Abstract
Background and Aim:
Streptococcus suis is an important zoonotic pathogen that can cause serious diseases in both swine and humans worldwide, especially in Asian countries. Since the majority of human cases reported in Thailand were infected by the consumption of a raw pork dish, the microbial food safety hazard associated with raw meat has been a matter of concern. Therefore, this study aimed to investigate the contamination by S. suis in pork and edible pig organs sold in central Thailand.
Materials and Methods:
In total, 88 raw pork and pig organ samples were purchased from markets, butcher shops, and supermarkets in central Thailand. The samples were examined using the loop-mediated isothermal amplification (LAMP) technique. LAMP reactions used for the detection of the DNA of S. suis (LAMPSS) and S. suis serotype 2 or 1/2 (LAMPSS2) were carried out according to previous studies.
Results:
The percentage of LAMPSS-positive samples was as high as 85.23% (75/88) while the percentage of LAMPSS2-positive samples was 17.05% (15/88). The percentages of LAMPSS- and LAMPSS2-positive samples were relatively high in both pig organs (lung and heart) and meat (sliced pork and minced pork) compared with the previous report. Except one supermarket, LAMPSS-positive samples were found in all sources investigated in this study. The pork and pig organs obtained from the markets and the butcher shops additionally gave positive results for LAMPSS2.
Conclusion:
Using LAMP techniques, high rate contamination of S. suis was found in raw pork and edible pig organs sold at different sources in central Thailand. The cross-contamination could have occurred through slaughtering, meat cutting, and meat handling processes. Therefore, consumers and people involved in the pig production industry should be aware of the potential hazards of S. suis infection; food safety education is crucial to prevent further infection.
Keywords: contamination, loop-mediated isothermal amplification, pork, Streptococcus suis, Thailand
Introduction
Streptococcus suis is a well-recognized zoonotic pathogen worldwide. S. suis infection can cause serious diseases in swine as well as severe consequences in humans. The most striking clinical feature found in infected patients is meningitis, and after recovery, the patients frequently suffer from permanent loss of hearing [1]. Other clinical manifestations including arthritis, endocarditis, pneumonia, septicemia, and septic shock have been reported in human infections [1]. Since the first human S. suis infection was reported in Denmark in 1968, >1600 human cases have occurred in many countries, particularly in Vietnam, Thailand, and China [2]. Although direct contact through a wound is the main transmission route of human infection, the majority of human cases reported in Vietnam and Thailand were infected by the consumption of raw pork and offal [3,4].
Based on the various capsular polysaccharide (CPS) antigens, S. suis strains have been classified into different serotypes [2]. Of the serotypes described so far, S. suis serotype 2 is the most prevalent and pathogenic for both pigs and humans [5,6]. In addition, other serotypes including serotypes 1, 4, 5, 9, 14, 16, 21, 24, and 31 have been occasionally reported in human cases [2,7-12]. Since S. suis serotype 2 and the other potential hazardous strains could be found even in the slaughtered pigs [13,14], contamination by S. suis in pork and pig organs should be taken into account as it could lead to a high risk of human infection. Loop-mediated isothermal amplification (LAMP) specific to S. suis, which was previously described elsewhere [15], was used to detect S. suis in this study. Since LAMP is simple, fast, and sensitive, this technique can be used as a surveillance tool for the detection of S. suis contamination. Accordingly, LAMP techniques targeting the gene-encoding recombination/repair protein (recN) and the CPS synthesis gene specific for serotype 2 and 1/2 (cps2J) can be used for the detection of S. suis and S. suis serotype 2 or 1/2, respectively [15,16].
Central Thailand is not only the center of the country’s economy, transportation, and tourism but is also a region where the pig density is high. Therefore, in this study, we aimed to investigate S. suis contamination in pork and edible pig organs sold in retail markets, butcher shops, and supermarkets in central Thailand. The results from this study will provide important insights into the risk management of this emerging zoonotic pathogen in food.
Materials and Methods
Ethical approval
As live animals were not used, ethical approval for animal research was not required in this study. Pork and pig organ samples were purchased from local markets, butcher shops, and supermarkets in central Thailand.
Sample collection and preparation
In total, 88 samples, consisting of 50 raw pork samples (27 sliced pork and 23 minced pork) and 38 pig organ samples (16 livers, 13 lungs, and 9 hearts), were purchased from 20 sources (eight markets, eight butcher shops, and four supermarkets) in central Thailand between July 2016 and December 2017. The samples were immediately transported to the Faculty of Veterinary Technology, Kasetsart University, Bangkok, Thailand, and were prepared for S. suis detection following a previous study [15] with slight modifications. Briefly, each sample was aseptically cut into small pieces, and 100 g of each sample was subsequently homogenized with the appropriate amount (20-100 ml) of 0.9% saline solution in a sterile stomacher bag for 2 min at 230 rpm using a Stomacher® 400 circulator (Scientific Promotion Co., Ltd., UK). Then, 100 µl of the solution obtained from homogenization was added to 5 ml of Todd-Hewitt broth supplemented with Streptococcus Selective Supplement (Oxoid, UK). After incubation at 37°C for 18-24 h, 1 ml of each bacterial culture was used for DNA extraction.
Molecular techniques
DNA extraction
The genomic DNA was extracted using InstaGene Matrix® (Bio-Rad Laboratories, Inc., United States) according to the manufacturer’s recommendations. All genomic DNA samples were stored at −20°C until used.
LAMP
LAMP reactions used for the detection of DNA of S. suis (LAMPSS) and S. suis serotype 2 or 1/2 (LAMPSS2) were carried out according to Arai et al. [15] and Zhang et al. [16], respectively. The primer sets are shown in Table-1 [15,16] and consisted of two inner primers (forward inner primer [FIP] and backward inner primer [BIP]), two outer primers (F3 and B3), and an LB loop primer. The primers in each reaction mixture contained 0.2 µM each of F3 and B3, 1.6 µM each of FIP and BIP, and 0.8 µM of LB loop primer. LAMP reactions were performed using a Loopamp DNA amplification kit (Eiken Chemical Co., Ltd., Japan) using the GeneAmp® PCR system 9700 (Applied Biosystem, Singapore). LAMPSS reaction was carried out at 60°C for 60 min followed by inactivation at 80°C for 5 min. The samples which gave a positive result for LAMPSS were further examined using LAMPSS2. LAMPSS2 was performed at 63°C for 60 min and was then inactivated at 85°C for 2 min. In all reactions, S. suis strain P1/7 [17] and distilled water were used as positive and negative controls, respectively.
Table-1.
Primer sequences of LAMPSS and LAMPSS2 used in this study.
| Assay | Primer | Primer sequence (5’–3’) | References |
|---|---|---|---|
| LAMPSS | F3 | TGTCGATGATGTTTTGGACTA | [15] |
| B3 | GCTTTCTCCATATACAAGTCTTG | ||
| FIP | AAGCTGAACTTCCAAATCATCTCCCAGCGAAGAATACAATCTATTGAC | ||
| BIP | TAGAGAAAGAATTGGTTGAACGAGCGCGGATAATATCTTCTAAAACAAC | ||
| LB | GGTCAGCTCAGCCAATCACGC | ||
| LAMPSS2 | F3 | GTGTTTCAAACGAAGGAAT | [16] |
| B3 | GCACCTCTTTTATCTCTTCCAA | ||
| FIP | GTTGCCGTCAACAATATCATCAGAACGGTATCAAAAATAGCACAGC | ||
| BIP | AGAGAATGATAGTGATTTGTCGGG TTTGCAGCTCAGATTCTTG | ||
| LB | AGGGTTACTTGCTACTTTTGATGG |
LAMP=Loop-mediated isothermal amplification, BIP=Backward inner primer, FIP=Forward inner primer
LAMP product detection
Gel electrophoresis was used to analyze the products of both LAMPSS and LAMPSS2 by HE-Plus Electrophoresis (Hoefer, U.S.A). An UltraSlim® LED illuminator (Maestrogen, Taiwan) was used to observe the bands of products, and the samples were considered to be positive if they showed a ladder-like band pattern (Figure-1).
Figure-1.
Agarose gel electrophoresis under LED illuminator used to observe the band of loop-mediated isothermal amplification (LAMP) products, where a positive result of LAMP shows a ladder-like band pattern. Lane 1, 100 bp Plus DNA Ladder; Lane 2, LAMP-positive sample.
Results
All sample types investigated in this study gave positive results with both LAMPSS and LAMPSS2 analyses, as shown in Table-2. The percentage of LAMPSS-positive samples was as high as 85.23% (75/88) while the percentage of LAMPSS2-positive sample was 17.05% (15/88). The highest percentage of LAMPSS-positive samples was in the lung (92.31%), followed by the heart (88.89%) and sliced pork (88.89%), while the lowest percentage of LAMPSS-positive samples was in the liver. Similar to LAMPSS, the results from LAMPSS2 analysis showed that the percentage of LAMPSS2-positive sample was highest in the lung (30.77%) followed by the heart (22.22%) and sliced pork (18.52%) (Table-2).
Table-2.
Meat samples used in this study and LAMP results.
| Sample type | Number of samples | Number of LAMPSS-positive samples (%) | Number of LAMPSS2-positive samples (%) |
|---|---|---|---|
| Sliced pork | 27 | 24 (88.89) | 5 (18.52) |
| Minced pork | 23 | 20 (86.96) | 4 (17.39) |
| Liver | 16 | 11 (68.75) | 0 (0) |
| Lung | 13 | 12 (92.31) | 4 (30.77) |
| Heart | 9 | 8 (88.89) | 2 (22.22) |
| Total | 88 | 75 (85.23) | 15 (17.05) |
LAMP=Loop-mediated isothermal amplification
The results of LAMP analyses classified by the type of sample source are shown in Table-3. Except for one supermarket, LAMPSS-positive samples were found at all sources investigated in this study. The samples collected from 10 of the 20 sources (50%) additionally had positive results for LAMPSS2. All samples obtained from supermarkets were LAMPSS2 negative, while the samples collected from 6 markets (75%) and 4 butcher shops (50%) were LAMPSS2 positive.
Table-3.
Sources of samples used in this study and LAMP results.
| Sample source | Number of sample source | Number of sources containing LAMPSS-positive sample (%) | Number of sources containing LAMPSS2-positive sample (%) |
|---|---|---|---|
| Market | 8 | 8 (100) | 6 (75) |
| Butcher shop | 8 | 8 (100) | 4 (50) |
| Supermarket | 4 | 3 (75) | 0 (0) |
| Total | 20 | 19 (95) | 10 (50) |
LAMP=Loop-mediated isothermal amplification
Discussion
Among S. suis infections reported in humans worldwide, >90% of cases have occurred in Asian countries, particularly in Vietnam and Thailand [18]. Since the major cause of S. suis human infection in this area is the consumption of a raw pork dish, the microbial food safety hazard associated with raw meat has been raised as a matter of great concern. Therefore, in this study, we investigated the contamination by S. suis and S. suis serotype 2 or 1/2 in raw pork and edible pig organs sold at different sources in central Thailand using LAMP techniques. Our results showed high contamination rates by S. suis in pork and pig organs. In addition, contamination by S. suis serotype 2 or 1/2 was found in the samples purchased from markets and butcher shops. S. suis and S. suis serotype 2 or 1/2 contamination rates in this study were much higher than those reported in a previous study [15], in which the contamination rates of S. suis and S. suis serotype 2 or 1/2 in raw pork meat samples in Japan were 26.4% and 4.87%, respectively.
In addition, they found that the rate of contamination in pig organs was higher than in pork. Likewise, contamination by S. suis was reported in the tongue, tonsil, bone, and tail, but not in pork meat collected from wet markets in Hong Kong [19]. On the contrary, the contamination rates of S. suis and S. suis serotype 2 or 1/2, in our study, were relatively high in both the pig organs (lung and heart) and meat (sliced pork and minced pork) samples. Although S. suis can be found in the tonsil, nasal cavities, and reproductive and digestive tracts of healthy pigs, this bacterium should not be found in sterile sites such as muscle, blood, heart, lung, and liver of a healthy pig [20]. Our findings indicated the possibility of the cross-contamination between visceral organs and pork meat which could occur through slaughtering, meat cutting, meat handling, and further processing [21].
Although many attempts were made, we failed to isolate S. suis from the LAMP-positive samples. Since one of the main advantages of LAMP over traditional culture techniques is its sensitivity, it could be suggested that the number of vegetative S. suis cells may be too low to compete with the other non-fastidious bacteria contaminating the same sample. Thus, the presence of viable S. suis could not be detected using bacterial cultivation. Similarly, Cheung et al. [22] revealed that it was difficult to isolate S. suis from raw pork meat samples due to the low levels of live S. suis cells coexisting with many other microorganisms. However, the retrieval of S. suis isolate is required for other important information including virulence and antibiotic resistance traits. Accordingly, it is necessary to further investigate the characteristics of S. suis isolates contaminated in raw pork for a better approach to the food safety risk analysis.
Contamination by S. suis in raw pork meat was found in all markets and butcher shops examined in this study. Moreover, the samples contaminated with S. suis serotype 2 or 1/2 were obtained from 6 of the 8 markets (75%) and 4 of the 8 butcher shops (50%), but no contaminated samples were obtained from the supermarkets. These results emphasized the problem of sanitation and hygienic practices in local retail shops and markets in Thailand. We noticed that the meat handlers in the market stalls worked without gloves and they usually used the same utensils, such as a chopping board and knife, for all meat types. Due to the high contamination rate, the consumers, as well as people who were in close contact with raw pork and pig organs, have a high risk of S. suis infection. The achievements from a food safety campaign on the control of S. suis infection in Northern Thailand have been described [23]. Therefore, food safety education and public health intervention are crucial to effectively prevent and control the infection of this zoonotic pathogen throughout high-risk areas.
Conclusion
Using LAMP techniques, high rate contamination of S. suis was found in raw pork and edible pig organs sold at different sources in central Thailand. Contamination by S. suis serotype 2 or 1/2 was additionally found in samples purchased from markets and butcher shops. It is suggested that the cross-contamination between visceral organs and pork meat possibly occurred during slaughtering, meat cutting, meat handling, and further processing. Therefore, food safety education is necessary to prevent S. suis infection.
Authors’ Contributions
NB collected samples, performed experiments, and wrote the manuscript. SK, DK, and KS provided technical help during the experiments. NM conceived the work, designed the experiments, collected samples, and revised the manuscript critically for important intellectual content. All authors have read and approved the final manuscript.
Acknowledgments
This study was financially supported by the Graduate School, Kasetsart University, Bangkok, Thailand, the Kasetsart University Research and Development Institute (Grant no. 37.59) and the Capacity Building of Kasetsart University Students on Internationalization program. We are grateful to Prof. Tsutomu Sekizaki and Assoc. Prof. Daisuke Takamatsu for their scientific help.
Competing Interests
The authors declare that they have no competing interests.
Publisher’s Note
Veterinary World remains neutral with regard to jurisdictional claims in published institutional affiliation.
References
- 1.Lun Z.R, Wang Q.P, Chen X.G, Li A.X, Zhu X.Q. Streptococcus suis:An emerging zoonotic pathogen. Lancet Infect. Dis. 2007;7(3):201–209. doi: 10.1016/S1473-3099(07)70001-4. [DOI] [PubMed] [Google Scholar]
- 2.Goyette-Desjardins G, Auger J.P, Xu J, Segura M, Gottschalk M. Streptococcus suis an important pig pathogen and emerging zoonotic agent-an update on the worldwide distribution based on serotyping and sequence typing. Emerg. Microbes. Infect. 2014;3(6):e45. doi: 10.1038/emi.2014.45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Huong V.T.L, Hoa N.T, Horby P, Bryant J.E, Kinh N.V, Toan T.K, Wertheim H.F.L. Raw pig blood consumption and potential risk for Streptococcus suis infection, Vietnam. Emerg. Infect. Dis. 2014;20(11):1895–1898. doi: 10.3201/eid2011.140915. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Kerdsin A, Dejsirilert S, Sawanpanyalert P, Boonnark A, Noithachang W, Sriyakum D, Simkum S, Chokngam S, Gottschalk M, Akeda Y, Oishi K. Sepsis and spontaneous bacterial peritonitis in Thailand. Lancet. 2011;378(9794):960. doi: 10.1016/S0140-6736(11)60923-9. [DOI] [PubMed] [Google Scholar]
- 5.Gottschalk M, Segura M. The pathogenesis of meningitis caused by Streptococcus suis:The unresolved questions. Vet. Microbiol. 2000;76(3):259–272. doi: 10.1016/s0378-1135(00)00250-9. [DOI] [PubMed] [Google Scholar]
- 6.Madsen L.W, Svensmark B, Elvestad K, Aalbaek B, Jensen H.E. Streptococcus suis serotype 2 infection in pigs:New diagnostic and pathogenetic aspects. J. Comp. Pathol. 2002;126(1):57–65. doi: 10.1053/jcpa.2001.0522. [DOI] [PubMed] [Google Scholar]
- 7.Kerdsin A, Dejsirilert S, Puangpatra P, Sripakdee S, Chumla K, Boonkerd N, Polwichai P, Tanimura S, Takeuchi D, Nakayama T, Nakamura S, Akeda Y, Gottschalk M, Sawanpanyalert P, Oishi K. Genotypic profile of Streptococcus suis serotype 2 and clinical features of infection in humans, Thailand. Emerg. Infect. Dis. 2011;17(5):835–842. doi: 10.3201/eid1705.100754. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Kerdsin A, Hatrongjit R, Gottschalk M, Takeuchi D, Hamada S, Akeda Y, Oishi K. Emergence of Streptococcus suis serotype 9 infection in humans. J. Microbiol. Immunol. 2017;50(4):545–546. doi: 10.1016/j.jmii.2015.06.011. [DOI] [PubMed] [Google Scholar]
- 9.Nghia H.D.T, Ngo T.H, Le D.L, Campbell J, To S.D, Chau N.V.V, Mai N.T.H, Tran T.H, Spratt B, Farrar J, Schultsz C. Human case of Streptococcus suis serotype 16 infection. Emerg. Infect. Dis. 2008;14(1):155–157. doi: 10.3201/eid1401.070534. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Takeuchi D, Kerdsin A, Pienpringam A, Loetthong P, Samerchea S, Luangsuk P, Khamisara K, Wongwan N, Areeratana P, Chiranairadul P, Lertchayanti S, Petcharat S, Yowang A, Chaiwongsaen P, Nakayama T, Akeda Y, Hamada S, Sawanpanyalert P, Dejsirilert S, Oishi K. Population-based study of Streptococcus suis infection in humans in Phayao province in Northern Thailand. PLoS One. 2012;7(2):e31265. doi: 10.1371/journal.pone.0031265. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Taniyama D, Sakurai M, Sakai T, Kikuchi T, Takahashi T. Human case of bacteremia due to Streptococcus suis serotype 5 in Japan:The first report and literature review. ID Cases. 2016;6(5):36–38. doi: 10.1016/j.idcr.2016.09.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Wertheim H.F.L, Nghia H.D.T, Taylor W, Schultsz C. Streptococcus suis:An emerging human pathogen. Clin. Infect. Dis. 2009;48(5):617–625. doi: 10.1086/596763. [DOI] [PubMed] [Google Scholar]
- 13.Meekhanon N, Kaewmongkol S, Phimpraphai W, Okura M, Osaki M, Sekizaki T, Takamatsu D. Potentially hazardous Streptococcus suis strains latent in asymptomatic pigs in a major swine production area of Thailand. J. Med. Microbiol. 2017;66(5):662–669. doi: 10.1099/jmm.0.000483. [DOI] [PubMed] [Google Scholar]
- 14.Wang K, Zhang W, Li X, Lu C, Chen J, Fan W, Huang B. Characterization of Streptococcus suis isolates from slaughter swine. Curr. Microbiol. 2013;66(4):344–349. doi: 10.1007/s00284-012-0275-4. [DOI] [PubMed] [Google Scholar]
- 15.Arai S, Tohya M, Yamada R, Osawa R, Nomoto R, Kawamura Y, Sekizaki T. Development of loop-mediated isothermal amplification to detect Streptococcus suis and its application to retail pork meat in Japan. Int. J. Food Microbiol. 2015;208:35–42. doi: 10.1016/j.ijfoodmicro.2015.05.008. [DOI] [PubMed] [Google Scholar]
- 16.Zhang J, Zhu J, Ren H, Zhu S, Zhao P, Zhang F, Lv H, Hu D, Hao L, Geng M, Gong X, Pan X, Wang C, Qi Z. Rapid visual detection of highly pathogenic Streptococcus suis serotype 2 isolates by use of loop-mediated isothermal amplification. J. Clin. Microbiol. 2013;51(10):3250–3256. doi: 10.1128/JCM.01183-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Slater J.D, Allen A.G, May J.P, Bolitho S, Lindsay H, Maskell D.J. Mutagenesis of Streptococcus equi and Streptococcus suis by transposon Tn 917. Vet. Microbiol. 2003;93(3):197–206. doi: 10.1016/s0378-1135(03)00030-0. [DOI] [PubMed] [Google Scholar]
- 18.Dutkiewicz J, Sroka J, Zajac V, Wasinski B, Cisak E, Sawczyn A, Kloc A, Wojcik-Fatla A. Streptococcus suis:A re-emerging pathogen associated with occupational exposure to pigs or pork products. Part I - Epidemiology. Ann. Agric. Environ. Med. 2017;24(4):683–695. doi: 10.26444/aaem/79813. [DOI] [PubMed] [Google Scholar]
- 19.Ip M, Fung K.S, Chi F, Cheuk E.S, Chau S.S, Wong B.W, Lui S, Hui M, Lai R.W, Chan P.K. Streptococcus suis in Hong Kong. Diagn. Microbiol. Infect. Dis. 2007;57(1):15–20. doi: 10.1016/j.diagmicrobio.2006.05.011. [DOI] [PubMed] [Google Scholar]
- 20.Feng Y, Zhang H, Wu Z, Wang S, Cao M, Hu D, Wang C. Streptococcus suis infection:An emerging/reemerging challenge of bacterial infectious diseases? Virulence. 2014;5(4):477–497. doi: 10.4161/viru.28595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Adesokan H.K, Raji A.O.Q. Safe meat-handling knowledge, attitudes and practices of private and government meat processing plants'workers:Implications for future policy. J. Prev. Med. Hyg. 2014;55(1):10–16. [PMC free article] [PubMed] [Google Scholar]
- 22.Cheung P.Y, Lo K.L, Cheung T.T, Yeung W.H, Leung P.H, Kam K.M. Streptococcus suis in retail markets:How prevalent is it in raw pork? Int. J. Food Microbiol. 2008;127(3):316–320. doi: 10.1016/j.ijfoodmicro.2008.08.006. [DOI] [PubMed] [Google Scholar]
- 23.Takeuchi D, Kerdsin A, Akeda Y, Chiranairadul P, Loetthong P, Tanburawong N, Areeratana P, Puangmali P, Khamisara K, Pinyo W, Anukul R, Samerchea S, Lekhalula P, Nakayama T, Yamamoto K, Hirose M, Hamada S, Dejsirilert S, Oishi K. Impact of a food safety campaign on Streptococcus suis infection in humans in Thailand. Am. J. Trop. Med. Hyg. 2017;96(6):1370–1377. doi: 10.4269/ajtmh.16-0456. [DOI] [PMC free article] [PubMed] [Google Scholar]