Skip to main content
Turkish Journal of Biology logoLink to Turkish Journal of Biology
. 2018 Oct 25;42(5):447–452. doi: 10.3906/biy-1801-51

Oxidative Stress Upregulates the Transcription of Genes Involved in Thiamine Metabolism

Burcu KARTAL 1,3, Ahmet AKÇAY 3, Bedia PALABIYIK 2
PMCID: PMC6438119  PMID: 30930628

Abstract

Thiamine is a major vitamin that acts as a cofactor in energy metabolism in all organisms, as well as in lipid and amino acid metabolisms, and is associated with many diseases. It is known that glucose starvation decreases the intracellular thiamine pool while increasing oxidative stress tolerance. Earlier, in whole genome analysis, we detected major differences in the expression of genes related to thiamine pathway against oxidative stress in Schizosaccharomyces pombe. We investigated the effects of oxidative stress and glucose repression to thiamine pathway in S. pombe by comparing some genes encoding key enzymes of each related pathway at the transcription level. In the present study, we found that the expression of genes related to thiamine biosynthesis and transport (thi2, thi3, and pho1) increased in wild type and ird11 cells grown in thiamine-rich media under oxidative stress induced by H2O2. Based on our findings, we suggested that there might be an important effect of oxidative stress on thiamine biosynthesis and transport.

Keywords: Fission yeast, thiamine, oxidative stress, glucose metabolism

1. Introduction

Thiamine diphosphate, the biological active form of thiamine (vitamin B1), is a cofactor for many enzymes (pyruvate dehydrogenase, α-ketoglutarate dehydrogenase, α-ketoacid dehydrogenase, transketolase, and pyruvate decarboxylase) in universal metabolic pathways such as glycolysis, pentose phosphate pathway, and tricarboxylic acid cycle (TCA) (Friedrich, 1987) .

Yeast synthesizes 5-(2-hydroxyethyl)-4-methylthiazole phosphate (HET-P) and 4-amino-5-hydroxymethyl2-methylpyrimidine diphosphate (HMP-PP) precursors separately in thiamine biosynthesis, and the subsequent HET-P and HMP-PP unite to form ThMP with thiamine phosphate synthase (Kowalska and Kozik, 2008) . In eukaryotes, ThMP is first converted to free thiamine, and then the free thiamine is converted to ThDP (Murata, 1982) . Dephosphorylation is essential for extracellular thiamine phosphates to be transported through the cell membrane (Kowalska and Kozik, 2008) .

Various defense mechanisms (oxidative stress response) have been developed for eliminating oxidative stress that arises from the increase of reactive oxygen species that are stable within the cell. Sty1p, the stress-activated MAPK, is a major regulator in stress response (Shiozaki and Russell, 1996; Shieh et al., 1997) and triggers the global stress response via stimulating Atf1p and Pap1p transcription factors. Activated transcription factors stimulate the expression of genes that encode oxidative stress response proteins such as glutathione peroxidase (Gpx1), neutral trehalose (Ntp1), cytoplasmic catalase (Ctt1), thioredoxin reductase (Trr1), and superoxide dismutase (Sod1) (Toone et al., 1998; Mutoh et al., 2002) .

Using microarray technology earlier, we found global changes in the gene expressions in response to oxidative stress induced by H2O2 in wild type and ird11 mutant (resistant to glucose repression and oxidative stress) cells grown in optimal conditions (Kig et al., 2005; Palabiyik et al., 2012) . Because of the involvement of some of these genes in thiamine metabolism (Palabiyik et al., 2014) , we aimed to investigate the relationship between oxidative stress, glucose metabolism, and thiamine metabolism. Expression levels of thiamine metabolism, glucose metabolism, and stress response pathways genes were measured with quantitative real-time PCR (qRT-PCR) at a level of transcription, in both normal and hydrogen peroxide-induced oxidative stress conditions with/without thiamine.

2. Materials and methods

2.1. Growth conditions and S. pombe strains

S. pombe Lindner liquefaciens (wild type, 972h-) strain and ird11 mutant (Kig et al., 2005) were cultivated till midlogarithmic phase in minimal media (MML) with/without thiamine (Gutz et al., 1974). 2 mM H O was applied as an 2 2 oxidative stress agent for 1 h at 30 °C (Bayram et al., 2008) .

2.2. Total RNA isolation

Total RNA from control and experimental groups were acquired using a commercial kit (High Pure RNA Isolation Kit, Roche) according to the manufacturer’s recommendations. Spectrophotometrical measurements of RNA samples at 260 nm were calculated via µg/mL = A260 ´ dilution factor ´ 40 formulae (Sambrook, 1989) . RNA samples were separated into amounts of 20 μL and stored at –70 °C.

2.3. cDNA synthesis

cDNA synthesis from RNA molecules was done with a commercial kit (Transcriptor High Fidelity cDNA Synthesis Kit, Roche) according to the manufacturer’s instructions; cDNA samples were stored at –20 °C.

2.4. Real-time PCR

Variation in expression profiles of the genes of interest under different conditions was determined with quantitative RT-PCR that is based on “SYBR green”. Fast Start SYBR Green Master Kit (Roche) and “Roche, 480” were used according to the manufacturer’s instructions. Gene-specific primers were designed at Primer 3 program and are listed in Table. S. pombe actin gene (act1) was used as a reference gene for normalization of the results (Xue-Franzen et al., 2006) .

Table.

Primers used throughout the study. (¹: Forward sequence; ²: Reverse sequence).

Group SEQ_ID Name Primer sequence (5’-3’)
Reference gene SPBC32H8.12c Actin / act1 AGATTCTCATGGAGCGTGGT¹ TCAAAGTCCAAAGCGACGTA²
Thiamine metabolism SPAC17A2.01 High-affinity import carrier for pyridoxine, pyridoxal, and pyridoxamine / bsu1 GCCCGTTTACTTTTGTTCCA¹ GCAACACCGATGATGAAATG²
SPAC23H4.10c Bifunctional thiamine-phosphate dipyrophosphorylase/hydroxyethylthiazole kinase / thi4 GTGATGGGTGTAACGGCTTC¹ GAGTTTTTCGCTTCCACTGC²
SPBC26H8.01 Thiazole biosynthetic enzyme / thi2 CCCATTTGGTTGTTTCTGCT¹ CGCATGTCGTGAAGGTTAGA²
SPBP4G3.02 Acid phosphatase / pho1 AGCATTGACTTTCCCACCAC¹ ATTCCAACAGCATCGAAAGC²
SPBP8B7.18c Phosphomethylpyrimidine kinase (predicted) GCAGCCCTGAAATCGTTAAG¹ CGAGAGAATCCCCAGAAGTG²
SPCC18B5.05 Phosphomethylpyrimidine kinase (predicted) GACGGCCGATCTGATTTATG¹ TGGCAGCTGTAAGAGAGCAA²
SPCC1223.02 4-amino-5-hydroxymethyl-2-methylpyrimidine phosphate synthase / nmt1 TCCCCAGAGATTGGAACAAG¹ GGTCAAGTTCCCAGGTCAAG²
Glucose metabolism SPBC1198.14c Fructose-1,6-bisphosphatase / fbp1 GTATGGTGCTTCGGCTCATT¹ TTCATGTTTCGATGGGTCAA²
SPAC4F8.07c Hexokinase 2 / hxk2 CAACAAGGACTTTGCCCAAT¹ AAGGTGTCGCTCTCCTTTGA²
Stress response SPAC24B11.06c MAP kinase / sty1 TGTTCATTCTGCCGGTGTTA¹ GAATACGAGCCAAACCGAAA²
SPAC821.10c Superoxide dismutase / sod1 ATTGGCCGTACCATTGTCAT¹ GACACCACAAGCGTTACGTG²
SPCC757.07c Catalase / ctt1 ATCCTCAATCCGACCACTTG¹ AACGTCGGTAATTTCGTCCA²

PCR was carried out under the following conditions: 95 °C for 10 min (preincubation), followed by 45 cycles of 95 °C for 10 s, 53 °C for 7 s, and 72 °C for 5 s. 2.5. Statistical analysis The variation in gene expression level (R) was calculated according to Pfaffl equation (Pfaffl 2001 ), which is based on the proportion of crossing threshold (Ct) measured for target and reference genes depending on the yield at each reaction (E). Statistical analysis of experiment results was done with “Graphpad Ver.5” software.

R = (Etarget gene) ΔCttarget gene(control-test) / (Ereference gene) ΔCtreference gene(control-test)

3. Results

3.1. The effect of thiamine on the expression of genes related to thiamine metabolism

Expression profiles of genes that are included in thiamine intake and biosynthesis pathway were examined in S. pombe 972h- wild type and ird11 mutant strains grown in thiamine-rich media (Figure 1). The expression of thi2 and thi3 genes was downregulated (87.29´, 78.06´, respectively) in the wild type, as expected (Figure 1A), while in ird11 strain the expression of thi3 did not change, but thi2 and pho1 genes were upregulated (1.69´, 2.55´, respectively) (Figure 1B).

Figure 1.

Figure 1

Relative expression profiles of genes related to thiamine metabolism. The expression of genes related to thiamine pathway in S. pombe cells growing in thiamine-rich media calculated relative to thiamine-free media. A. S. pombe wild type; B. S. pombe ird11 mutant strain. Statistical analysis of experiment results was done with “Graphpad Ver.5” software. Error bars represent standard deviation of three experimental replicates. (Dunnet’s test, P < 0.05*, P < 0.01**, P < 0.001***).

3.2. Thiamine-mediated glucose metabolism and stress response pathway

The expression profiles of genes involved in glucose metabolism and stress response pathways were examined in S. pombe 972h- wild type and ird11 mutant strains grown in thiamine-rich media, using qRT-PCR (Figure 2). It was determined that the pfb1 gene encoding phosphofructokinase 1 enzyme, which is a gluconeogenetic enzyme, was downregulated, although not statistically significantly in both of the strains at the presence of thiamine. No significant variation was observed in the expression of the hxk2 gene encoding hexokinase 2 enzyme, which starts glycolytic flow. It is suggested that there is an optimal glycolytic flow in both of the strains in all growth media. The transcription of stress response genes (sty1, sod1, and ctt1) did not change in both strains in the absence and presence of thiamine (Figures 2A and 2B). Only the expression of the sod1 gene, which encodes the superoxide dismutase 1 enzyme in ird11, was increased (2.48´) in thiamine-rich media relative to thiamine-free media (Figure 2B).

Figure 2.

Figure 2

Relative expression profiles of genes related to glucose metabolism and oxidative stress response pathways. Expression of genes of interest in S. pombe cells growing in thiamine-rich media was calculated relative to thiamine-free media. A. S. pombe wild type; B. S. pombe ird11 mutant strain. Statistical analysis of experiment results was done with “Graphpad Ver.5” software. Error bars represent standard deviation of at least two experimental replicates. (Dunnet’s test, P < 0.05*). GM: glucose metabolism; OSR: oxidative stress response.

3.3. Activation of thiamine metabolism related genes under oxidative stress

Expression levels of genes encoding main enzymes involved in oxidative stress response pathways, thiamine metabolism, and glucose metabolism were determined at the level of transcription after exposing S. pombe wild type and ird11 cells to oxidative stress (2 mM H2O2, 1 h) in thiamine-rich media (Figure 3). No significance was observed in the expression of genes related to glucose metabolism and oxidative stress response pathway in both strains. In wild type, a significant increase was observed only in the expression of the pho1 gene encoding acid phosphatase, which allows thiamine to be introduced into the cell (Figure 3A). On the other hand, the expression of the thi2 and thi3 genes, which encode thiazole biosynthetic enzyme (participates in the synthesis of the thiazole ring) and 4-amino-5-hydroxymethyl-2-methylpyrimidine phosphate synthase enzyme (participates in the synthesis of the pyrimidine ring), respectively, and also the expression of pho1 gene were upregulated in ird11 as if thiamine was absent in the media (Figure 3B).

Figure 3.

Figure 3

Relative expression profiles of genes related to thiamine metabolism, glucose metabolism, and oxidative stress response pathways under oxidative stress. After S. pombe cells grown until midlogarithmic phase were exposed to 2 mM hydrogen peroxide, inducing oxidative stress in presence of thiamine, expression profiles of the genes were calculated relative to stressfree condition. A. S. pombe wild type; B. S. pombe ird11 mutant strain. Statistical analysis of experiment results was done with “Graphpad Ver.5” software. Error bars represent standard deviation of at least three experimental replicates. (Dunnet’s test, P < 0.05*, P < 0.001***). GM: glucose metabolism; OSR: oxidative stress response; ThM: thiamine metabolism.

4. Discussion

There are many critical diseases occurring due to thiamine deficiency with little progress in diagnosis and treatment. Thiamine deficiency increases oxidative stress in neurodegenerative diseases such as Alzheimer, Parkinson, Huntington, and Wernicke-Korsakof syndrome; furthermore, thiamine-dependent enzymes are more sensitive to oxidative stress (Gibson et al., 1999; Lin and Beal, 2006; Hazell et al., 2010; Jhala and Hazell, 2011) . It is also known that thiamine has an important role in signal transduction, immune system activation, and signaling in animal cells (Manzetti et al., 2014) . It is believed that determining the expression profiles of genes responsible for thiamine biosynthesis and transport might lead to research into the diagnosis and treatment of the diseases. In this study, we investigated the relationship between thiamine metabolism, oxidative stress response, and glucose metabolism in both S. pombe wild type and the ird11 mutant (Kig et al., 2005; Palabiyik et al., 2012) .

The expression of genes related to biosynthesis and transport of thiamine is completely suppressed by thiamine in the media, whereas in the absence of thiamine it is known that their expression increases at a high level (Maundrell, 1990; Praekelt et al., 1994; Nosaka, 2006) .

Besides, it has been reported that in S. pombe, thiamine represses the mRNA synthesis of many genes that are involved in their own metabolism, such as thi2, thi3, thi4, pho4, and car1 (Schweingruber et al., 1991) . It has been shown that with microarray analysis, in the absence of thiamine in S. cerevisiae, the expression of THI5, THI12 (ortholog of S. pombe thi3 gene), and THI4 (ortholog of S. pombe thi2 gene) genes were significantly increased (No saka et al., 2005). It was confirmed in the present study by the remarkable decrease (approximately 80-fold) in the expression of thi3 and thi2 genes in S. pombe wild type cells growing in the presence of thiamine, compared to the expression of other genes associated with thiamine biosynthesis and transport (Figure 1A).

In the presence of thiamine, the fact that the pfb1 gene in both strains was downregulated suggested continuing glucose repression (Figures 2A and 2B). Likewise, the fact that no significant decrease was observed in stress response genes expression (sty1, sod1, and ctt1) in the wild type under thiamine-rich conditions (Figure 2A) suggests that the stress response is not effect ed by environmental thiamine. However, differences in the expression profiles of genes related to thiamine and oxidative stress response pathways between ird11 and wild type cells might result from a lack of glucose repression in ird11 (Figures 1B and 2B).

Palabiyik et al. (2014) have shown the relationship between oxidative stress and thiamine metabolism in microarray analyses, indicating that the expression of the thi3 gene is 33.5-fold less than wild type in ird11, but 31-fold higher in ird11 exposed to H2O2. We determined an in creased expression of genes involved in thiamine biosynthesis and transport (thi2, thi3, and pho1) when ird11 and wild type cells were exposed to H2O2 (Figure 3). Therefore, it is suggested that S. pombe cells need thiamine in defense mechanisms developed against oxidative stress. Recently, it has been reported that osmotic and oxidative stresses elevate the transcription of thiamine biosynthesis genes in oil palm (Elaeis guineensis) (Yee et al., 2016; Idris et al., 2018) .

Consequently, the fact that expression of genes related to thiamine biosynthesis and transport (thi2, thi3, and pho1) increased when wild type cells were exposed to H2O2 (Figure 3A), while the expression of these genes decreased under thiamine-rich conditions (Figure 1A) in this study, suggests that oxidative stress upregulates thiamine metabolism to protect the cellular balance in fission yeast. This conclusion is supported by the findings obtained from ird11, which is resistant to glucose repression and oxidative stress (Figures 1B and 3B). Also, it has been reported that thiamine is involved in the stabilization of the redox levels of cells throughout the production of NAPDH and glutathione during oxidative stress response and protects the tissues against oxidative damage via reduced NADP+ (Depeint et al., 2006; Gioda et al., 2010) . Besides, it has been put forward that in S. cerevisiae cells, free radical levels and protein oxidation have decreased under different stress conditions in the presence of thiamine (Wolak et al., 2014) . Based on our findings, we hypothesize that thiamine pathway is affected by oxidative stress.

Acknowledgments

This research was funded by the Scientific Research Project Coordination Unit of İstanbul University, project ID: 28781, and by The Scientific and Technological Research Council of Turkey, project number: 1919B011403361.

References

  1. Bayram T , Pekmez M , Arda N , Yalçın AS ( 2008. ). Antioxidant activity of whey protein fractions isolated by gel exclusion chromatography and protease treatment . Talanta 75 : 705 - 709 . doi: 10 .1016/j.talanta. 2007. . 12 .007. [DOI] [PubMed] [Google Scholar]
  2. Depeint F , Bruce WR , Shangari N , Mehta R , O'Brien PJ ( 2006. ). Mitochondrial function and toxicity: role of the B vitamin family on mitochondrial energy metabolism . Chem-Biol Interact 163 : 94 - 112 . doi: 10 .1016/j.cbi. 2006. . 04 .014. [DOI] [PubMed] [Google Scholar]
  3. Friedrich W ( 1987. ). Hanbuch der Vitamine . Munich, Germany: Urban & Schwarzenberg (in German) .
  4. Gibson GE , Park LC , Zhang H , Sorbi S , Calingasan NY ( 1999. ). Oxidative stress and a key metabolic enzyme in Alzheimer brains, cultured cells, and an animal model of chronic oxidative deficits . Ann NY Acad Sci 893 : 79 - 94 . [DOI] [PubMed] [Google Scholar]
  5. Gioda CR , de Oliveira Barreto T , Primola-Gomes TN , de Lima DC , Campos PP , Capettini Ldos S , Lauton-Santos S , Vasconcelos AC , Coimbra CC , Lemos VS et al. ( 2010. ). Cardiac oxidative stress is involved in heart failure induced by thiamine deprivation in rats . Am J Physiol-Heart C 298 : 2039 - 2045 . doi: 10 .1152/ajpheart.00820. 2009. . [DOI] [PubMed] [Google Scholar]
  6. Gutz H , Heslot H , Leupold U , Loprieno N , ( 1974. ). Schizosaccharomyces pombe . In: King RC , editor. Handbook of Genetics . New York, NY, USA: Plenum Press, pp. 395 - 446 .
  7. Hazell AS , Sheedy D , Oanea R , Aghourian M , Sun S , Jung JY , Wang D , Wang C ( 2010. ). Loss of astrocytic glutamate transporters in Wernicke encephalopathy . Glia 58 : 148 - 156 . doi: 10 .1002/ glia.20908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Idris ZHC , Abidin AAZ , Subki A , Yusof ZNB ( 2018. ). The effect of oxidative stress towards the expression of thiamine biosynthesis genes (THIC and THI1/THI4) in oil palm (Elaeis guineensis) . Tropical Life Sciences Research 29 : 71 - 85 . doi:10.21315/ tlsr2018.29.1 .5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Jhala SS , Hazell AS ( 2011. ). Modeling neurodegenerative disease pathophysiology in thiamine deficiency: consequences of impaired oxidative metabolism . Neurochem Int 58 : 248 - 260 . doi: 10 .1016/j.neuint. 2010. . 11 .019. [DOI] [PubMed] [Google Scholar]
  10. Kig C , Turkel S , Temizkan G ( 2005. ). Isolation and characterization of glucose derepressed invertase mutants from Schizosaccharomyces pombe . Bioscience, Biotechnology, and Biochemistry 69 : 2475 - 2478 . doi: 10 .1271/bbb.69.2475. [DOI] [PubMed] [Google Scholar]
  11. Kowalska E , Kozik A ( 2008. ). The genes and enzymes involved in the biosynthesis of thiamin and thiamin diphosphate in yeasts . Cell Mol Biol Lett 13 : 271 - 282 . doi: 10 .2478/s11658-007-0055-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Lin MT , Beal MF ( 2006. ). Mitochondrial dysfunction and oxidative stress in neurodegenerative diseases . Nature 443 : 787 - 795 . doi: 10 .1038/nature05292. [DOI] [PubMed] [Google Scholar]
  13. Manzetti S , Zhang J , van der Spoel D ( 2014. ). Thiamin function, metabolism, uptake, and transport . Biochemistry-US 53 : 821 - 835 . doi: 10 .1021/bi401618y. [DOI] [PubMed] [Google Scholar]
  14. Maundrell K ( 1990. ). nmt1 of fission yeast. A highly transcribed gene completely repressed by thiamine . J Biol Chem 265 : 10857 - 10864 . [PubMed] [Google Scholar]
  15. Murata K ( 1982. ). Actions of two types of thiaminase on thiamin and its analogues . Ann NY Acad Sci 378 : 146 - 156 . [DOI] [PubMed] [Google Scholar]
  16. Mutoh N , Nakagawa CW , Yamada K ( 2002. ). Characterization of Cu, Zn-superoxide dismutase-deficient mutant of fission yeast Schizosaccharomyces pombe . Curr Genet 41 : 82 - 88 . doi: 10 .1007/s00294-002-0288-9. [DOI] [PubMed] [Google Scholar]
  17. Nosaka K ( 2006. ). Recent progress in understanding thiamin biosynthesis and its genetic regulation in Saccharomyces cerevisiae . Appl Microbiol Biot 72 : 30 - 40 . doi: 10 .1007/s00253- 006-0464-9. [DOI] [PubMed] [Google Scholar]
  18. Nosaka K , Onozuka M , Konno H , Kawasaki Y , Nishimura H , Sano M , Akaji K ( 2005. ). Genetic regulation mediated by thiamin pyrophosphate-binding motif in Saccharomyces cerevisiae . Mol Microbiol 58 : 467 - 479 . doi: 10 .1111/j.1365- 2958 . 2005. . 04835 . x. [DOI] [PubMed] [Google Scholar]
  19. Palabiyik B , Ghods FJ , Ucar EO ( 2014. ). A potential protective role for thiamine in glucose-driven oxidative stress . Gen Mol Res 13 : 5582 - 5593 . doi: 10 .4238/ 2014. .July. 25 .13. [DOI] [PubMed] [Google Scholar]
  20. Palabiyik B , Kig C , Pekmez M , Dalyan L , Arda N , Temizkan G ( 2012. ). Investigation of the relationship between oxidative stress and glucose signaling in Schizosaccharomyces pombe . Biochem Genet 50 : 336 - 349 . doi: 10 .1007/s10528-011-9477-x. [DOI] [PubMed] [Google Scholar]
  21. Pfaffl MW ( 2001. ). A new mathematical model for relative quantification in real-time RT-PCR . Nucleic Acids Res 29 : e45 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Praekelt UM , Byrne KL , Meacock PA ( 1994. ). Regulation of THI4 (MOL1), a thiamine-biosynthetic gene of Saccharomyces cerevisiae . Yeast 10 : 481 - 490 . doi: 10 .1002/yea.320100407. [DOI] [PubMed] [Google Scholar]
  23. Sambrook J , Fritsch EF , Maniatis T ( 1989. ). Molecular Cloning: A Laboratory Manual . 2nd ed. New York, NY, USA: Cold Spring Harbor Laboratory Press.
  24. Schweingruber AM , Dlugonski J , Edenharter E , Schweingruber ME ( 1991. ). Thiamine in Schizosaccharomyces pombe: dephosphorylation, intracellular pool, biosynthesis and transport . Curr Genet 19 : 249 - 254 . [DOI] [PubMed] [Google Scholar]
  25. Shieh JC , Wilkinson MG , Buck V , Morgan BA , Makino K , Millar JB ( 1997. ). The Mcs4 response regulator coordinately controls the stress-activated Wak1-Wis1-Sty1 MAP kinase pathway and sifsion yeast cell cycle . Gene Dev 11 : 1008 - 1022 . [DOI] [PubMed] [Google Scholar]
  26. Shiozaki K , Russell P ( 1996. ). Conjugation, meiosis, and the osmotic stress response are regulated by Spc1 kinase through Atf1 transcription factor in fission yeast . Gene Dev 10 : 2276 - 2288 . [DOI] [PubMed] [Google Scholar]
  27. Toone WM , Kuge S , Samuels M , Morgan BA , Toda T , Jones N ( 1998. ). Regulation of the fission yeast transcription factor Pap1 by oxidative stress: requirement for the nuclear export factor Crm1 (Exportin) and the stress-activated MAP kinase Sty1/ Spc1 . Gene Dev 12 : 1453 - 1463 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Wolak N , Kowalska E , Kozik A , Rapala-Kozik M ( 2014. ). Thiamine increases the resistance of baker's yeast Saccharomyces cerevisiae against oxidative, osmotic and thermal stress, through mechanisms partly independent of thiamine diphosphate-bound enzymes . FEMS Yeast Res 14 : 1249 - 1262 . doi: 10 .1111/ 1567, - 1364 . 12218 . [DOI] [PubMed] [Google Scholar]
  29. Xue-Franzen Y , Kjaerulf S , Holmberg C , Wright A , Nielsen O ( 2006. ). Genome wide identification of pheromone-targeted transcription in fission yeast . BMC Genomics 7 : 303 . doi: 10 .1186/ 1471 -2164-7-303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Yee WS , Aziz SDA , Yusof ZNB ( 2016. ). Osmotic stress upregulates the transcription of thiamine (vitamin B1) biosynthesis genes (THIC and THI4) in oil palm (Elaies guineensis) . Afr J Biotechnol 15 : 1566 - 1574 . doi: 10 .5897/AJB2016.15222. [Google Scholar]

Articles from Turkish Journal of Biology are provided here courtesy of The Scientific and Technological Research Council of Turkey

RESOURCES