety. Finally, we wish to acknowledge the Centre for Cellular Imaging (CCI) at Sahlgrenska Academy, University of Gothenburg, Sweden. The financial support of the Carl Tryggers Foundation, the Olle Engkvist Byggmästare Foundation and the Foundation of Lars Hierta’s Minne is gratefully acknowledged.

References

  1. Alonso, J.M. , Stepanova, A.N. , Leisse, T.J. , Kim, C.J. , Chen, H. , Shinn, P. , Stevenson, D.K. , Zimmerman, J. , Barajas, P. , Cheuk, R. , Gadrinab, C. , Heller, C. , Jeske, A. , Koesema, E. , Meyers, C.C. , Parker, H. , Prednis, L. , Ansari, Y. , Choy, N. , Deen, H. , Geralt, M. , Hazari, N. , Hom, E. , Karnes, M. , Mulholland, C. , Ndubaku, R. , Schmidt, I. , Guzman, P. , Aguilar‐Henonin, L. , Schmid, M. , Weigel, D. , Carter, D.E. , Marchand, T. , Risseeuw, E. , Brogden, D. , Zeko, A. , Crosby, W.L. , Berry, C.C. and Ecker, J.R. (2003) Genome‐wide insertional mutagenesis of Arabidopsis thaliana. Science, 301, 653–657. [DOI] [PubMed] [Google Scholar]
  2. Ambrose, C. , Debono, A. and Wasteneys, G. (2013) Cell geometry guides the dynamic targeting of apoplastic GPI‐linked lipid transfer protein to cell wall elements and cell borders in Arabidopsis thaliana. PLoS One, 8, e81215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bednarek, P. (2012) Chemical warfare or modulators of defence responses—the function of secondary metabolites in plant immunity. Curr. Opin. Plant. Biol. 15, 407–414. [DOI] [PubMed] [Google Scholar]
  4. Bednarek, P. , Pislewska‐Bednarek, M. , Svatos, A. , Schneider, B. , Doubsky, J. , Mansurova, M. , Humphry, M. , Consonni, C. , Panstruga, R. , Sanchez‐Vallet, A. , Molina, A. and Schulze‐Lefert, P. (2009) A glucosinolate metabolism pathway in living plant cells mediates broad‐spectrum antifungal defense. Science, 323, 101–106. [DOI] [PubMed] [Google Scholar]
  5. Boutrot, F. , Chantret, N. and Gautier, M.F. (2008) Genome‐wide analysis of the rice and Arabidopsis non‐specific lipid transfer protein (nsLtp) gene families and identification of wheat nsLtp genes by EST data mining. BMC Genom., 9, 86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cammue, B.P. , Thevissen, K. , Hendriks, M. , Eggermont, K. , Goderis, I.J. , Proost, P. , van Damme, J. , Osborn, R.W. , Guerbette, F. , Kader, J.C. and Broekaert, W.F. (1995) A potent antimicrobial protein from onion seeds showing sequence homology to plant lipid transfer proteins. Plant Physiol. 109, 445–455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Champigny, M.J. , Isaacs, M. , Carella, P. , Faubert, J. , Fobert, P.R. and Cameron, R.K. (2013) Long distance movement of DIR1 and investigation of the role of DIR1‐like during systemic acquired resistance in Arabidopsis. Front Plant Sci. 4, 230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Charvolin, D. , Douliez, J.P. , Marion, D. , Cohen‐Addad, C. and Pebay‐Peyroula, E. (1999) The crystal structure of a wheat nonspecific lipid transfer protein (ns‐LTP1) complexed with two molecules of phospholipid at 2.1 A resolution. Eur. J. Biochem. 264, 562–568. [DOI] [PubMed] [Google Scholar]
  9. Collins, N.C. , Thordal‐Christensen, H. , Lipka, V. , Bau, S. , Kombrink, E. , Qiu, J.L. , Huckelhoven, R. , Stein, M. , Freialdenhoven, A. , Somerville, S.C. and Schulze‐Lefert, P. (2003) SNARE‐protein‐mediated disease resistance at the plant cell wall. Nature, 425, 973–977. [DOI] [PubMed] [Google Scholar]
  10. de Oliveira Carvalho, A. and Gomes, V.M. (2007) Role of plant lipid transfer proteins in plant cell physiology—a concise review. Peptides, 28, 1144–1153. [DOI] [PubMed] [Google Scholar]
  11. Debono, A. , Yeats, T.H. , Rose, J.K. , Bird, D. , Jetter, R. , Kunst, L. and Samuels, L. (2009) Arabidopsis LTPG is a glycosylphosphatidylinositol‐anchored lipid transfer protein required for export of lipids to the plant surface. Plant Cell, 21, 1230–1238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Edstam, M.M. , Viitanen, L. , Salminen, T.A. and Edqvist, J. (2011) Evolutionary history of the non‐specific lipid transfer proteins. Mol. Plant, 4, 947–964. [DOI] [PubMed] [Google Scholar]
  13. Edstam, M.M. , Blomqvist, K. , Eklof, A. , Wennergren, U. and Edqvist, J. (2013) Coexpression patterns indicate that GPI‐anchored non‐specific lipid transfer proteins are involved in accumulation of cuticular wax, suberin and sporopollenin. Plant Mol. Biol. 83, 625–649. [DOI] [PubMed] [Google Scholar]
  14. Edstam, M.M. and Edqvist, J. (2014) Involvement of GPI‐anchored lipid transfer proteins in the development of seed coats and pollen in Arabidopsis thaliana. Physiol. Plant, 152, 32–42. [DOI] [PubMed] [Google Scholar]
  15. Edwards, K. , Johnstone, C. and Thompson, C. (1991) A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Res. 19, 1349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Finkina, E.I. , Melnikova, D.N. , Bogdanov, I.V. and Ovchinnikova, T.V. (2016) Lipid transfer proteins as components of the plant innate immune system: structure, functions, and applications. Acta Naturae, 8, 47–61. [PMC free article] [PubMed] [Google Scholar]
  17. Hannoufa, A. , McNevin, J. and Lemieux, B. (1993) Epicuticular waxes of eceriferum mutants of Arabidopsis thaliana. Phytochemistry, 33, 851–855. [Google Scholar]
  18. Hansjakob, A. , Bischof, S. , Bringmann, G. , Riederer, M. and Hildebrandt, U. (2010) Very‐long‐chain aldehydes promote in vitro prepenetration processes of Blumeria graminis in a dose‐ and chain length‐dependent manner. New Phytol. 188, 1039–1054. [DOI] [PubMed] [Google Scholar]
  19. Hansjakob, A. , Riederer, M. and Hildebrandt, U. (2011) Wax matters: absence of very‐long‐chain aldehydes from the leaf cuticular wax of the glossy11 mutant of maize compromises the prepenetration processes of Blumeria graminis . Plant Pathol. 60, 1151–1161. [Google Scholar]
  20. Hardham, A.R. , Jones, D.A. and Takemoto, D. (2007) Cytoskeleton and cell wall function in penetration resistance. Curr. Opin. Plant Biol. 10, 342–348. [DOI] [PubMed] [Google Scholar]
  21. Haslan, T.M. and Kunst, L. (2013) Wax analysis of stem and rosette leaves in Arabidopsis thaliana. Bio‐protocol, 3(11) [Online]. Available at: https://www.bio-protocol.org/e782 . Accessed march 2017. [Google Scholar]
  22. Hückelhoven, R. (2007) Cell wall‐associated mechanisms of disease resistance and susceptibility. Annu. Rev. Phytopathol. 45, 101–127. [DOI] [PubMed] [Google Scholar]
  23. Hückelhoven, R. and Panstruga, R. (2011) Cell biology of the plant–powdery mildew interaction. Curr. Opin. Plant Biol. 14, 738–746. [DOI] [PubMed] [Google Scholar]
  24. Jacq, A. , Pernot, C. , Martinez, Y. , Domergue, F. , Payre, B. , Jamet, E. , Burlat, V. and Pacquit, V.B. (2017) The Arabidopsis lipid transfer protein 2 (AtLTP2) is involved in cuticle‐cell wall interface integrity and in etiolated hypocotyl permeability. Front. Plant. Sci. 8, 263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Julke, S. and Ludwig‐Muller, J. (2015) Response of Arabidopsis thaliana roots with altered Lipid Transfer Protein (LTP) gene expression to the clubroot disease and salt stress. Plants (Basel), 5. doi: 10.3390/plants5010002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kader, J.C. (1997) Lipid‐transfer proteins: a puzzling family of plant proteins. Trends Plant Sci. 2, 66–70. [Google Scholar]
  27. Kim, H. , Lee, S.B. , Kim, H.J. , Min, M.K. , Hwang, I. and Suh, M.C. (2012) Characterization of glycosylphosphatidylinositol‐anchored lipid transfer protein 2 (LTPG2) and overlapping function between LTPG/LTPG1 and LTPG2 in cuticular wax export or accumulation in Arabidopsis thaliana. Plant Cell Physiol. 53, 1391–1403. [DOI] [PubMed] [Google Scholar]
  28. Koch, E. and Slusarenko, A. (1990) Arabidopsis is susceptible to infection by a downy mildew fungus. Plant Cell, 2, 437–445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Lee, S.B. , Go, Y.S. , Bae, H.J. , Park, J.H. , Cho, S.H. , Cho, H.J. , Lee, D.S. , Park, O.K. , Hwang, I. and Suh, M.C. (2009) Disruption of glycosylphosphatidylinositol‐anchored lipid transfer protein gene altered cuticular lipid composition, increased plastoglobules, and enhanced susceptibility to infection by the fungal pathogen Alternaria brassicicola. Plant Physiol. 150, 42–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Lipka, V. , Dittgen, J. , Bednarek, P. , Bhat, R. , Wiermer, M. , Stein, M. , Landtag, J. , Brandt, W. , Rosahl, S. , Scheel, D. , Llorente, F. , Molina, A. and Parker, J. (2005) Pre‐ and postinvasion defenses both contribute to nonhost resistance in Arabidopsis. Science, 310, 1180–1183. [DOI] [PubMed] [Google Scholar]
  31. Lipka, U. , Fuchs, R. and Lipka, V. (2008) Arabidopsis non‐host resistance to powdery mildews. Curr. Opin. Plant Biol. 11, 404–411. [DOI] [PubMed] [Google Scholar]
  32. Liu, F. , Zhang, X. , Lu, C. , Zeng, X. , Li, Y. , Fu, D. and Wu, G. (2015) Non‐specific lipid transfer proteins in plants: presenting new advances and an integrated functional analysis. J. Exp. Bot. 66, 5663–5681. [DOI] [PubMed] [Google Scholar]
  33. Maldonado, A.M. , Doerner, P. , Dixon, R.A. , Lamb, C.J. and Cameron, R.K. (2002) A putative lipid transfer protein involved in systemic resistance signalling in Arabidopsis. Nature, 419, 399–403. [DOI] [PubMed] [Google Scholar]
  34. Micali, C. , Gollner, K. , Humphry, M. , Consonni, C. and Panstruga, R. (2008) The powdery mildew disease of Arabidopsis: a paradigm for the interaction between plants and biotrophic fungi. Arabidopsis Book, 6, e0115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Nielsen, M.E. , Jurgens, G. and Thordal‐Christensen, H. (2017) VPS9a activates the Rab5 GTPase ARA7 to confer distinct pre‐ and postinvasive plant innate immunity. Plant Cell, 29, 1927–1937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Nielsen, M.E. and Thordal‐Christensen, H. (2013) Transcytosis shuts the door for an unwanted guest. Trends Plant Sci. 18, 611–616. [DOI] [PubMed] [Google Scholar]
  37. Pinosa, F. , Buhot, N. , Kwaaitaal, M. , Fahlberg, P. , Thordal‐Christensen, H. , Ellerström, M. and Andersson, M.X. (2013) Arabidopsis phospholipase Dδ is involved in basal defense and nonhost resistance to powdery mildew fungi. Plant Physiol. 163, 896–906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Rowland, O. , Zheng, H. , Hepworth, S.R. , Lam, P. , Jetter, R. and Kunst, L. (2006) CER4 encodes an alcohol‐forming fatty acyl‐coenzyme A reductase involved in cuticular wax production in Arabidopsis. Plant Physiol. 142, 866–877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Salminen, T.A. , Blomqvist, K. and Edqvist, J. (2016) Lipid transfer proteins: classification, nomenclature, structure, and function. Planta, 244, 971–997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Samuels, L. , Kunst, L. and Jetter, R. (2008) Sealing plant surfaces: cuticular wax formation by epidermal cells. Annu. Rev. Plant Biol. 59, 683–707. [DOI] [PubMed] [Google Scholar]
  41. Scholl, R.L. , May, S.T. and Ware, D.H. (2000) Seed and molecular resources for Arabidopsis. Plant Physiol. 124, 1477–1480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Segura, A. , Moreno, M. and García‐Olmedo, F. (1993) Purification and antipathogenic activity of lipid transfer proteins (LTPs) from the leaves of Arabidopsis and spinach. FEBS Lett. 332, 243–246. [DOI] [PubMed] [Google Scholar]
  43. Sessions, A. , Burke, E. , Presting, G. , Aux, G. , McElver, J. , Patton, D. , Dietrich, B. , Ho, P. , Bacwaden, J. , Ko, C. , Clarke, J.D. , Cotton, D. , Bullis, D. , Snell, J. , Miguel, T. , Hutchison, D. , Kimmerly, B. , Mitzel, T. , Katagiri, F. , Glazebrook, J. , Law, M. and Goff, S.A. (2002) A high‐throughput Arabidopsis reverse genetics system. Plant Cell, 14, 2985–2994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Stein, M. , Dittgen, J. , Sánchez‐Rodríguez, C. , Hou, B.‐H. , Molina, A. , Schulze‐Lefert, P. , Lipka, V. and Somerville, S. (2006) Arabidopsis PEN3/PDR8, an ATP binding cassette transporter, contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration. Plant Cell, 18, 731–746. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Thordal‐Christensen, H. (2003) Fresh insights into processes of nonhost resistance. Curr. Opin. Plant Biol. 6, 351–357. [DOI] [PubMed] [Google Scholar]
  46. Tsuda, K. and Somssich, I.E. (2015) Transcriptional networks in plant immunity. New Phytol. 206, 932–947. [DOI] [PubMed] [Google Scholar]
  47. Weis, C. , Hildebrandt, U. , Hoffmann, T. , Hemetsberger, C. , Pfeilmeier, S. , Konig, C. , Schwab, W. , Eichmann, R. and Huckelhoven, R. (2014) CYP83A1 is required for metabolic compatibility of Arabidopsis with the adapted powdery mildew fungus Erysiphe cruciferarum. New Phytol. 202, 1310–1319. [DOI] [PubMed] [Google Scholar]
  48. Yeats, T.H. and Jocelyn, K.C.R. (2008) The biochemistry and biology of extracellular plant lipid‐transfer proteins (LTPs). Protein Sci. 17, 191–198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Zottich, U. , daCunha, M. , Carvalho, A.O. , Dias, G.B. , Silva, N.C. , Santos, I.S. , Do Nacimento, V.V. , Miguel, E.C. , Machado, O.L. and Gomes, V.M. (2011) Purification, biochemical characterization and antifungal activity of a new lipid transfer protein (LTP) from Coffea canephora seeds with alpha‐amylase inhibitor properties. Biochim. Biophys. Acta, 1810, 375–383. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1   Structure of the glycophosphatidylinositol (GPI)‐anchored lipid transfer protein (LTPG) genes and T‐DNA insertions used in this study.

Click here for additional data file. (62.8KB, docx)

Fig. S2   Analysis of leaf total cuticular wax content.

Click here for additional data file. (69.7KB, docx)

Table S1  Mutant lines and primers used for genotyping in this study.

Click here for additional data file. (33.2KB, docx)

Articles from Molecular Plant Pathology are provided here courtesy of Wiley

RESOURCES