Skip to main content
Parasites & Vectors logoLink to Parasites & Vectors
. 2019 Mar 26;12:131. doi: 10.1186/s13071-019-3382-2

Long-term trends of tick-borne pathogens in regard to small mammal and tick populations from Saxony, Germany

Daniel Galfsky 1,#, Nina Król 1,#, Martin Pfeffer 1,✉, Anna Obiegala 1
PMCID: PMC6434846  PMID: 30909955

Abstract

Background

Rodents are important in the life-cycle of ticks as hosts for immature developmental stages. Both rodents and ticks are of public health interest as they are reservoirs and vectors for different tick-borne pathogens (TBP). The aim of this study was to reassess the prevalence of TBP in previously studied areas of the city of Leipzig (Saxony, Germany).

Methods

In the years 2015–2017 rodents and ticks were collected in parks and forest areas in Saxony. DNA was extracted from the rodents, attached and questing ticks. Samples were screened for the presence of Anaplasma phagocytophilum, Babesia spp., Borrelia burgdorferi (s.l.), “Candidatus Neoehrlichia mikurensis” (CNM), Bartonella spp., Hepatozoon spp. and Rickettsia spp. using PCR methods. Rodent, attached nymph and questing tick (nymph and adult) samples were tested individually, while attached larvae were further processed in pools.

Results

A total of 165 rodents (Apodemus agrarius, n = 1; A. flavicollis, n = 59; Arvicola terrestris, n = 1; Myodes glareolus, n = 104), 1256 attached ticks (Ixodes ricinus, n = 1164; Dermacentor reticulatus, n = 92) and 577 questing ticks (I. ricinus, n = 547; D. reticulatus, n = 30) were collected. The prevalence levels in rodents were 78.2% for Bartonella spp., 58.2% for CNM, 49.1% for B. burgdorferi (s.l.) 29.1% for Rickettsia spp. and 24.2% for Hepatozoon spp. The minimal infection rates (MIR) in attached larvae ticks were 39.8% for Rickettsia spp., 32.7% for Bartonella spp., 7.1% for CNM and 8.8% for B. burgdorferi (s.l.) and the prevalence rates in attached nymphs were 33.7% for Bartonella spp., 52.9% for Rickettsia spp., 13.5% for CNM and 11.3% for B. burgdorferi (s.l.) Both rodents and attached ticks were negative for Babesia spp. The prevalence in questing ticks was 18.2% for Rickettsia spp., 7.3% for CNM, 6.4% for B. burgdorferi (s.l.) and 1.4% for Babesia spp. All tested samples were Anaplasma-negative. Sequencing revealed the occurrence of 14 identified species.

Conclusions

This research is the first evaluation of the prevalence for Hepatozoon spp. in rodents from Germany. In comparison to earlier studies, detected pathogens species remained the same; however, the prevalence for particular pathogens differed.

Keywords: Rodent, Myodes glareolus, Apodemus flavicollis, Bartonella, Rickettsia, Hepatozoon, Neoehrlichia, Anaplasma phagocytophilum, Ticks, Ixodes ricinus

Background

Small mammals are important hosts for the developmental immature stages of ticks in their natural life-cycle. Moreover, small mammals serve also as reservoirs [1] for various zoonotic agents. Ixodes ricinus is the most prevalent tick species in Europe and is responsible for the transmission of most zoonotic tick-borne pathogens (TBP) [2]; however, Dermacentor reticulatus is a rising concern as a potential vector of TBP.

Anaplasma phagocytophilum and “Candidatus Neoehrlichia mikurensis” (CNM) are Gram-negative, obligate intracellular bacteria which are tick-borne and mainly transmitted by I. ricinus [3]. However, D. reticulatus has also been described to harbour both [4, 5]. There are four ecotypes of A. phagocytophilum and only two are vectored by I. ricinus [6]. While A. phagocytophilum is known to cause mild to severe symptoms in humans, dogs and other mammals, CNM is rather an opportunistic agent mostly affecting immunosuppressed humans and dogs [7, 8]. CNM is considered to be harboured by rodents such as Myodes glareolus and Apodemus flavicollis [1]. Whereas roe deer, wild boars and hedgehogs are regarded as reservoirs for A. phagocytophilum, the reservoir function of small mammals is disputable, as there are supportive as well as refutable studies [1, 9–12].

Rickettsia spp. are likewise zoonotic Gram-negative, obligate intracellular bacteria which may be subdivided in four groups: (i) the spotted fever group (SFG); (ii) the typhus group; (iii) the Rickettsia bellii group; and (iv) the Rickettsia canadensis group [13]. Most rickettsiae belonging to the SFG are tick-borne and zoonotic. While I. ricinus is thought to be a vector in particular for Rickettsia monacensis and R. helvetica, D. reticulatus seems to be the main vector for R. raoultii in Europe [1, 13, 14]. While R. helvetica and R. slovaca are considered to be harboured by sika deer and dogs, and by wild boars and domestic ruminants, respectively, the reservoir host for R. raoultii is still not clear [15–17]. Nonetheless, small mammals have previously been found positive for all three aforementioned Rickettsia species [18, 19].

Species of the Borrelia burgdorferi (sensu lato) complex are the causative agents of Lyme disease which is the most prevalent tick-borne disease in Europe [20]. Ixodes ricinus is known to be the main vector and small mammals are expected to be key reservoirs for B. afzelii which is a species of the B. burgdorferi (s.l.) complex [21].

Bartonella spp. are zoonotic, Gram-negative, vector-borne bacteria. Rodents are known to be reservoirs for most Bartonella species [22], whilst a variety of arthropods such as fleas, lice, keds and ticks are considered to transmit these pathogens. In Germany, human cases of bartonellosis, mainly caused by B. henselae, have been previously reported [23].

Babesia spp. and Hepatozoon spp. are small intracellular parasites which are harboured by many different vertebrate hosts including birds and mammals in Europe [24, 25]. Babesia microti is mostly found in voles of the genus Microtus, in particular M. agrestis in Europe. However, there are also reports of B. microti in other rodent species such as M. glareolus and A. flavicollis [26]. Ixodes ricinus is believed to be the main vector of several Babesia spp. [27]. However, I. trianguliceps, a rodent-associated tick species, seems to be the key vector of B. microti in Europe. Human babesiosis caused by B. microti was previously reported in a human from Germany [28].

In the past, Hepatozoon spp. in rodents were not directly examined in Germany; however, there was an accidental finding of Hepatozoon sp. in one rodent previously tested by our study group [29] and other findings in M. glareolus and M. oeconomus previously from Poland, but neither in A. flavicollis nor insectivores [30]. Thus far the Hepatozoon species obtained from small mammals in Europe are either non-pathogenic or of unknown pathogenicity to humans [31]. Hepatozoon canis, which is highly pathogenic to dogs, was previously found in I. ricinus and D. reticulatus collected from foxes in Germany [32]. Most previous examinations on TBP in hosts and vectors from nature were carried out in a time frame of few years only and did not reassess the same areas again. Thus, long term studies on ticks, small mammals and TBP are scarce. However, it may be of importance to survey the dynamics of TBP in hosts and vectors in the purpose of predicting the distribution and maintenance of TBP in the future. Previous research showed a quite high prevalence of the previously mentioned TBPs in small mammals and ticks from Saxony, Germany [4, 18, 29, 33–36].

The present study reassessed TBPs in small mammal and tick populations from sites in Saxony which were previously examined by our group for TBP over the last 9 years [4, 18, 29, 33–36]. Thus, the aims of this study were: (i) collection of rodents, their attached ticks and questing ticks in Saxony, Germany; (ii) assessment of the prevalence of the mentioned pathogens in collected rodents and ticks; (iii) comparison of the current results with our previous studies from the last 9 years [4, 18, 29, 33–36].

Results

Captured rodents and their attached ticks

A total of 165 rodents belonging to four species were collected (predominantly M. glareolus, 63.0%, CI: 55.4–70.0%, n = 104; followed by Apodemus flavicollis, 35.8%, CI: 28.8–43.3%, n = 59; and two others, A. agrarius, n = 1 and Arvicola terrestris, n = 1; Table 1). Overall, 1256 ticks were attached to 122 rodents from three species (A. agrarius, n = 1; A. flavicollis, n = 42; M. glareolus, n = 79). There were only two tick species detected, I. ricinus (92.7%, CI: 91.1–94.0%, n = 1164) and D. reticulatus (7.3%, CI: 6.0–8.9%, n = 92). While I. ricinus parasitized on three rodent species [A. agrarius (n = 1), A. flavicollis (n = 42) and M. glareolus (n = 69)], D. reticulatus exclusively infested M. glareolus (n = 22). Only larvae and nymphs were observed on small mammals. Among I. ricinus, larvae constituted the majority (93.6%, CI: 92.1–94.9%, n = 1090), while nymphs were scarce (6.7%, CI: 5.1–7.9%, n = 74). However, for D. reticulatus the nymphs (90.2%, CI: 82.2–95.0%, n = 83) were more prevalent than larvae (9.8%, CI: 5.0–17.8%, n = 9). The maximum infestation rate on rodents was 135 ticks per host (M. glareolus) with a mean value of 7.6 (SD= 16.43).

Table 1.

Numbers of collected and selected rodents, attached and questing ticks, 2015–2017, Saxony, Germany

Species 2015 2016 2017 M Total
M Total M Total M Total
Collected rodents
 A. flavicollis 17 17 15 15 27 27 59 59
 A. agrarius – – 1 1 – – 1 1
 A. terrestris 1 1 – – – – 1 1
 M. glareolus 55 55 31 31 18 18 104 104
 Total 73 73 47 47 45 45 165 165
Attached ticks
 I. ricinus 158 295 97 231 140 638 395 1164
  Larvae 144 271 81 212 117 607 342 1090
  Nymph 14 24 16 19 23 31 53 74
 D. reticulatus 17 33 23 35 20 24 60 92
  Larvae 3 3 – – 6 6 9 9
  Nymph 14 30 23 35 14 18 51 83
 Total 175 328 120 266 160 662 455 1256
Questing ticks
 I. ricinus 58 299 31 42 105 206 194 547
  Larvae 7 13 – – 20 21 27 34
  Nymph 25 214 2 13 50 150 77 377
  Male 11 31 18 18 21 21 50 70
  Female 15 41 11 11 14 14 40 66
 D. reticulatus – – 5 9 21 21 26 30
  Male – – 1 3 5 5 6 8
  Female – – 4 6 16 16 20 22
 Total 58 299 36 51 126 227 220 577

Abbreviation: M, selected for molecular examination

Questing ticks

Altogether, 577 ticks belonging to two species were collected from the vegetation: I. ricinus was more prevalent (94.8%, CI: 92.6–96.3%, n = 547) than D. reticulatus (5.2%, CI: 3.6–7.3%, n = 30, Table 1). The most frequently collected developmental stage among I. ricinus were nymphs (68.9%, CI: 64.9–72.7%, n = 377), followed by adults (24.9%, CI: 21.4–28.7%, n = 136) and larvae (6.2%, CI: 4.5–8.6%, n = 34). In case of D. reticulatus, only adult ticks were collected and exclusively in the years 2016 and 2017 (Table 1).

PCR results for rodents

At least 1 out of 7 tested pathogens was detected in 156 out of 165 rodents (94.5%, CI: 89.8–97.2%). None of the samples tested positive for A. phagocytophilum or Babesia spp. Apodemus agrarius (n = 1) was negative for all tested pathogens and A. terrestris (n = 1) was exclusively positive for CNM (100%, n = 1; Table 2). Myodes glareolus (n = 104) and A. flavicollis (n = 59) were infected with at least one of the tested pathogens at the same level, 96.2 and 93.2%, respectively (P = 0.462). The prevalence levels for tested pathogens differed significantly (χ2= 128.132, df = 4, P < 0.001) with Bartonella spp. as the most often detected pathogen (78.2%), followed by CNM (58.2%), B. burgdorferi (49.1%), Rickettsia spp. (29.1%) and Hepatozoon spp. (24.2%) (Table 2). Pairwise comparisons for the prevalence between the years revealed no significant differences.

Table 2.

The prevalence of TBPs in captured rodents, 2015–2017, Saxony, Germany

Rodent species (n) Prevalence of TBP (no. of positive rodents) [95% CI]
Bartonella spp. B. burgdorferi (s.l.) CNM Rickettsia spp. Hepatozoon spp.
A. flavicollis (n = 59) 78% (46) [65.7–86.8] 47.5% (28) [35.3–60] 59.3% (35) [46.6–70.9] 27.1% (16) [17.4–39.7] 6.8% (4) [2.2–16.6]
A. agrarius (n = 1) 0 0 0 0 0
A. terrestris (n = 1) 0 0 100% (1) [16.8–100] 0 0
M. glareolus (n = 104) 79.8% (83) [71–86.5] 51% (53) [41.5–60.4] 57.7% (60) [48.1–66.8] 30.8% (32) [22.7–40.2] 34.6% (36) [26.6–44.2]
Total (n = 165) 78.2% (129) [71.3–83.8] 49.1% (81) [41.6–56.7] 58.2% (96) [50.6–65.4] 29.1% (48) [22.7–36.5] 24.2% (40) [18.3–31.3]

All samples were negative for A. phagocytophilum and Babesia spp.

Abbreviations: 95% CI, 95% confidence interval; n, number of individuals

DNA of Bartonella spp., B. burgdorferi (s.l.) and Rickettsia spp. was recorded only in two rodent species, A. flavicollis and M. glareolus, with no significant differences in prevalence (P = 0.842, P = 0.745, P = 0.721, respectively) (Table 2). Hepatozoon spp. was the only pathogen which was significantly more prevalent (P < 0.0001) in M. glareolus (34.6%) than in A. flavicollis (6.8%). CNM was detected in three rodent species, although with no significant differences in prevalence rates regarding the rodent species (χ2= 0.754, df = 2, P = 0.686). The prevalence levels for CNM (P = 0.0003) and for B. burgdorferi (s.l.) (P < 0.0001) were significantly higher in males than in females of M. glareolus (77.1%, CI: 63.3–86.9%, n = 37 vs 41.1%, CI: 52.5–82.6%, n = 23; and 72.9%, CI: 58.9–83.5%, n = 35 vs 32.1%, CI: 21.4–45.2%, n = 18; respectively).

Sequencing of randomly selected rodent samples (n = 40; Table 3) revealed the presence of Bartonella taylorii (n = 1), uncultured Bartonella sp. (n = 5), Hepatozoon sp. BT-2014 isolate DB2382 (n = 11), Hepatozoon sp. clone PCE165 (n = 1), R. raoultii (n = 7), R. helvetica (n = 9) and Borrelia afzelii (n = 6). Co-infections in rodents (Table 4) were very common and were present in 122 small mammals (73.9%, CI: 66.7–80.1%). Triple co-infections were the most common and diverse with 9 different pathogen combinations detected in 50 rodents. The most prevalent co-infection (n = 25) was Bartonella spp. + CNM + B. burgdorferi (s.l.). Double infections with a variety of 7 different pathogen combinations were detected in 44 rodents. Three combinations of quadruple infections occurred in 18 small mammals, while the quintuple co-infections were present in 10 rodents.

Table 3.

Sequencing results for selected samples: rodents (n = 40), attached (n = 25) and questing ticks (n = 23), 2015–2017, Saxony, Germany

Detected pathogen Minimum identity (%) GenBank IDa Sample Type n
Babesia capreoli 100 KX839234 D. reticulatus Questing 1
Babesia microti 99 KX591647 I. ricinus Questing 1
Babesia venatorum 99 MG052939 I. ricinus Questing 1
Bartonella doshiae 97 AJ269786 I. ricinus Attached 1
Bartonella grahamii 100 CP001562 I. ricinus Attached 1
D. reticulatus Attached 3
Bartonella taylorii 99 AJ269788 I. ricinus Attached 3
D. reticulatus Attached 2
99 AJ269784 A. flavicollis – 1
Bartonella sp. N40 97 AJ269787 I. ricinus Attached 2
D. reticulatus Attached 2
Bartonella sp. 15AZ DNA 99 LN847263 I. ricinus Attached 1
Uncultured Bartonella 100 MF039571 A. flavicollis – 1
95 M. glareolus – 2
100 DQ155379 I. ricinus Attached 1
99 DQ155380 M. glareolus – 2
100 KX267692 I. ricinus Attached 1
Borrelia afzelii 99 CP009058 A. flavicollis – 1
100 CP018262 M. glareolus – 4
100 JX971363 M. glareolus – 1
Hepatozoon sp. BT-2014 isolate DB2382 99 KJ408528 A. flavicollis – 1
M. glareolus – 10
Hepatozoon sp. clone PCE165 99 KX776354 M. glareolus – 1
Rickettsia raoultii 99 CP019435 M. glareolus – 1
99 MF002527 M. glareolus – 6
D. reticulatus Questing 10
Rickettsia helvetica 99 KU310591 A. flavicollis – 2
M. glareolus – 7
I. ricinus Attached 3
I. ricinus Questing 7
99 KT835126 I. ricinus Attached 2
I. ricinus Questing 3
Rickettsia monacensis 100 KU961543 I. ricinus Attached 1
Uncultured Rickettsia 95 KX591658 I. ricinus Attached 1
D. reticulatus Attached 1

aMost similar sequence on GenBank

Abbreviation: n, number of samples sequenced

Table 4.

Co-infections detected in rodent samples, 2015–2017, Saxony, Germany

No. of co-infections (n = 122) Detected pathogen per co-infection No. of rodents with co-infection
Bartonella spp. CNM B. burgdorferi (s.l.) Rickettsia spp. Hepatozoon spp.
Quintuple (n = 10) + + + + + 10
Quadruple (n = 18) + + + + − 9
+ + + − + 7
+ + − + + 2
Triple (n = 50) + + + − − 25
− + + − + 6
+ + − + − 5
− + + + − 4
+ − + − + 3
+ − + + − 2
+ − − + + 2
+ + − − + 2
− − + + + 1
Double (n = 44) + + − − − 17
+ − + − − 10
+ − − + − 9
− + + − − 3
− − − + + 2
+ − − − + 2
− + − + − 1

Key: +, presence of pathogen; −, absence of pathogen

Abbreviation: CNM, “Candidatus Neoehrlichia mikurensis”

PCR results for attached ticks

In total, 4 out of 7 tested pathogens were detected. Anaplasma phagocytophilum, Hepatozoon spp. and Babesia spp. were not detected. Overall, the MIR for at least one of four detected pathogens for larvae was 62.8% (CI: 53.6–71.2%) and the general prevalence for nymphs was 75% (CI: 65.8–82.4%). However, B. burgdorferi (s.l.) was detected only in I. ricinus ticks, while CNM, Bartonella spp. and Rickettsia spp. were recorded in both I. ricinus and D. reticulatus (Table 5). CNM was found in D. reticulatus nymphs (9.8%), I. ricinus larvae (7.4%) and nymphs (17.4%; Table 5). Bartonella spp. was detected in all examined life stages and tick species with similar prevalence rates (32–40%). Rickettsia spp. was significantly the most often detected pathogen in both tick species, D. reticulatus (73.2%; χ2= 48.963, df = 2, P < 0.001) and I. ricinus (46.1%; χ2= 55.312, df = 3, P < 0.001). The prevalence for Rickettsia spp. was significantly higher (almost 3 times) in D. reticulatus than I. ricinus concerning nymphs (P < 0.0001). Statistical differences in the prevalence of TBPs was noted only for Rickettsia spp. regarding I. ricinus nymphs attached to M. glareolus (58.3%, CI: 28.8–75.6%) and to A. flavicollis (3.4%, CI: 0–18.7%) (P = 0.0005). There were no statistical differences in the prevalence levels for different pathogens between the years, except for Bartonella spp. which was the highest in 2016 and the lowest in 2015 (43.7%; χ2= 6.389, df = 2, P = 0.04). Further examinations of arbitrarily selected Rickettsia-positive (n = 8) and Bartonella-positive (n = 17) samples (Table 3) revealed presence of the following species (Table 3): R. helvetica (n = 5; 5 I. ricinus larvae pools), R. monacensis (n = 1; 1 I. ricinus larvae pool), uncultured Rickettsia sp. (n = 2; 1 I. ricinus and 1 D. reticulatus larvae pools) as well as B. grahamii (n = 4; 1 I. ricinus and 1 D. reticulatus larvae pools, 2 D. reticulatus nymphs), B. taylorii (n = 5; 2 I. ricinus and 1 D. reticulatus larvae pools, 1 I. ricinus and 1 D. reticulatus nymphs), B. doshiae (n = 1; 1 I. ricinus larvae pool), Bartonella sp. 15AZ DNA (1 I. ricinus nymph), Bartonella sp. N40 (n = 4; 2 I. ricinus and 2 D. reticulatus nymphs) and uncultured Bartonella spp. (n = 2; 2 I. ricinus nymphs). Co-infections were only examined for nymphs as larvae samples were pooled. Out of 104 examined nymphs 29 (27.9% CI: 20.1–37.1%) were co-infected with at least 2 pathogens. There was only one pathogen combination for triple infections (CNM + Rickettsia + Bartonella) which occurred in 6 ticks. Double infections occurred in 23 ticks with five different combinations of pathogens (15× Rickettsia spp. + Bartonella spp.; 3× B. burgdorferi + Bartonella spp.; 3× CNM + Bartonella spp.; 1× CNM + Rickettsia spp.; and 1× B. burgdorferi + CNM).

Table 5.

The prevalence of TBPs in selected ticks attached to rodents, 2015–2017, Saxony, Germany

Tick species No. of selected ticks (pools) Prevalence (no. of positive ticks) [95% CI]
B. burgdorferi (s.l.) Bartonella spp. CNM Rickettsia spp.
I. ricinus
 Larvaea 342 (108) 9.3% (10) [4.9–16.4] 32.4% (35) [24.3–41.7] 7.4% (8) [3.6–14.1] 40.7% (44) [31.9–50.2]
 Nymphs 53 11.3% (6) [4.9–22.9] 32.1% (17) [21.0–45.5] 17% (9) [9.0–29.51] 28.3% (15) [17.9–41.7]
D. reticulatus
 Larvaea 9 (5) 0 40% (2) [11.6–77.1] 0 20% (1) [2.0–64.0]
 Nymphs 51 0 35.3% (18) [23.6–49.1] 9.8% (5) [3.8–21.4] 78.4% (40) [65.2–87.7]

All samples tested negative for Babesia spp., Hepatozoon spp. and Anaplasma phagocytophilum

aPrevalence levels for larvae are calculated as MIR

Abbreviations: 95% CI, 95% confidence interval; CNM, “Candidatus Neoehrlichia mikurensis”

PCR results for questing ticks

DNA of at least one of the tested pathogens was found in 63 out of 220 ticks (28.6%, CI: 23.1–35.0%). All samples were negative for Hepatozoon spp., Bartonella spp. and A. phagocytophilum. Ixodes ricinus ticks were positive for 4 out of 7 pathogens with significantly different prevalence levels (χ2= 14.841, df = 3, P = 0.002); the highest was observed for Rickettsia spp. (10.3%), followed by CNM (8.3%), B. burgdorferi (s.l.) (7.2%) and Babesia spp. (1%) (Table 6). Dermacentor reticulatus tested positive for only two pathogens (Table 6), with Rickettsia spp. (76.9%) significantly more prevalent (over 20 times) than Babesia spp. (3.8%) (P < 0.0001). The prevalence for Rickettsia spp. was significantly higher (almost 7.5 times) in D. reticulatus than in I. ricinus (P < 0.0001). The statistical difference in the prevalence rates for different pathogens between the years was noted only for B. burgdorferi which was the highest in 2015 in comparison to the years 2016 and 2017 (χ2= 7.363, df = 2, P = 0.03). Randomly selected Rickettsia-positive samples (n = 20) and all Babesia-positive samples (n = 3) were further sequenced (Table 3). Rickettsia helvetica (n = 10) was found in I. ricinus, while R. raoultii (n = 10) was found in D. reticulatus. Regarding Babesia, three species were detected: B. capreoli (n = 1) in D. reticulatus, and B. microti (n = 1) and B. venatorum (n = 1) in I. ricinus. Co-infections in questing ticks were seldom: they were present only in 8 ticks (3.6%, CI: 1.7–7.1%). Most of them occurred in I. ricinus (n = 7). Double infections were the most common (n = 6), with three different pathogen combinations (3× B. burgdorferi + Rickettsia spp., 2× CNM + Rickettsia spp. and 1× Babesia spp. + Rickettsia spp.). Triple co-infections were observed only in 2 cases: in D. reticulatus and I. ricinus ticks, with 2 different pathogen combinations (1× B. burgdorferi + CNM + Babesia spp. and 1× B. burgdorferi + CNM + Rickettsia spp.).

Table 6.

The prevalence of TBPs in selected questing ticks, 2015–2017, Saxony, Germany

Tick species Prevalence (number of positive ticks) [95% CI]
Babesia spp. B. burgdorferi (s.l.) CNM Rickettsia spp.
I. ricinus (n = 194) 1.0% (2) [0–3.9] 7.2% (14) [4.3–11.8] 8.3% (16) [5.1–13.1] 10.3% (20) [6.7–15.5]
D. reticulatus (n = 26) 3.8% (1) [0–20.5] 0 0 76.9% (20) [57.6–89.3]
Total (n = 220) 1.4% (3) [0.3–4.1] 6.4% (14) [3.8–10.5] 7.3% (16) [4.5–11.6] 18.2% (40) [13.6–23.8]

Note: All ticks were negative for Hepatozoon spp., Bartonella spp. and Anaplasma phagocytophilum

Abbreviations: 95% CI, 95% confidence interval; CNM, “Candidatus Neoehrlichia mikurensis”

The prevalence for Rickettsia spp. was significantly higher in attached ticks in comparison to rodents and questing ticks (χ2= 40.082, df = 2, P < 0.001). Borrelia burgdorferi, CNM, Bartonella spp. and Hepatozoon spp. were more prevalent in rodents than in questing and attached ticks (χ2= 141.338, df = 2, P < 0.001; χ2= 170.022, df = 2, P < 0.001; χ2= 259.132, df = 2, P < 0.001; and χ2= 113.48, df = 2, P < 0.001; respectively; Tables 2, 5, 6). However, 7 larvae pools/nymphs attached to uninfected rodents were positive for Bartonella spp.

Comparing the present results with previous studies

The results from this study were compared with results obtained in 2009–2014 from the same sites [4, 18, 29, 33–35]. Regarding the numbers and diversity of captured small mammals, there is a visible decreasing trend. In the past, a total of 10 small mammal species were captured, while in the present study only 4 rodent species were found. Furthermore, the species of attached ticks were more diverse in the previous investigations, since I. trianguliceps and unidentified Dermacentor and Ixodes ticks were also found. In the present study, A. phagocytophilum was absent in each type of tested sample, while previously it had been detected in small mammals, questing and attached ticks [4, 29]. Rodents and attached ticks were also Babesia-negative, whereas before they had been positive [29, 34]. Regarding questing ticks, the prevalence for Babesia spp. in I. ricinus slightly decreased from 4.1% in 2009 to 1% in the present study (P = 0.0359) [29]. However, in this investigation DNA of Babesia was additionally found in questing D. reticulatus. In the present study B. burgdorferi (s.l.) was detected in questing ticks (also only in I. ricinus) with no statistical differences compared to the former research [33]; however, the present prevalence in small mammals (49.1%) was much higher than in the past (31.2%) (P < 0.0001). Borrelia burgdorferi (s.l.) in attached ticks had not been tested in the previous investigations. The prevalence for Rickettsia spp. in questing, attached ticks and small mammals seems to be stable over the years as it had been similar in the past [18, 33]. The infection levels of CNM seem to be increasing. The prevalence from this research was significantly higher than in the last study [4] in small mammals (41.2 vs 58.2%, P = 0.0003) and the prevalence for attached ticks in the past was fluctuating from 1.9 to 9.8% while now the average MIR for larvae was 7.1% and the average prevalence for nymphs was 13.5%. Bartonella spp. remained the most often detected pathogen in small mammals [35]. The prevalence in small mammals decreased from 73.9% in 2010 to 43.3% in 2013 ([35], our unpublished data] and has since (2015–2017) increased up to 78.2% (data missing for 2014). The infection levels in attached ticks also increased from 16.3% in 2010–2011 (our unpublished data) to 32.7% (MIR for larvae) and 33.7% (for nymphs) in the present study (with a gap in the years 2012–2014).

Discussion

This study reassessed the prevalence of TBP over 9 years in ticks and rodents from sites previously examined by our group in the surroundings of Leipzig, Saxony, Germany [4, 18, 29, 33–35]. Although such long-term investigations are scarce, they may be of importance from a public health point of view to survey dynamics of TBP in hosts and vectors as this may help to predict the distribution and maintenance of TBP in future. The number of captured rodents and questing ticks as well as their species diversity has been decreasing through the years. In contrast, the average tick infestation on rodents has been rising in recent years. A reason for this phenomenon may be the so-called dilution effect. This effect describes that the higher the number of individuals in a host population the lower the tick burden per host individual [37]. In line with a former study, D. reticulatus was exclusively found on M. glareolus while I. ricinus did not have such a host association [18].

CNM is widespread in rodents across Eurasia with a prevalence ranging between 10.8–52.7% in Germany and other European countries, such as the Netherlands and Slovakia [36, 38, 39]. Earlier, it was described that male rodents were more often infected with CNM than females [4]. The present research confirms a sex-biased difference in the prevalence for CNM in M. glareolus. Previous studies explained this bias by a higher activity rate of males and due to immunosuppressive effects and higher aggression levels resulting in a higher chance of encountering the pathogen through fights [40]. Through wounds, scratches and/or bites pathogens may be transmitted directly to the bloodstream. Previous studies from Austria, France and the Netherlands showed a moderate prevalence (1.7–22%) in the known CNM vector, I. ricinus [41–43]. The prevalence in the present study was statistically lower in questing ticks than in previous studies [36]. CNM has been rarely investigated in D. reticulatus ticks. In this study it could be found only in attached D. reticulatus and not questing individuals, suggesting that it was probably a temporary uptake through the blood meal. Previously B. burgdorferi (s.l.) was described in rodents in other European countries with a prevalence of up to 77% in Austria [44]. In the present study, the prevalence of B. burgdorferi (s.l.) in rodents has significantly increased in the years 2015–2017 compared to 2012–2014 (from 31 to 49%) [33]. A previous investigation showed B. burgdorferi (s.l.) has many mechanisms to elude the hosts’ immune system, thus persisting in their rodent host [45]. One proven effect is described by a T-dependent B cell response which is subverted during infection in reservoir hosts. This could be a reason for the rise of the prevalence over the years. However, a dilution effect may not be ruled out as the population size of rodents decreased over the years, while the tick density increased per rodent. As described earlier for CNM, male M. glareolus were likewise more often infected than females. Sequencing from rodent samples confirmed the presence of pathogenic B. afzelii, the main rodent-associated Borrelia species [46]. Although the prevalence in small mammals increased, it did not vary in ticks over the years in this study. The prevalence in questing and attached I. ricinus ticks from the present study was in line with other European countries, e.g. Estonia, Belarus, Slovakia and Austria (8.2–13.5%) [14, 47, 48]. Rickettsia spp. were found in almost 24% of the rodents from this study which was higher compared to the prevalence detected in other parts of Germany, e.g. Mecklenburg-Western Pomerania, Thuringia and Baden-Wuerttemberg (6.8–9.4%) [49], and similar to a study from Lithuania (27.6%) [50]. Previous investigations in Europe revealed the occurrence of R. helvetica in A. agrarius, A. flavicollis and M. glareolus [51]. An earlier study by our group also showed the presence of R. raoultii in small mammals [18]. DNA of Rickettsia spp. was found in larvae attached to positive as well as to negative rodents, which supports the hypothesis of transovarial transmission of Rickettsia in ticks [52]. The current prevalence of 10.3% in I. ricinus is relatively low compared to the prevalence from previous studies in Germany (18–25%) and other European countries, e.g. France (16%) [18, 33, 53]. The infection level in attached (20–78.4%) and questing (76.9%) D. reticulatus ticks from the present study was much higher than in Dermacentor ticks from Poland and the Czech Republic (18–41%) [54, 55]. The previous prevalence from the same sites showed a likewise high prevalence in questing D. reticulatus (70.5%) [33]. Rickettsia raoultii was detected only in questing D. reticulatus ticks with a very high prevalence and in M. glareolus with a low infection rate, which is in accordance with studies suggesting the transovarial transmission of R. raoultii in D. reticulatus is more significant than feeding on reservoir hosts in order to maintain in the natural life-cycle [18]. Bartonella spp. in rodents are highly prevalent in Europe with prevalence rates ranging between 16–56% in France, Denmark and Poland [56–58]. In the present study the prevalence was 78% in rodents and thus the highest in comparison to all other examined TBPs. A previous examination at the same study sites [35] detected a lower prevalence of 65.8% and the following species: B. grahamii, B. taylorii, Bartonella sp. N40; and a variety of uncultured Bartonella species. In the present study, only B. taylorii and uncultured Bartonella strains were detected. Bartonella taylorii is known to be non-pathogenic to humans and the uncultured Bartonella spp. are currently of unknown pathogenicity [59]. Previously it had been shown that the prevalence for Bartonella spp. is significantly higher in Apodemus than in Myodes due to a deficiency in resolving the infection in Apodemus [60]. However, it was also shown that the prevalence of Bartonella spp. in M. glareolus, studied over 11 years, was subjected to great fluctuations and may even double over the years before declining again, as the prevalence is dependent on changes in the rodent population such as density and mean age [61]. Bartonella spp. could not be detected in questing ticks from the present study, supporting the hypothesis that ticks play a subordinate role in the transmission of rodent-associated Bartonella. Earlier studies from our group, however, support the hypothesis that ticks play a role in the life-cycle of Bartonella spp. since B. chomelii was detected in ticks attached to rodents. This Bartonella species is, however, associated with domesticated ruminants [62]. In the present study, seven attached larvae pools/nymphs were positive for Bartonella spp. even though the host was negative. Previously our group suggested that D. reticulatus plays a subordinate role in the transmission cycle compared to I. ricinus. However, the present study found almost equally high prevalence rates in attached D. reticulatus and I. ricinus. To our knowledge, there are thus far no studies focussed on the presence of Hepatozoon spp. small mammals in Germany. Studies from Spain, Slovakia and Poland reported a prevalence range of 4.5–41.6% in different rodent species, including A. flavicollis and M. glareolus [30, 63, 64]. In the present study, the prevalence of Hepatozoon spp. in rodents was 31.1%. In accordance with a study from Slovakia, M. glareolus showed a significantly higher prevalence than A. flavicollis [64]. This was also observed in rodents from Finland and Poland [30, 65]. Hepatozoon strains detected in small mammals from this study are known to have a wide host range and were previously detected in small mammals and reptiles [66]. It is not surprising that attached ticks as well as questing ticks were negative for Hepatozoon spp. in the present study, as rodent-associated Hepatozoon spp. are mainly transmitted by rodent-associated fleas [67]. Babesia DNA in this research was barely detected in questing ticks (1.4%) and not at all in rodents or in attached ticks. However, previous investigations from the same study sites revealed a similar prevalence in questing ticks (1.6%) and very low prevalence in attached ticks (0.3–0.5%) and rodents (0.6–2.5%) [29, 34]. The prevalence for Babesia in rodents from other European studies showed similarly low levels in rodents; however, the study from the UK reported a much higher prevalence (27.2%) [68]. The prevalence in questing ticks in former studies from Sweden and Poland varied but also in a lower range (up to 4.6%; B. venatorum, B. microti and B. divergens) [69, 70]. In the present study, B. venatorum and B. microti were detected in I. ricinus, and B. capreoli in D. reticulatus. Babesia venatorum and B. microti are zoonotic agents and have been previously detected in I. ricinus from other European countries [69–71]. Thus far only the “Jena” strain of B. microti is thought to be pathogenic to humans in Europe [72]. However, the B. microti strain detected in this study showed 99% identity to a non-pathogenic Ukrainian B. microti strain. Babesia capreoli, which is thought to be non-pathogenic, has previously been described in I. ricinus, with reindeer serving as main hosts in Europe [71, 73]. Interestingly, exclusively these three Babesia species described here were also previously detected at the same study sites [29].

In other studies from Germany, the prevalence for A. phagocytophilum in ticks varied between 1.9–8.9% [74–76]. In this investigation A. phagocytophilum DNA was neither detected in rodents nor in ticks. However, earlier results from our group showed a low prevalence in both rodents (1.1%; [4]) and questing ticks (5.3%; [29]). The explanation for the observed decline may be the effect of the resistance against A. phagocytophilum developed by rodents which may persist from 12 weeks up to a year, protecting them from re-infection and preventing uninfected ticks from infection, thus interrupting the infection cycle [77].

In comparison to the overall prevalence for TBPs in attached and questing ticks from this study, the level for rodents was generally higher, also resulting in a high co-infection rate. Even though the co-infection levels in questing ticks were very low as well as the prevalence for Babesia spp. (only 3 out of 220 ticks), most Babesia-positive ticks were co-infected leading to the assumption that infections with Babesia favour co-infections with other pathogens. The current co-infection level in rodents (over 70%) is much higher compared to a study from Austria where only 8.1% of the rodents were infected with more than one pathogen [78].

Conclusions

This study reports very high prevalence levels for TBP, especially in rodents. This is the first study focussing on the presence of Hepatozoon spp. in rodents from Germany. Furthermore, over a 9-year long trend, it should be taken into account that the number and the species diversity of rodents and questing ticks collected have been declining, while the average infestation rate for ticks attached to rodents has been increasing. While prevalence for A. phagocytophilum and Babesia spp. in general decreased or/and were not detected at all in the present study, the prevalence for CNM, Bartonella spp. and B. burgdorferi (s.l.), particularly in rodents, seems to be rising. Rickettsia spp. are the only pathogens in which the prevalence in rodents, attached and questing ticks has remained at the same level over the years. Although the prevalence rates for certain pathogens differed between the years, the detected pathogen species did not change with time.

Methods

Collection sites

Rodents and questing ticks were sampled from 2015 to 2017 at four locations in the surroundings of Leipzig, Saxony, Germany. The sites had previously been described, examined and named (“E”, “F”, “H1” and “H2”) [35]. Sites E (51°15′36.5″N, 12°21′00.4″E) and F (51°17′00.9″N, 12°21′02.8″E) are located in the east and the north of the lake “Cospuden” which was artificially created from a former brown coal mining area. Site H1 (51°18′14.6″N, 12°24′41.4″E) and H2 (51°17′35.5″N, 12°24′07.5″E) are also renatured areas and parts of the “Lößnig-Dölitz” city park which is also a renatured site and was created on a former waste disposal area.

Small mammal trapping

The trapping of small mammals took place in April to October 2015, May to November 2016 and March to October 2017. Twenty-five Sherman© live animal traps (H. B. Sherman Traps Inc., Tallahassee, FL, USA) were set for two successive nights each month at each site at the same time. Apple slices were used as bait and hay as isolation material. The traps were controlled twice a day; captured rodents were anesthetized on the spot with CO2 and euthanized by cervical dislocation. The rodents were morphologically identified using taxonomic key [79] and dissected in the laboratory. Attached ticks, skin and spleen samples were taken from each rodent and stored at -80 °C until further processing.

Attached and questing ticks

Questing ticks were collected simultaneously with each rodent trapping action by the flagging method. Questing and attached ticks were stored at −80 °C until morphological identification [80] and further analysis. A total of 455 ticks were selected for further PCR analysis examining tick-borne pathogens, including 231 I. ricinus (207 larvae and 24 nymphs) obtained from 64 M. glareolus, 164 I. ricinus (135 larvae and 29 nymphs) from 41 A. flavicollis and 60 D. reticulatus (9 larvae, 51 nymphs) from 15 M. glareolus (Table 1). Altogether 351 larvae were tested in 113 pools: 342 I. ricinus larvae in 108 pools and 9 D. reticulatus larvae in 5 pools. Concerning questing ticks, a total of 194 I. ricinus and 26 D. reticulatus were selected for further molecular examination.

DNA extraction from rodents and ticks

For DNA extraction, 0.6 g of sterile ceramic beads (sized 1.4 mm, Peqlab Biotechnologie, Erlangen, Germany) and 500 μl of PBS were added to each rodent sample. For ticks, 1 g of steel beads (sized 2.8 mm) was used instead of ceramic beads. The samples were then homogenized at 5500× rpm for 3 × 15 s with 10 s break intervals in a Precellys®24 tissue homogenizer (Bertin Technologies, Montigny Le Bretonneux, France). Due to financial restrictions, not all ticks were selected for further analysis. Up to five questing ticks per tick species, collection site, per month and year were randomly chosen. Attached ticks were likewise selected with the addition of up to five attached specimens per small mammal species (up to 30 host individuals per rodent species per month and collection site). Attached larvae were further tested in pools of up to 5 individuals according to the selection criteria. DNA was extracted with a QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) as per the manufacturer’s recommended protocol, followed by quantitative and qualitative measures with a spectrophotometer (NanoDrop® 2000c, Thermo Fisher Scientific, Waltham, Ma, USA).

PCR methods

All DNA samples were screened for the presence of A. phagocytophilum, Babesia spp., B. burgdorferi (s.l.), CNM and Rickettsia spp. by real-time and/or conventional PCRs. Samples positive for B. burgdorferi (s.l.) were additionally processed via multi locus sequence typing (MLST). All samples were moreover examined for Bartonella spp. and Hepatozoon spp. Details on used PCR protocols are presented in Table 7. For the detection of Hepatozoon spp., the initial annealing was changed to 52 °C. All Babesia-positive samples (n = 3) and a randomly selected number of samples positive for Bartonella spp. (n = 23), Hepatozoon spp. (n = 12), Borrelia spp. (n = 6) and Rickettsia spp. (n = 44; Table 3) were commercially sequenced (Interdisziplinäres Zentrum für Klinische Forschung, Leipzig, Germany). Results were aligned using Bionumerics v.7.6.1 (Applied Maths Inc., Austin, TX, USA) and compared with sequences published in GenBank using BLASTn. New allelic combinations were registered in the Borrelia spp. MLST database under the sequence types ST 787–792.

Table 7.

Details on primers and PCR assays used for the detection of tick-borne pathogens in different tissues from rodents and ticks

Pathogen PCR type Primer name Primer/probe sequence (5′–3′) Gene (amplicon size) (bp) Reference
Anaplasma phagocytophilum RT ApMsp2f ATGGAAGGTAGTGTTGGTTATGGTATT msp2 (77) [81]
ApMsp2r TTGGTCTTGAAGCGCTCGTA
ApMsp2p FAM-TGGTGCCAGGGTTGA GCTTGAGATTG-BHQ1
Babesia spp. C BJ1 GTCTTGTAATTGGAATGATGG 18S rRNA (411–452) [82]
BN2 TAGTTTATGGTTAGGACTACG
Bartonella spp. C Ba325s CTTCAGATGATGATCCCA AGCCTTCTGGCG 16S-23S rRNA (ITS) (453–780) [83]
Ba1100as GAACCGACGACCCCCTGCTTGCAAAGC
Borrelia burgdorferi (s.l.) RT FlaF1a AGCAAATTTAGGTGCTTTCCAA P41 (96) [84]
FlaR1 GCAATCATTGCCATTGCAGA
FlaProbe1 FAM-TGCTACAACCTCATCTG TCATTGTAGCATCTTTTATTTG-BBQ
MLSTa cplAF1255 AAAGATAGATTTCTTCCAGAC clpA (579) [33, 85]
cplAR2104 GAATTTCATCTATTAAAAGCTTTC
clpXF403 GCTGCAGAGATGAATGTGCC clpX (624)
clpXR1124 GATTGATTTCATATAACTCTTTTG
nifF1 ATGGATTTCAAACAAATAAAAAG nifS (564)
nifR719 GATATTATTGAATTTCTTTTAAG
pepXF449 TTATTCCAAACCTTGCAATCC pepX (570)
pepXR1115 GTTCCAATGTCAATAGTTTC
pyrF448 GATTGCAAGTTCTGAGAATA pyrG (603)
pyrR1154 CAAACATTACGAGCAAATTC
recF917 CCCTTGTTGCCTTGCTTTC recG (651)
recR1658 GAAAGTCCAAAACGCTCAG
rplfF40 TGGGTATTAAGACTTATAAGC rplB (624)
rplR760 GCTGTCCCCAAGGAGACA
uvrF1434 GAAATTTTAAAGGAAATTAAAAGTAG uvrA (570)
uvrR2111 CAAGGAACAAAAACATCTGG
“Candidatus Neoehrlichia mikurensis” RT NMikGroEL F2 CCTTGAAAATATAGCAAGATCAGGTAG groEL (99) [36, 38]
NMikGroEL rev1 CCACCACGTAACTTATTTAGCACTAAAG
NMikGroEL rev2 CCACCACGTAACTTATTTAGTACTAAAG
NMikGroEL-P2a FAM-CCTCTACTAATTATTGCT GAAGATGTAGAAGGTGAAGC-BHQ1
Hepatozoon spp. C Hep-1f CGCGAAATTACCCAATT 18S rRNA (660) [63, 86]
Hep-2r CAGACCGGTTACTTTYAGCAG
Rickettsia spp. RT Pan Rick gltA_2 for ATAGGACAACCGTTTATTT gltA (70) [87]
Pan Rick gltA_2 rev CAAACATCATATGCAGAAA
Pan Rick gltA_3 taq 6FAM-CCTGATAATTCGTTA GATTTTACCG–TMR
Ca 120–2788 AAACAATAATCAAGGTACTGT OmpB (811) [88]
120–3599 TACTTCCGGTTACAGCAAAGT

aOnly carried out if real-time PCR yielded

Abbreviations: C, conventional PCR; RT, real-time PCR; MLST, multi-locus sequence typing

Statistical analysis

Confidence intervals (95% CI) for the prevalence of pathogens were determined by the modified Wald method using GraphPad Prism v.4 (Graph Pad Software, San Diego, CA, USA). Chi-square and Fisher’s tests were used to test the prevalence levels for significant independence. The significance threshold was set at P = 0.05. The prevalence levels for attached larvae are given as MIR (minimal infection rate) as these were pooled.

Acknowledgements

The authors wish to thank Yauhen Karliuk, Lisa Hanne Nau, Johanna Fürst, Gina Gräser and Alexandra Fischer for their help in fieldwork. Furthermore, the authors wish to thank Dana Rüster and Dr Stephanie Speck for their technical advice and support. Publication of this paper has been sponsored by Bayer Animal Health in the framework of the 14th CVBD World Forum Symposium.

Funding

Not applicable.

Availability of data and materials

The data supporting the conclusions of this article are included within the article. The raw data used and/or analyzed during the present study are available from the corresponding author upon reasonable request.

Authors’ contributions

MP, NK and AO organized and planned the study. AO, NK and DG organized and participated in fieldwork. DG, NK and AO prepared the samples in the laboratory. DG and NK carried out tick identification. DG tested the samples for the presence of tick-borne pathogens. DG and AO performed the sequence analysis. NK performed the statistical analysis. DG, AO, NK and MP drafted the manuscript and wrote the final version. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Rodent trapping as well as euthanasia of rodents was carried out with the permit by the local government in Saxony, Germany (local permission numbers: 364.620/30/6/2, 36.11-36.45.12/4/12-0001-MA).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Abbreviations

BLAST

Basic Local Alignment Search Tool

CI

confidence interval

CNM

“Candidatus Neoehrlichia mikurensis”

ITS

intergenic spacer

MIR

minimum infection rate

MLST

multi-locus sequence typing

PBS

phosphate-buffered saline

PCR

polymerase chain reaction

SD

standard deviation

SFG

spotted fever group

ST

sequence type

TBP

tick-borne pathogens

Contributor Information

Daniel Galfsky, Email: dgalfsky@gmail.com.

Nina Król, Email: nina.krol@vetmed.uni-leipzig.de.

Martin Pfeffer, Email: Pfeffer@vetmed.uni-leipzig.de.

Anna Obiegala, Email: Anna.Obiegala@vetmed.uni-leipzig.de.

References

  • 1.Burri C, Schumann O, Schumann C, Gern L. Are Apodemus spp. mice and Myodes glareolus reservoirs for Borrelia miyamotoi, Candidatus Neoehrlichia mikurensis, Rickettsia helvetica, R. monacensis and Anaplasma phagocytophilum? Ticks Tick Borne Dis. 2014;5:245–251. doi: 10.1016/j.ttbdis.2013.11.007. [DOI] [PubMed] [Google Scholar]
  • 2.Rizzoli A, Silaghi C, Obiegala A, Rudolf I, Hubálek Z, Földvári G, et al. Ixodes ricinus and its transmitted pathogens in urban and peri-urban areas in Europe: new hazards and relevance for public health. Front Public Health. 2014;2:251. doi: 10.3389/fpubh.2014.00251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Andersson M, Bartkova S, Lindestad O, Råberg L. Co-infection with ‘Candidatus Neoehrlichia mikurensis’ and Borrelia afzelii in Ixodes ricinus ticks in southern Sweden. Vector Borne Zoonotic Dis. 2013;13:438–442. doi: 10.1089/vbz.2012.1118. [DOI] [PubMed] [Google Scholar]
  • 4.Obiegala A, Pfeffer M, Pfister K, Tiedemann T, Thiel C, Balling A, et al. Candidatus Neoehrlichia mikurensis and Anaplasma phagocytophilum: prevalences and investigations on a new transmission path in small mammals and ixodid ticks. Parasit Vectors. 2014;7:563. doi: 10.1186/s13071-014-0563-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Karbowiak G, Vichová B, Slivinska K, Werszko J, Didyk J, Peťko B, et al. The infection of questing Dermacentor reticulatus ticks with Babesia canis and Anaplasma phagocytophilum in the Chernobyl exclusion zone. Vet Parasitol. 2014;204:372–375. doi: 10.1016/j.vetpar.2014.05.030. [DOI] [PubMed] [Google Scholar]
  • 6.Jahfari S, Coipan EC, Fonville M, van Leeuwen AD, Hengeveld P, Heylen D, et al. Circulation of four Anaplasma phagocytophilum ecotypes in Europe. Parasit Vectors. 2014;15:365. doi: 10.1186/1756-3305-7-365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Von Loewenich FD, Geißdörfer W, Disqué C, Matten J, Schett G, Sakka SG, et al. Detection of “Candidatus Neoehrlichia mikurensis” in two patients with severe febrile illnesses: evidence for a European sequence variant. J Clin Microbiol. 2010;48:2630–2635. doi: 10.1128/JCM.00588-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Obiegala A, Silaghi C. Candidatus Neoehrlichia mikurensis - recent insights and future perspectives on clinical cases, vectors, and reservoirs in Europe in humans. Curr Clin Microbiol Rep. 2018;1:1. doi: 10.1007/s40588-018-0085-y. [DOI] [Google Scholar]
  • 9.Liz JS, Anderes L, Sumner JW, Massung RF, Gern L, Rutti B, et al. PCR detection of granulocytic ehrlichiae in Ixodes ricinus ticks and wild small mammals in western Switzerland. J Clin Microbiol. 2000;38:1002–1007. doi: 10.1128/jcm.38.3.1002-1007.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Alberdi MP, Walker AR, Urquhart KA. Field evidence that roe deer (Capreolus capreolus) are a natural host for Ehrlichia phagocytophila. Epidemiol Infect. 2000;124:315–323. doi: 10.1017/S0950268899003684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Michalik J, Stańczak J, Cieniuch S, Racewicz M, Sikora B, Dabert M. Wild boars as hosts of human-pathogenic Anaplasma phagocytophilum variants. Emerg Infect Dis. 2012;18:998–1001. doi: 10.3201/eid1806.110997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Silaghi C, Skuballa J, Thiel C, Pfister K, Petney T, Pfäffle M, et al. The European hedgehog (Erinaceus europaeus) - a suitable reservoir for variants of Anaplasma phagocytophilum? Ticks Tick Borne Dis. 2012;3:49–54. doi: 10.1016/j.ttbdis.2011.11.005. [DOI] [PubMed] [Google Scholar]
  • 13.Parola P, Paddock CD, Socolovschi C, Labruna MB, Mediannikov O, Kernif T, et al. Update on tick-borne rickettsioses around the world: a geographic approach. Clin Microbiol Rev. 2013;26:657–702. doi: 10.1128/CMR.00032-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Reye AL, Stegniy V, Mishaeva NP, Velhin S, Hübschen JM, Ignatyev G, et al. Prevalence of tick-borne pathogens in Ixodes ricinus and Dermacentor reticulatus ticks from different geographical locations in Belarus. PLoS One. 2013;8:e54476. doi: 10.1371/journal.pone.0054476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Ortuño A, Pons I, Quesada M, Lario S, Anton E, Gil A, et al. Evaluation of the presence of Rickettsia slovaca infection in domestic ruminants in Catalonia, northeastern Spain. Vector Borne Zoonotic Dis. 2012;12:1019–1022. doi: 10.1089/vbz.2012.0972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ortuño A, Quesada M, Lopez-Claessens S, Castella J, Sanfeliu I, Anton E, et al. The role of wild boar (Sus scrofa) in the eco-epidemiology of R. slovaca in northeastern Spain. Vector Borne Zoonotic Dis. 2007;7:59–64. doi: 10.1089/vbz.2006.0576. [DOI] [PubMed] [Google Scholar]
  • 17.Inokuma H, Seino N, Suzuki M, Kaji K, Takahashi H, Igota H, et al. Detection of Rickettsia helvetica DNA from peripheral blood of Sika deer (Cervus nippon yesoensis) in Japan. J Wildl Dis. 2008;44:164–167. doi: 10.7589/0090-3558-44.1.164. [DOI] [PubMed] [Google Scholar]
  • 18.Obiegala A, Oltersdorf C, Silaghi C, Kiefer D, Kiefer M, Woll D, et al. Rickettsia spp. in small mammals and their parasitizing ectoparasites from Saxony, Germany. Vet Parasitol Reg Stud Rep. 2016;5:19–24. doi: 10.1016/j.vprsr.2016.08.008. [DOI] [PubMed] [Google Scholar]
  • 19.Martello E, Selmi M, Ragagli C, Ambrogi C, Stella MC, Mannelli A, et al. Rickettsia slovaca in immature Dermacentor marginatus and tissues from Apodemus spp. in the northern Apennines, Italy. Ticks Tick Borne Dis. 2013;4:518–521. doi: 10.1016/j.ttbdis.2013.07.002. [DOI] [PubMed] [Google Scholar]
  • 20.Stanek G, Wormser GP, Gray J, Strle F. Lyme borreliosis. Lancet. 2012;379:461–473. doi: 10.1016/S0140-6736(11)60103-7. [DOI] [PubMed] [Google Scholar]
  • 21.Canica MM, Nato F, Merle LD, Mazie JC, Baranton G, Postic D. Monoclonal antibodies for identification of Borrelia afzelii sp. nov. associated with late cutaneous manifestations of Lyme borreliosis. Scand J Infect Dis. 1993;25:441–448. doi: 10.3109/00365549309008525. [DOI] [PubMed] [Google Scholar]
  • 22.Birtles RJ. Bartonellae as elegant hemotropic parasites. Ann N Y Acad Sci. 2005;1063:270–279. doi: 10.1196/annals.1355.044. [DOI] [PubMed] [Google Scholar]
  • 23.Dreier J, Vollmer T, Freytag CC, Bäumer D, Körfer R, Kleesiek K. Culture-negative infectious endocarditis caused by Bartonella spp.: 2 case reports and a review of the literature. Diagn Microbiol Infect Dis. 2008;61:476–483. doi: 10.1016/j.diagmicrobio.2008.03.008. [DOI] [PubMed] [Google Scholar]
  • 24.Kjemtrup AM, Conrad PA. Human babesiosis: an emerging tick-borne disease. Int J Parasitol. 2000;30:1323–1337. doi: 10.1016/S0020-7519(00)00137-5. [DOI] [PubMed] [Google Scholar]
  • 25.Baneth G, Aroch I, Tal N, Harrus S. Hepatozoon species infection in domestic cats: a retrospective study. Vet Parasitol. 1998;79(Suppl. 2):123–133. doi: 10.1016/S0304-4017(98)00160-5. [DOI] [PubMed] [Google Scholar]
  • 26.Siński E, Bajer A, Welc R, Pawełczyk A, Ogrzewalska M, Behnke JM. Babesia microti: prevalence in wild rodents and Ixodes ricinus ticks from the Mazury Lakes District of north-eastern Poland. Int J Med Microbiol. 2006;296:137–143. doi: 10.1016/j.ijmm.2006.01.015. [DOI] [PubMed] [Google Scholar]
  • 27.Becker CAM, Bouju-Albert A, Jouglin M, Chauvin A, Malandrin L. Natural transmission of Zoonotic Babesia spp. by Ixodes ricinus ticks. Emerg Infect Dis. 2009;15:320–322. doi: 10.3201/eid1502.081247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Häselbarth K, Tenter AM, Brade V, Krieger G, Hunfeld KP. First case of human babesiosis in Germany - clinical presentation and molecular characterisation of the pathogen. Int J Med Microbiol. 2007;297:197–204. doi: 10.1016/j.ijmm.2007.01.002. [DOI] [PubMed] [Google Scholar]
  • 29.Silaghi C, Woll D, Hamel D, Pfister K, Mahling M, Pfeffer M. Babesia spp. and Anaplasma phagocytophilum in questing ticks, ticks parasitizing rodents and the parasitized rodents - analyzing the host-pathogen-vector interface in a metropolitan area. Parasit Vectors. 2012;5:191. doi: 10.1186/1756-3305-5-191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Karbowiak G, Rychlik L, Nowakowski W, Wita I. Natural infections of small mammals with blood parasites on the borderland of boreal and temperate forest zones. Acta Theriol. 2005;50:31–42. doi: 10.1007/BF03192616. [DOI] [Google Scholar]
  • 31.Krampitz HE, Haberkorn A. Experimental treatment of Hepatozoon infections with the anticoccidial agent toltrazuril. Zentralbl Veterinarmed B. 1988;3:131–137. doi: 10.1111/j.1439-0450.1988.tb00478.x. [DOI] [PubMed] [Google Scholar]
  • 32.Najm NA, Meyer-Kayser E, Hoffmann L, Pfister K, Silaghi C. Hepatozoon canis in German red foxes (Vulpes vulpes) and their ticks: molecular characterization and the phylogenetic relationship to other Hepatozoon spp. Parasitol Res. 2014;113:2679–2685. doi: 10.1007/s00436-014-3923-8. [DOI] [PubMed] [Google Scholar]
  • 33.Obiegala A, Król N, Oltersdorf C, Nader J, Pfeffer M. The enzootic life-cycle of Borrelia burgdorferi (sensu lato) and tick-borne rickettsiae: an epidemiological study on wild-living small mammals and their ticks from Saxony, Germany. Parasit Vectors. 2017;10:115. doi: 10.1186/s13071-017-2053-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Obiegala A, Pfeffer M, Pfister K, Karnath C, Silaghi C. Molecular examinations of Babesia microti in rodents and rodent-attached ticks from urban and sylvatic habitats in Germany. Ticks Tick Borne Dis. 2015;6:445–449. doi: 10.1016/j.ttbdis.2015.03.005. [DOI] [PubMed] [Google Scholar]
  • 35.Silaghi C, Pfeffer M, Kiefer D, Kiefer M, Obiegala A. Bartonella, rodents, fleas and ticks: a molecular field study on host-vector-pathogen associations in Saxony, eastern Germany. Microb Ecol. 2016;72:965–974. doi: 10.1007/s00248-016-0787-8. [DOI] [PubMed] [Google Scholar]
  • 36.Silaghi C, Woll D, Mahling M, Pfister K, Pfeffer M. Candidatus Neoehrlichia mikurensis in rodents in an area with sympatric existence of the hard ticks Ixodes ricinus and Dermacentor reticulatus, Germany. Parasit Vectors. 2012;5:285. doi: 10.1186/1756-3305-5-285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Krasnov BR, Stanko M, Morand S. Host community structure and infestation by ixodid ticks: repeatability, dilution effect and ecological specialization. Oecologia. 2007;154:185–194. doi: 10.1007/s00442-007-0824-x. [DOI] [PubMed] [Google Scholar]
  • 38.Jahfari S, Fonville M, Hengeveld P, Reusken C, Scholte EJ, Takken W, et al. Prevalence of Neoehrlichia mikurensis in ticks and rodents from North-west Europe. Parasit Vectors. 2012;5:74. doi: 10.1186/1756-3305-5-74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Vichova B, Majlathova V, Novakova M, Stanko M, Hviscova I, Pangracova L, et al. Anaplasma infections in ticks and reservoir host from Slovakia. Infect Genet Evol. 2014;22:265–272. doi: 10.1016/j.meegid.2013.06.003. [DOI] [PubMed] [Google Scholar]
  • 40.Bernshtein AD, Apekina NS, Mikhailova TV, Myasnikov YA, Khlyap LA, Korotkov YS, et al. Dynamics of Puumala hantavirus infection in naturally infected bank voles (Clethrinomys glareolus) Arch Virol. 1999;144:2415–2428. doi: 10.1007/s007050050654. [DOI] [PubMed] [Google Scholar]
  • 41.Derdáková M, Václav R, Pangrácova-Blaňárová L, Selyemová D, Koči J, Walder G, et al. Candidatus Neoehrlichia mikurensis and its co-circulation with Anaplasma phagocytophilum in Ixodes ricinus ticks across ecologically different habitats of central Europe. Parasit Vectors. 2014;7:160. doi: 10.1186/1756-3305-7-160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Coipan EC, Jahfari S, Fonville M, Maassen C, van der Giessen J, Takken W, et al. Spatiotemporal dynamics of emerging pathogens in questing Ixodes ricinus. Front Cell Infect Microbiol. 2013;3:36. doi: 10.3389/fcimb.2013.00036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Michelet L, Delannoy S, Devillers E, Umhang G, Aspan A, Juremalm M, et al. High-throughput screening of tick-borne pathogens in Europe. Front Cell Infect Microbiol. 2014;4:103. doi: 10.3389/fcimb.2014.00103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Khanakah G, Kocianová E, Vyrosteková V, Řeháček J, Kundi M, Stanek G. Seasonal variations in detecting Borrelia burgdorferi sensu lato in rodents from north eastern Austria. Wien Klin Wochenschr. 2006;118:754–758. doi: 10.1007/s00508-006-0730-y. [DOI] [PubMed] [Google Scholar]
  • 45.Tracy KE, Baumgarth N. Borrelia burgdorferi manipulates innate and adaptive immunity to establish persistence in rodent reservoir hosts. Front Immunol. 2017;8:116. doi: 10.3389/fimmu.2017.00116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Kurtenbach K, De Michelis S, Etti S, Schäfer SM, Sewell HS, Brade V, et al. Host association of Borrelia burgdorferi sensu lato-the key role of host complement. Trends Microbiol. 2002;10:74–79. doi: 10.1016/S0966-842X(01)02298-3. [DOI] [PubMed] [Google Scholar]
  • 47.Geller J, Nazarova L, Katargina O, Golovljova I. Borrelia burgdorferi sensu lato prevalence in tick populations in Estonia. Parasit Vectors. 2013;6:202. doi: 10.1186/1756-3305-6-202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Pangrácová L, Derdáková M, Pekárik L, Hviščová I, Víchová B, Stanko M, et al. Ixodes ricinus abundance and its infection with the tick-borne pathogens in urban and suburban areas of eastern Slovakia. Parasit Vectors. 2013;6:238. doi: 10.1186/1756-3305-6-238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Fischer S, Spierling NG, Heuser E, Kling C, Schmidt S, Rosenfeld UM, et al. High prevalence of Rickettsia helvetica in wild small mammal populations in Germany. Ticks Tick Borne Dis. 2018;9:500–505. doi: 10.1016/j.ttbdis.2018.01.009. [DOI] [PubMed] [Google Scholar]
  • 50.Mardosait-Busaitien D, Radzijevskaja J, Balčiauskas L, Paulauskas A. First detection of Rickettsia helvetica in small mammals in Lithuania. New Microbes New Infect. 2018;22:19–23. doi: 10.1016/j.nmni.2017.12.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Schex S, Dobler G, Riehm J, Müller J, Essbauer S. Rickettsia spp. in wild small mammals in Lower Bavaria, South-Eastern Germany. Vector Borne Zoonotic Dis. 2011;11:493–502. doi: 10.1089/vbz.2010.0060. [DOI] [PubMed] [Google Scholar]
  • 52.Samoylenko I, Shpynov S, Raoult D, Rudakov N, Fournier PE. Evaluation of Dermacentor species naturally infected with Rickettsia raoultii. Clin Microbiol Infect. 2009;15:305–306. doi: 10.1111/j.1469-0691.2008.02249.x. [DOI] [PubMed] [Google Scholar]
  • 53.Halos L, Vourc’h G, Cotte V, Gasqui P, Barnouin J, Boulous HJ, et al. Prevalence of Anaplasma phagocytophilum, Rickettsia sp. and Borrelia burgdorferi sensu lato DNA in questing Ixodes ricinus ticks from France. Ann N Y Acad Sci. 2006;1078:316–319. doi: 10.1196/annals.1374.059. [DOI] [PubMed] [Google Scholar]
  • 54.Rudolf I, Venclíková K, Blažejová H, Betášová L, Mendel J, Hubálek Z, et al. First report of Rickettsia raoultii and Rickettsia helvetica in Dermacentor reticulatus ticks from the Czech Republic. Ticks Tick Borne Dis. 2016;7:1222–1224. doi: 10.1016/j.ttbdis.2016.07.011. [DOI] [PubMed] [Google Scholar]
  • 55.Stańczak J, Biernat B, Racewicz M, Zalewska M, Matyjasek A. Prevalence of different Rickettsia spp. in Ixodes ricinus and Dermacentor reticulatus ticks (Acari: Ixodidae) in north-eastern Poland. Ticks Tick Borne Dis. 2018;9:427–434. doi: 10.1016/j.ttbdis.2017.12.010. [DOI] [PubMed] [Google Scholar]
  • 56.Engbaek K, Lawson PA. Identification of Bartonella species in rodents, shrews and cats in Denmark: detection of two B. henselae variants, one in cats and the other in the long-tailed field mouse. APMIS. 2004;2004(112):336–341. doi: 10.1111/j.1600-0463.2004.apm1120603.x. [DOI] [PubMed] [Google Scholar]
  • 57.Paziewska A, Harris PD, Zwolińska L, Bajer A, Siński E. Differences in the ecology of Bartonella infections of Apodemus flavicollis and Myodes glareolus in a boreal forest. Parasitology. 2012;139:881–893. doi: 10.1017/S0031182012000170. [DOI] [PubMed] [Google Scholar]
  • 58.Buffet JP, Marsot M, Vaumourin E, Gasqui P, Masséglia S, Marcheteau E, et al. Co-infection of Borrelia afzelii and Bartonella spp. in bank voles from a suburban forest. Comp Immunol Microbiol Infect Dis. 2012;35:583–589. doi: 10.1016/j.cimid.2012.07.002. [DOI] [PubMed] [Google Scholar]
  • 59.Gutiérrez R, Krasnov B, Morick D, Gottlieb Y, Khokhlova IS, Harrus S. Bartonella infection in rodents and their flea ectoparasites: an overview. Vector Borne Zoonotic Dis. 2015;15:27–39. doi: 10.1089/vbz.2014.1606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Welc-Faleciak R, Paziewska A, Bajer A, Behnke JM, Siński E. Bartonella spp. infection in rodents from different habitats in the Mazury Lake District, northeast Poland. Vector-Borne Zoonotic Dis. 2008;8:467–474. doi: 10.1089/vbz.2007.0217. [DOI] [PubMed] [Google Scholar]
  • 61.Bajer A, Welc-Falęciak R, Bednarska M, Alsarraf M, Behnke-Borowczyk J, Siński E, et al. Long-term spatiotemporal stability and dynamic changes in the haemoparasite community of bank voles (Myodes glareolus) in NE Poland. Microb Ecol. 2014;68:196–211. doi: 10.1007/s00248-014-0390-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Ebani VV, Bertelloni F, Turchi B, Filogari D, Cerri D. Molecular survey of tick-borne pathogens in ixodid ticks collected from hunted wild animals in Tuscany, Italy. Asian Pac J Trop Med. 2015;8:714–717. doi: 10.1016/j.apjtm.2015.07.033. [DOI] [PubMed] [Google Scholar]
  • 63.Criado-Fornelio A, Ruas JL, Casado N, Farias NAR, Soares MP, Müller G, et al. New molecular data on mammalian Hepatozoon species (Apicomplexa: Adeleorina) from Brazil and Spain. J Parasitol. 2006;92:93–99. doi: 10.1645/GE-464R.1. [DOI] [PubMed] [Google Scholar]
  • 64.Hamšíková Z, Silaghi C, Rudolf I, Venclíková K, Mahríková L, Slovák M, et al. Molecular detection and phylogenetic analysis of Hepatozoon spp. in questing Ixodes ricinus ticks and rodents from Slovakia and Czech Republic. Parasitol Res. 2016;115:3897–3904. doi: 10.1007/s00436-016-5156-5. [DOI] [PubMed] [Google Scholar]
  • 65.Laakkonen J, Sukura A, Oksanen A, Henttonen H, Soveri T. Haemogregarines of the genus Hepatozoon (Apicomplexa: Adeleina) in rodents from northern Europe. Folia Parasitol. 2001;48:263–267. doi: 10.14411/fp.2001.043. [DOI] [PubMed] [Google Scholar]
  • 66.Maia JP, Álvares F, Boratyński Z, Brito JC, Leite JV, Harris DJ. Molecular assessment of Hepatozoon (Apicomplexa: Adeleorina) infections in wild canids and rodents from North Africa, with implications for transmission dynamics across taxonomic groups. J Wildl Dis. 2014;50:837–848. doi: 10.7589/2013-10-280. [DOI] [PubMed] [Google Scholar]
  • 67.Rigó K, Majoros G, Szekeres S, Molnár I, Jablonszky M, Majláthová V. Identification of Hepatozoon erhardovae Krampitz, 1964 from bank voles (Myodes glareolus) and fleas in southern Hungary. Parasitol Res. 2016;115:2409–2413. doi: 10.1007/s00436-016-4992-7. [DOI] [PubMed] [Google Scholar]
  • 68.Bown KJ, Lambin X, Telford GR, Ogden NH, Telfer S, Woldehiwet Z, et al. Relative importance of Ixodes ricinus and Ixodes trianguliceps as vectors for Anaplasma phagocytophilum and Babesia microti in field vole (Microtus agrestis) populations. Appl Environ Microbiol. 2008;74:7118–7125. doi: 10.1128/AEM.00625-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Karlsson ME, Andersson MO. Babesia species in questing Ixodes ricinus, Sweden. Ticks Tick Borne Dis. 2016;7:10–12. doi: 10.1016/j.ttbdis.2015.07.016. [DOI] [PubMed] [Google Scholar]
  • 70.Wójcik-Fatla A, Zając V, Sawczyn A, Cisak E, Dutkiewicz J. Babesia spp. in questing ticks from eastern Poland: prevalence and species diversity. Parasitol Res. 2015;114:3111–3116. doi: 10.1007/s00436-015-4529-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Abdullah S, Helps C, Tasker S, Newbury H, Wall R. Prevalence and distribution of Borrelia and Babesia species in ticks feeding on dogs in the UK. Med Vet Entomol. 2018;32:14–22. doi: 10.1111/mve.12257. [DOI] [PubMed] [Google Scholar]
  • 72.Gray J, Zintl A, Hildebrandt A, Hunfeld KP, Weiss L. Zoonotic babesiosis: overview of the disease and novel aspects of pathogen identity. Ticks Tick Borne Dis. 2010;1:3–10. doi: 10.1016/j.ttbdis.2009.11.003. [DOI] [PubMed] [Google Scholar]
  • 73.Bos JH, Klip FC, Sprong H, Broens EM, Kik MJL. Clinical outbreak of babesiosis caused by Babesia capreoli in captive reindeer (Rangifer tarandus tarandus) in the Netherlands. Ticks Tick Borne Dis. 2017;8:799–801. doi: 10.1016/j.ttbdis.2017.06.006. [DOI] [PubMed] [Google Scholar]
  • 74.Hartelt K, Oehme R, Frank H, Brockmann SO, Hassler D. Pathogens and symbionts in ticks: prevalence of Anaplasma phagocytophilum (Ehrlichia sp.), Wolbachia sp., Rickettsia sp., and Babesia sp. in southern Germany. Int J Med Microbiol. 2004;293(Suppl. 1):86–92. doi: 10.1016/s1433-1128(04)80013-5. [DOI] [PubMed] [Google Scholar]
  • 75.Hildebrandt A, Krämer A, Sachse S, Straube E. Detection of Rickettsia spp. and Anaplasma phagocytophilum in Ixodes ricinus ticks in a region of Middle Germany (Thuringia) Ticks Tick Borne Dis. 2010;1:52–56. doi: 10.1016/j.ttbdis.2009.11.005. [DOI] [PubMed] [Google Scholar]
  • 76.Schorn S, Pfister K, Reulen H, Mahling M, Manitz J, Thiel C, et al. Prevalence of Anaplasma phagocytophilum in Ixodes ricinus in Bavarian public parks, Germany. Ticks Tick Borne Dis. 2011;2:196–203. doi: 10.1016/j.ttbdis.2011.09.009. [DOI] [PubMed] [Google Scholar]
  • 77.Levin ML, Fish D. Immunity reduces reservoir host competence of Peromyscus leucopus for Ehrlichia phagocytophila. Infect Immun. 2000;68:1514–1518. doi: 10.1128/IAI.68.3.1514-1518.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Schmidt S, Essbauer SS, Mayer-Scholl A, Poppert S, Schmidt-Chanasit J, Klempa B, et al. Multiple infections of rodents with zoonotic pathogens in Austria. Vector Borne Zoonotic Dis. 2014;14:467–475. doi: 10.1089/vbz.2013.1504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Stresemann E. Stresemann - Exkursionsfauna von Deutschland. Band 3: Wirbeltiere. Germany: Springer Spektrum; 1995. [Google Scholar]
  • 80.Siuda K. Ticks of Poland (Acari: Ixodida). Part 2: Systematics and distribution. Warsaw: PTP; 1993. [Google Scholar]
  • 81.Courtney JW, Kostelnik LM, Zeidner NS, Massung RF. Multiplex real-time PCR for detection of Anaplasma phagocytophilum and Borrelia burgdorferi. J Clin Microbiol. 2004;42:3164–3168. doi: 10.1128/JCM.42.7.3164-3168.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Casati S, Sager H, Gern L, Piffaretti J-C. Presence of potentially pathogenic Babesia sp. for human in Ixodes ricinus in Switzerland. Ann Agric Environ Med. 2006;13:65–70. [PubMed] [Google Scholar]
  • 83.Maggi RG, Diniz PP, Cadenas MB, Breitschwerdt EB. The use of molecular diagnostic techniques to detect Anaplasma, Bartonella and Ehrlichia species in arthropods or patients. In: The International Canine Vector-Borne Disease Symposium, 18–20 April 2006, Billesley, UK. p. 9–14.
  • 84.Schwaiger M, Péter O, Cassinotti P. Routine diagnosis of Borrelia burgdorferi (sensu lato) infections using a real-time PCR assay. Clin Microbiol Infect. 2001;7:461–469. doi: 10.1046/j.1198-743x.2001.00282.x. [DOI] [PubMed] [Google Scholar]
  • 85.Wang G, Liveris D, Mukherjee P, Jungnick S, Margos G, Schwartz I. Molecular typing of Borrelia burgdorferi. Curr Protoc Microbiol. 2014;34:1–31. doi: 10.1002/9780471729259.mc12c05s34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Inokuma H, Parola P, Raoult D, Brouqui P. Molecular survey of Ehrlichia infection in ticks from animals in Yamaguchi Prefecture, Japan. Vet Parasitol. 2001;99:335–339. doi: 10.1016/S0304-4017(01)00470-8. [DOI] [PubMed] [Google Scholar]
  • 87.Wölfel R, Essbauer S, Dobler G. Diagnostics of tick-borne rickettsioses in Germany: a modern concept for a neglected disease. Int J Med Microbiol. 2008;298:368–374. doi: 10.1016/j.ijmm.2007.11.009. [DOI] [Google Scholar]
  • 88.Roux V, Raoult D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer membrane protein rOmpB (ompB) Int J Syst Evol Microbiol. 2000;50:1449–1455. doi: 10.1099/00207713-50-4-1449. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data supporting the conclusions of this article are included within the article. The raw data used and/or analyzed during the present study are available from the corresponding author upon reasonable request.


Articles from Parasites & Vectors are provided here courtesy of BMC

RESOURCES