Skip to main content
NCBI home page
International Journal for Parasitology: Parasites and Wildlife logoLink to International Journal for Parasitology: Parasites and Wildlife
. 2019 Mar 23;9:1–6. doi: 10.1016/j.ijppaw.2019.03.014

First report of Enterocytozoon bieneusi and Cryptosporidium spp. in peafowl (Pavo cristatus) in China

Sheng-Yong Feng a,b, Han Chang a,b, Jing Luo a, Jing-Jing Huang a,b, Hong-Xuan He a,∗
PMCID: PMC6438908  PMID: 30976510

Abstract

Enterocytozoon bieneusi and Cryptosporidium spp. are important pathogens causing diarrhea in humans and animals. However, few studies have been conducted on the infection of E. bieneusi and Cryptosporidium spp. in peafowl up to now. The purpose of the present study was to determine the prevalence and the involved genotypes of Cryptosporidium spp. and E. bieneusi in peafowl in Beijing and Jiangxi Province, China. In total, 258 peafowl fecal samples were collected. Overall, both Cryptosporidium spp. and E. bieneusi had the same prevalence, i.e. 6.59% (17/258). Higher infection rates of E. bieneusi and Cryptosporidium spp. were found in the adolescent peafowl. The prevalence of E. bieneusi in Beijing and Jiangxi Province was 5.23% and 8.57% respectively. For Cryptosporidium spp., the prevalence was 4.58% and 9.52% in Beijing and Jiangxi Province, respectively. Three zoonotic genotypes of E. bieneusi were confirmed, including two known genotypes, genotype Peru 6 and D, and one novel genotype, JXP1. Two avian specific species/genotypes of Cryptosporidium, Avian genotype Ⅲ and Goose genotype Ⅰ, were identified. To our knowledge, this is the first report of E. bieneusi and Cryptosporidium spp. occurrence in peafowl in China. The findings suggest that peafowl could be reservoirs of E. bieneusi and Cryptosporidium spp. which could be potentially transmitted to humans and other animals, and the present survey have implications for controlling E. bieneusi and Cryptosporidium spp. infection in peafowl.

Keywords: China, Peafowl, Cryptosporidium spp., Enterocytozoon bieneusi, Genotype

Graphical abstract

Image 1

Open in a new tab

Highlights

  • •

    This is the first report of Enterocytozoon bieneusi and Cryptosporidium spp. in peafowl in China.

  • •

    The average infection rate was 6.59% and higher prevalence was found in the adolescent peafowl.

  • •

    Three zoonotic genotypes of E. bieneusi and 2 avian specific genotypes of Cryptosporidium were identified.

  • •

    This study will enrich the epidemiological data of E. bieneusi and Cryptosporidium spp. infection in China.

1. Introduction

Cryptosporidiosis and microsporidiosis, caused by Cryptosporidium spp. and Enterocytozoon bieneusi respectively, are two important emerging infectious parasitoses in humans and animals. Humans and other susceptible hosts can be infected through accidently ingesting food and water contaminated with oocysts and spores (Ben Ayed et al., 2012; Jedrzejewski et al., 2007; Galván et al., 2013). Infected hosts show clinical symptoms depending on their different health status. In general, the clinical symptoms of immunocompromised individuals are more severe (Checkley et al., 2015; Wang et al., 2013).

Genotypes of E. bieneusi have been identified by analyzing the sequence of the internal transcribed spacer (ITS) of the rRNA gene and more than 240 genotypes have been identified up to now (Santin and Fayer, 2009). The genotypes of E. bieneusi have been divided into 9 groups (group 1–9) according to phylogenetic analysis, including a zoonotic group and other host specific groups (Zhang et al., 2018b). For Cryptosporidium spp., more than 30 species and 40 genotypes have been characterized by analysing the small subunit (SSU) rRNA gene (Holubova et al., 2016; Yang et al., 2016). Some species have been detected in humans (Ryan et al., 2016). In addition to Cryptosporidium baileyi, Cryptosporidium galli and Cryptosporidium meleagridis which are specific for birds (Current et al., 1986; Ryan et al., 2003; Slavin, 1955), also other genotypes of Cryptosporidium, such as goose genotypes I–IV and avian genotypes I–V, have been detected in different avian species (Ryan, 2010).

Because of the ornamental and edible value, the peafowl (Pavo cristatus) are commonly kept as pets and bred in captivity in many countries, including China. Many pathogens, such as avian influenza virus (Li et al., 2017), avian poxvirus (Khan et al., 2009), infectious bronchitis coronavirus (Liu et al., 2005), Ascaridia galli (Teixeira et al., 2012), Newcastle disease virus (Kumar et al., 2013), Toxoplasma gondii (Tian et al., 2012) and Histomonas meleagridis (Michelazzo et al., 2017), have been detected in peafowl, but the infection data of E. bieneusi and Cryptosporidium spp. are still relatively limited. To our knowledge, only one study concerning Cryptosporidium spp. infection in Pavo cristatus has been reported in Brazil (Nakamura et al., 2009), and no information about the prevalence of E. bieneusi in peafowl is available worldwide. The aim of the present study was to investigate the prevalence of Cryptosporidium spp. and E. bieneusi in peafowl from Beijing and Jiangxi Province, China.

2. Materials and methods

2.1. Ethics statement

This work was approved by the Animal Ethics Committee of the Institute of Zoology, Chinese Academy of Sciences. The procedures of collecting feces from peafowl were strictly in line with good animal practices required by the Animal Ethics Procedures and Guidelines of the People's Republic of China.

2.2. Sample collection

Between November 2017 and June 2018, a total of 258 fresh fecal samples taken from cloaca of the peafowl were obtained with sterile cotton swabs, including 153 from Beijing and 105 from Jiangxi Province. At the time of sampling, no obvious clinical signs were observed. The samples fall into two categories according to the age of the peafowl, the adult (≥24 months, n = 108) and the adolescent (≥5 months or < 24 months, n = 150) (Tian et al., 2012). All of the samples were separately collected into sterile centrifuge tube, put into box filled with ice packs, and then transported to the laboratory immediately.

2.3. DNA extraction and PCR amplification

The E.Z.N.A.® Stool DNA Kit (Omega Biotek Inc., Norcross, USA) was used to extract genomic DNA from 200 mg fecal samples following the manufacturer's protocol. The extracted DNA was stored at −20 °C until further PCR analysis. The small subunit ribosomal RNA (SSU rRNA) gene was amplified by nested PCR to identify Cryptosporidium species/genotypes as described by Nolan et al. (2010). To detect E. bieneusi, a fragment of ITS was amplified via nested PCR in accordance with previous methods (Buckholt et al., 2002). The obtained sequences were aligned with each other and reference sequences downloaded from the GenBank database with ClustalX 1.83 software package to differentiate E. bieneusi genotypes. All the primers used in this study were listed in Table 1. Both negative (reagent-grade water) and positive controls (DNA extracted from the E. bieneusi PtEbIX genotype and C. baileyi) were included in each amplification to ensure the accuracy of the results. The secondary PCR products were detected by 2% agarose gel electrophoresis with GoldView™ (Solarbio, China) stained.

Table 1.

Primers used for identification of E. bieneusi and Cryptosporidium spp. in the present study.

Parasite Primer Sequence (5′-3′) Reference
E. bieneusi EBITS3 GGTCATAGGGATGAAGAG Buckholt et al. (2002)
EBITS4 TTCGAGTTCTTTCGCGCTC
EBITS1 GCTCTGAATATCTATGGCT
EBITS2.4 ATCGCCGACGGATCCAAGTG
Cryptosporidium spp. XF2f GGAAGGGTTGTATTTATTAGATAAAG Nolan et al. (2010)
XF2r AAGGAGTAAGGAACAACCTCCA
pSSUf AAAGCTCGTAGTTGGATTTCTGTT
pSSUr ACCTCTGACTGTTAAATACRAATGC
Open in a new tab

The nucleotide sequences generated in present study have been deposited in GenBank under accession numbers MK168300-MK168302 (E. bieneusi) and MK168303-MK168304 (Cryptosporidium spp.).

2.4. Sequencing and phylogenetic analyses

The secondary PCR products were bi-directionally sequenced by the Sino Geno Max Company (Beijing, China). Each PCR product was sequenced three times to ensure that the sequencing results were correct. Chromatograms of the forward and reverse sequences were manually confirmed and the sequences were assembled with Lasergene SeqMan software (DNASTAR, Madison, Wisconsin, USA).

Nucleotide sequences obtained in the present study were aligned with reference sequences available in GenBank database with the ClustalX 1.83 software package was implemented to determine the genotypes of E. bieneusi and Cryptosporidium spp. Phylogenetic analysis was implemented with MEGA 6.0 (Tamura et al., 2013) using the Neighbor-joining algorithm in a Kimura2-parameter model, and the branch reliability was analyzed using a bootstrap of 1000 replicates (Zhang et al., 2018a).

2.5. Statistical analysis

The χ2 test was used to compare the prevalence under SPSS 19.0 (SPSS Inc., Chicago, USA). Differences were considered to be statistically significant at P < 0.05.

3. Results

3.1. Prevalence of E. bieneusi and Cryptosporidium spp

In our study, DNA sequences of the two parasites were determined by nested PCR. The overall prevalence of both Cryptosporidium spp. and E. bieneusi was 6.59% (17/258). Higher infection rates of E. bieneusi and Cryptosporidium spp. were found in the adolescent peafowl, but only the difference in Cryptosporidium spp. infection was significant (P < 0.05). The prevalence of E. bieneusi in Beijing and Jiangxi Province was 5.23% and 8.57% respectively. For Cryptosporidium spp., the prevalence was 4.58% and 9.52% in Beijing and Jiangxi Province, respectively. According to the statistical results, no correlation between the two parasitic protozoa infection and gender (P > 0.05) was found. Moreover, in none of the positive samples a co-infection of Cryptosporidium spp. and E. bieneusi was found in all positive samples (Table 2).

Table 2.

The occurrence of E. bieneusi and Cryptosporidium species/genotypes in peafowl in Beijing and Jiangxi Province, China.

Factors Category E. bieneusi
 Cryptosporidium spp.
No. tested/No. positive Prevalence (%)
(95% CI)		 P-value No. tested/No. positive Prevalence (%)
(95% CI)		 P-value
Region Beijing 8/153 5.23 (1.66–8.80) 0.288 7/153 4.58 (1.23–7.92) 0.115
Jiangxi 9/105 8.57 (3.13–14.01) 10/105 9.52 (3.82–15.23)
Age Adult 4/108 3.70 (0.08–7.32) 0.113 3/108 2.78 (0.83–2.87) 0.036
Adolescent 13/150 8.67 (4.11–13.22) 14/150 9.33 (4.62–14.04)
Gender Female 8/119 6.72 (2.16–11.29) 0.936 7/119 5.88 (1.59–10.17) 0.672
Male 9/139 6.47 (2.33–10.62) 10/139 7.19 (2.84–11.54)
Total 17/258 6.59 (3.54–9.64) 17/258 6.59 (3.54–9.64)
Open in a new tab

3.2. Genetic characterization of E. bieneusi and Cryptosporidium spp

In our studies, three genotypes of E. bieneusi were confirmed by sequencing the second PCR products of ITS region, including two known genotypes, genotype Peru 6 and D, and one novel genotype, termed JXP1. Genotype D was discovered in peafowl from Beijing, and genotype Peru 6 and JXP1 were from Jiangxi Province. Among the seventeen Cryptosporidium-positive fecal samples, 2 species/genotypes of Cryptosporidium, Avian genotype Ⅲ and Goose genotype I, were revealed by amplifying the SSU rRNA gene. The Avian genotype Ⅲ was found in peafowl from Beijing, and the other was from Jiangxi Province (Table 3).

Table 3.

Distribution of E. bieneusi genotypes and Cryptosporidium species/genotypes in peafowl in this study.

Factors E. bieneusi genotype (n) Cryptosporidium spp. (n)
Region Beijing D (8) Avian genotype Ⅲ (7)
Jiangxi JXP1 (6); Peru6 (3) Goose genotypeⅠ(10)
Age Adult D (4) Avian genotype Ⅲ (2)
Adolescent D (4); JXP1 (6); Peru6 (3) Avian genotype Ⅲ (5); Goose genotypeⅠ(10)
Gender Female D (7); JXP1 (3); Peru6 (1) Avian genotype Ⅲ (4); Goose genotypeⅠ(5)
Male D (1); JXP1 (3); Peru6 (2) Avian genotype Ⅲ (3); Goose genotypeⅠ(5)
Total D (8); JXP1 (6); Peru6 (3) Avian genotype Ⅲ (7); Goose genotypeⅠ(10)
Open in a new tab

3.3. Phylogenetic analysis

The E. bieneusi genotypes were separated into 9 distinct groups on the basis of the ITS1/5.8S/ITS2 sequences, and the group 1 was further divided into 8 subgroups (group1a-group1i) (Zhang et al., 2018b). The isolate BJP-18 (MK168302) identified in Beijing was clustered into group1a, JXP1 (MK168300) and JXP-41 (MK168301), were clustered together in group1b (Fig. 1). Phylogenetic tree of Cryptosporidium spp. was constructed based on the SSU rRNA gene. The two isolates of Cryptosporidium spp. recovered in the present study were grouped with the genotype Goose I (AY504516) and Avian genotype Ⅲ (KU885387) with 99% bootstrap support respectively (Fig. 2).

Fig. 1.

Fig. 1

Open in a new tab

Phylogenetic relationships of ITS nucleotide sequences of Enterocytozoon bieneusi identified in the present study and reference genotypes. The phylogenetic tree was constructed with a Neighbor-Joining method with the Kimura 2-parameter model. Bootstrap values > 50% from 1000 replicates are shown on the nodes. The E. bieneusi genotype PtEb (DQ885585) from dog was used as outgroup. The genotypes detected in the current study are shown with solid triangle.

Fig. 2.

Fig. 2

Open in a new tab

Phylogenetic analysis of Cryptosporidium spp. using Neighbor-Joining (NJ) method based on sequences of the small subunit ribosomal RNA (SSU rRNA) gene. Bootstrap values > 50% are shown (1000 replicates). Isolates obtained in the present study are indicated by solid square. The SSU rRNA gene sequence of Eimeria faurei is used as the outgroup.

4. Discussion

E. bieneusi and Cryptosporidium spp. are important pathogens that can cause severe watery diarrhea in humans and animals globally. To explore the role of peafowl in the epidemiology of these pathogens above, we characterized the prevalence and genotypes of E. bieneusi and Cryptosporidium spp. in peafowl from Beijing and Jiangxi Province, China.

In our study, we detected, for the first time, the prevalence (6.59%) of E. bieneusi in peafowl, which was similar to some studies performed in other birds (Bart et al., 2008; Lallo et al., 2012; Pirestani et al., 2013). In contrast to our result, much higher prevalence was found in studies conducted by Li et al. (2014) in chicken, Lobo et al. (2006) in pigeon and Tavalla et al. (2018) in exotic birds. Lower infection rates were identified in pigeon and Brazilian captive birds investigated by Slodkowica-Kowalskaet et al. (2013) and da Cunha et al. (2017) respectively. Cryptosporidium spp. has been detected in a wide range of domestic and wild avian hosts worldwide (Nakamura and Meireles, 2015). In China, Cryptosporidium spp. has been reported in ruddy shelduck (Amer et al., 2010), quails (Wang et al., 2012), ostriches (Qi et al., 2014), domestic pigeons (Li et al., 2015), parrots (Zhang et al., 2015), Java sparrows (Yao et al., 2017) and chickens (Liao et al., 2018). In the present study, we first detected the prevalence of Cryptosporidium spp. in peafowl in China. In Beijing, the infection rate was 4.58%, while in Jiangxi Province, the infection rate was 9.52%. This differences may be caused by climatic conditions, management level and differences in age composition of peafowl in the two locations. To our knowledge, there is no other reports on Cryptosporidium spp. infection in peafowl other than studies conducted by Nakamura et al. (2009). In studies performed in other birds elsewhere, infection rates of Cryptosporidium spp. vary from 0.82% to 43.9% (Baroudi et al., 2013; Li et al., 2015a; Maca and Pavlasek, 2015). Though infection rate varies with geographical location, avian species and detection methods, the number of samples may also be the causation of the differences. Moreover, different hosts are unequally susceptible to various genotypes of the parasites, which may also be responsible for the difference in infection rates. In addition, higher prevalence of E. bieneusi and Cryptosporidium spp. in the adolescent peafowl might be caused by their naive immune status.

Three genotypes of E. bieneusi were identified based on analyzing the ITS region, including two known genotype, Peru6 and D, and one novel genotype, JXP1. All the positive samples detected in Beijing belong to genotype D. In Jiangxi Province, the predominant genotype was JXP1, followed by genotype Peru 6 (Table 3). Genotype D has been widely found in mammals, including humans (Kicia et al., 2016; Prasertbun et al., 2017; Wang et al., 2017), non-human primates (Karim et al., 2014), Suidae (Nemejc et al., 2014; Zhao et al., 2014), ruminants (Huang et al., 2017; Zhao et al., 2015), canids (Li et al., 2015b; Zhang et al., 2016), felines (Li et al., 2016; Xu et al., 2016), rodents (Perec-Matysiak et al., 2015; Yang et al., 2016) and equines (Deng et al., 2016; Qi et al., 2016; Yue et al., 2017). However, genotype D was reported only in a few avian species, such as chicken (Rodrigues da Cunha et al., 2016), pigeon (Pirestani et al., 2013), common crane and red-crowned crane (Zhao et al., 2016), rook (Perec-Matysiak et al., 2017), falcon (Mueller et al., 2008) and swan goose (Anser cygnoides) (da Cunha et al., 2017), and our findings constitute the first report of the genotype in peafowl. Genotype Peru6 was mainly reported in humans (Bern et al., 2005; Lobo et al., 2012), cattle (Santin et al., 2005), sheep and goats (Zhao et al., 2015). Pigeon and lovebird also can be infected by the genotype (Luisa Lobo et al., 2006; Zhao et al., 2016). To our knowledge, this is the first report that peafowls were infected with the genotype Peru6. Together, both genotype Peru 6 and D can infect a wider range of host species, including peafowl, thus may cause microsporidiosis to the host. Moreover, the novel genotype (JXP1) of E. bieneusi identified in our study should be further explored to reveal its danger to the host, especially to human beings. Phylogenetic analysis was performed based on the ITS sequence of E. bieneusi. Both genotype Peru 6 and the novel genotype JXP1 obtained in the present study were grouped into group 1b, and genotype D was clustered into the group 1a. Both group 1b and group 1a belong to group 1, the most important human-pathogenic group. These results suggest that peafowl are potential source of human and animal microsporidiosis.

Molecular characterization of the SSU rRNA gene verified the presence of two genotypes/species, Cryptosporidium Avian genotype Ⅲ and Goose genotype Ⅰ. The former was found in peafowl from Beijing, and the latter was recovered in peafowl from Jiangxi Province. Cryptosporidium Avian genotype Ⅲ was considered specific to birds and first identified in parrots in western Australia by Ng et al. (2006). After that, the genotype was isolated from birds in other countries, such as from the families Psittacidae in Brazil (Gomes et al., 2012; Nakamura et al., 2009; Novaes et al., 2018), Japan (Abe and Makino, 2010; Makino et al., 2010), China (Qi et al., 2011) and the USA (Ravich et al., 2014), from seagulls in Thailand (Koompapong et al., 2014), and from aquatic birds in Spain (Cano et al., 2016). Though the Cryptosporidium Avian genotype Ⅲ seems to play no role in zoonotic potential, its global distribution makes it impossible to ignore its potential threat to bird health. Cryptosporidium Goose genotype I had been detected in Canada Geese (Zhou et al., 2004) and was identified in the feces of peafowl for the first time. Both Cryptosporidium Avian genotype Ⅲ and Goose genotype Ⅰ have not been found in humans up to now. Further research is needed to determine whether zoonotic Cryptosporidium species/genotypes occur in peafowl in other areas and settings.

5. Conclusions

To our knowledge, this is the first report of E. bieneusi infection in peafowl worldwide and first report on Cryptosporidium spp. occurrence in peafowl in China. Moreover, two known zoonotic genotypes, genotype Peru 6 and D, and one novel genotype JXP1 of E. bieneusi and two known avian adapted genotypes, Avian genotype III and Goose genotype I of Cryptosporidium were identified, which suggest the transmission potential of the parasites from peafowl to humans or other animals. To better understand the epidemiology of E. bieneusi and Cryptosporidium spp. in peafowl, further investigations involving more areas and larger number of samples are needed.

Conflicts of interest

The authors have no conflict of interest.

Acknowledgment

This work was supported by National Forestry and Grassland Administration, China, Chinese Academy of Sciences (CZBZX1), the Strategic Priority Research Program of the Chinese Academy of Sciences (XDA19050204), and the External Cooperation Program of BIC, Chinese Academy of Sciences (152111KYSB20150023).

References

  1. Abe N., Makino I. Multilocus genotypic analysis of Cryptosporidium isolates from cockatiels. Japan. Parasitol. Res. 2010;106:1491–1497. doi: 10.1007/s00436-010-1810-5. [DOI] [PubMed] [Google Scholar]
  2. Amer S., Wang C.M., He H.X. First Detection of Cryptosporidium baileyi in ruddy shelduck (Tadorna ferruginea) in China. J. Vet. Med. Sci. 2010;72:935–938. doi: 10.1292/jvms.09-0515. [DOI] [PubMed] [Google Scholar]
  3. Baroudi D., Khelef D., Goucem R., Adjou K.T., Adamu H., Zhang H., Xiao L. Common occurrence of zoonotic pathogen Cryptosporidium meleagridis in broiler chickens and turkeys in Algeria. Vet. Parasitol. 2013;196:334–340. doi: 10.1016/j.vetpar.2013.02.022. [DOI] [PubMed] [Google Scholar]
  4. Bart A., Wentink-Bonnema E.M., Heddema E.R., Buijs J., van Gool T. Frequent occurrence of human-associated microsporidia in fecal droppings of urban pigeons in Amsterdam, The Netherlands. Appl. Environ. Microbiol. 2008;74:7056–7058. doi: 10.1128/AEM.01429-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Ben Ayed L., Yang W., Widmer G., Cama V., Ortega Y., Xiao L. Survey and genetic characterization of wastewater in Tunisia for Cryptosporidium spp., Giardia duodenalis, Enterocytozoon bieneusi, Cyclospora cayetanensis and Eimeria spp. J. Water Health. 2012;10:431–444. doi: 10.2166/wh.2012.204. [DOI] [PubMed] [Google Scholar]
  6. Bern C., Kawai V., Vargas D., Rabke-Verani J., Williamson J., Chavez-Valdez R., Xiao L.H., Sulaiman I., Vivar A., Ticona E., Navincopa M., Cama V., Moura H., Secor W.E., Visvesvara G., Gilman R.H. The epidemiology of intestinal microsporidiosis in patients with HIV/AIDS in Lima, Peru. J. Infect. Dis. 2005;191:1658–1664. doi: 10.1086/429674. [DOI] [PubMed] [Google Scholar]
  7. Buckholt M.A., Lee J.H., Tzipori S. Prevalence of Enterocytozoon bieneusi in swine: an 18-month survey at a slaughterhouse in Massachusetts. Appl. Environ. Microbiol. 2002;68:2595–2599. doi: 10.1128/AEM.68.5.2595-2599.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cano L., de Lucio A., Bailo B., Cardona G.A., Omar Muadica A.S., Lobo L., Carmena D. Identification and genotyping of Giardia spp. and Cryptosporidium spp. isolates in aquatic birds in the Salburua wetlands, Alava, Northern Spain. Vet. Parasitol. 2016;221:144–148. doi: 10.1016/j.vetpar.2016.03.026. [DOI] [PubMed] [Google Scholar]
  9. Checkley W., White A.C., Jr., Jaganath D., Arrowood M.J., Chalmers R.M., Chen X.M., Fayer R., Griffiths J.K., Guerrant R.L., Hedstrom L., Huston C.D., Kotloff K.L., Kang G., Mead J.R., Miller M., Petri W.A., Jr., Priest J.W., Roos D.S., Striepen B., Thompson R.C.A., Ward H.D., Van Voorhis W.A., Xiao L., Zhu G., Houpt E.R. A review of the global burden, novel diagnostics, therapeutics, and vaccine targets for Cryptosporidium. Lancet Infect. Dis. 2015;15:85–94. doi: 10.1016/S1473-3099(14)70772-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Current W.L., Upton S.J., Haynes T.B. The life cycle of Cryptosporidium. baileyi n. sp. (apicomplexa, cryptosporidiidae) infecting chickens. J. Protozool. 1986;33:289–296. doi: 10.1111/j.1550-7408.1986.tb05608.x. [DOI] [PubMed] [Google Scholar]
  11. da Cunha M.J.R., Cury M.C., Santin M. Molecular identification of Enterocytozoon bieneusi, Cryptosporidium, and Giardia in Brazilian captive birds. Parasitol. Res. 2017;16:487–493. doi: 10.1007/s00436-016-5309-6. [DOI] [PubMed] [Google Scholar]
  12. Deng L., Li W., Zhong Z., Gong C., Liu X., Huang X., Xiao L., Zhao R., Wang W., Feng F., Zhang Y., Hu Y., Fu H., He M., Zhang Y., Wu K., Peng G. Molecular characterization and multilocus genotypes of Enterocytozoon bieneusi among horses in southwestern China. Parasites Vectors. 2016;9:561. doi: 10.1186/s13071-016-1844-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Galván A.L., Magnet A., Izquierdo F., Fenoy S., Rueda C., Fernandez Vadillo C., Henriques-Gil N., del Aguila C. Molecular characterization of human-pathogenic microsporidia and Cyclospora cayetanensis isolated from various water sources in Spain: a year-long longitudinal study. Appl. Environ. Microbiol. 2013;79:449–459. doi: 10.1128/AEM.02737-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gomes R.S., Huber F., da Silva S., Bergamo do Bomfim T.C. Cryptosporidium spp. parasitize exotic birds that are commercialized in markets, commercial aviaries, and pet shops. Parasitol. Res. 2012;110:1363–1370. doi: 10.1007/s00436-011-2636-5. [DOI] [PubMed] [Google Scholar]
  15. Holubova N., Sak B., Horcickova M., Hlaskova L., Kvetonova D., Menchaca S., McEvoy J., Kvac M. Cryptosporidium avium n. sp (Apicomplexa: cryptosporidiidae) in birds. Parasitol. Res. 2016;115:2243–2251. doi: 10.1007/s00436-016-4967-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Huang J., Zhang Z., Yang Y., Wang R., Zhao J., Jian F., Ning C., Zhang L. New genotypes of Enterocytozoon bieneusi isolated from sika deer and red deer in China. Front. Microbiol. 2017;8:879. doi: 10.3389/fmicb.2017.00879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Jedrzejewski S., Graczyk T.K., Slodkowicz-Kowalska A., Tamang L., Majewska A.C. Quantitative assessment of contamination of fresh food produce of various retail types by human-virulent microsporidian spores. Appl. Environ. Microbiol. 2007;73:4071–4073. doi: 10.1128/AEM.00477-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Karim M.R., Wang R., Dong H., Zhang L., Li J., Zhang S., Rume F.I., Qi M., Jian F., Sun M., Yang G., Zou F., Ning C., Xiao L. Genetic polymorphism and zoonotic potential of Enterocytozoon bieneusi from nonhuman primates in China. Appl. Environ. Microbiol. 2014;80:1893–1898. doi: 10.1128/AEM.03845-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Khan A., Yousaf A., Khan M.Z., Siddique M., Gul S.T., Mahmood F. Cutaneous form of pox infection among captive peafowl (Pavo cristatus) chicks. Avian Pathol. 2009;38:65–70. doi: 10.1080/03079450802638061. [DOI] [PubMed] [Google Scholar]
  20. Kicia M., Wesolowska M., Kopacz Z., Jakuszko K., Sak B., Kvetonova D., Krajewska M., Kvac M. Prevalence and molecular characteristics of urinary and intestinal microsporidia infections in renal transplant recipients. Clin. Microbiol. Infect. 2016;22:462. doi: 10.1016/j.cmi.2016.01.014. [DOI] [PubMed] [Google Scholar]
  21. Koompapong K., Mori H., Thammasonthijarern N., Prasertbun R., Pintong A.R., Popruk S., Rojekittikhun W., Chaisiri K., Sukthana Y., Mahittikorn A. Molecular identification of Cryptosporidium spp. in seagulls, pigeons, dogs, and cats in Thailand. Parasite. 2014;21:52. doi: 10.1051/parasite/2014053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kumar A., Maan S., Mahajan N.K., Rana V.P., Jindal N., Batra K., Ghosh A., Mishra S.K., Kapoor S., Maan N.S. Detection and molecular characterization of Newcastle disease virus in peafowl (Pavo cristatus) in Haryana State, India. Indian J. Virol. 2013;24:380–385. doi: 10.1007/s13337-013-0169-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lallo M.A., Calabria P., Milanelo L. Encephalitozoon and Enterocytozoon (Microsporidia) spores in stool from pigeons and exotic birds: microsporidia spores in birds. Vet. Parasitol. 2012;190:418–422. doi: 10.1016/j.vetpar.2012.06.030. [DOI] [PubMed] [Google Scholar]
  24. Li J., Lin X., Zhang L., Qi N., Liao S., Lv M., Wu C., Sun M. Molecular characterization of Cryptosporidium spp. in domestic pigeons (Columba livia domestica) in Guangdong province, Southern China. Parasitol. Res. 2015;114:2237–2241. doi: 10.1007/s00436-015-4415-1. [DOI] [PubMed] [Google Scholar]
  25. Li M., Zhao N., Luo J., Li Y., Chen L., Ma J., Zhao L., Yuan G., Wang C., Wang Y., Liu Y., He H. Genetic characterization of continually evolving highly pathogenic H5N6 influenza viruses in China, 2012-2016. Front. Microbiol. 2017;8:260. doi: 10.3389/fmicb.2017.00260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Li W., Deng L., Yu X., Zhong Z., Wang Q., Liu X., Niu L., Xie N., Deng J., Lei S., Wang L., Gong C., Zhou Z., Hu Y., Fu H., Xu H., Geng Y., Peng G. Multilocus genotypes and broad host-range of Enterocytozoon bieneusi in captive wildlife at zoological gardens in China. Parasites Vectors. 2016;9:395. doi: 10.1186/s13071-016-1668-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Li W., Li Y., Song M., Lu Y., Yang J., Tao W., Jiang Y., Wan Q., Zhang S., Xiao L. Prevalence and genetic characteristics of Cryptosporidium, Enterocytozoon bieneusi and Giardia duodenalis in cats and dogs in Heilongjiang province, China. Vet. Parasitol. 2015;208:125–134. doi: 10.1016/j.vetpar.2015.01.014. [DOI] [PubMed] [Google Scholar]
  28. Li W., Tao W., Jiang Y., Diao R., Yang J., Xiao L. Genotypic distribution and phylogenetic characterization of Enterocytozoon bieneusi in diarrheic chickens and pigs in multiple cities, China: potential zoonotic transmission. PLoS One. 2014;9:e108279. doi: 10.1371/journal.pone.0108279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Liao C., Wang T., Koehler A.V., Fan Y., Hu M., Gasser R.B. Molecular investigation of Cryptosporidium in farmed chickens in Hubei Province, China, identifies 'zoonotic' subtypes of C. meleagridis. Parasites Vectors. 2018;11:484. doi: 10.1186/s13071-018-3056-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Liu S.W., Chen J.F., Chen J.D., Kong X.G., Shao Y.H., Han Z.X., Feng L., Cai X.H., Gul S.L., Liu M. Isolation of avian infectious bronchitis coronavirus from domestic peafowl (Pavo cristatus) and teal (Anas) J. Gen. Virol. 2005;86:719–725. doi: 10.1099/vir.0.80546-0. [DOI] [PubMed] [Google Scholar]
  31. Lobo M.L., Xiao L., Antunes F., Matos O. Microsporidia as emerging pathogens and the implication for public health: a 10-year study on HIV-positive and -negative patients. Int. J. Parasitol. 2012;42:197–205. doi: 10.1016/j.ijpara.2011.12.002. [DOI] [PubMed] [Google Scholar]
  32. Luisa Lobo M., Xiao L., Cama V., Magalhaes N., Antunes F., Matos O. Identification of potentially human-pathogenic Enterocytozoon bieneusi genotypes in various birds. Appl. Environ. Microbiol. 2006;72:7380–7382. doi: 10.1128/AEM.01394-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Maca O., Pavlasek I. First finding of spontaneous infections with Cryptosporidium baileyi and C. meleagridis in the red-legged partridge Alectoris rufa from an aviary in the Czech Republic. Vet. Parasitol. 2015;209:164–168. doi: 10.1016/j.vetpar.2015.03.003. [DOI] [PubMed] [Google Scholar]
  34. Makino I., Abe N., Reavill D.R. Cryptosporidium avian genotype III as a possible causative agent of chronic vomiting in peach-faced lovebirds (Agapornis roseicollis) Avian Dis. 2010;54:1102–1107. doi: 10.1637/9227-123009-Case.1. [DOI] [PubMed] [Google Scholar]
  35. Michelazzo M.M.Z., Sasse J.P., de Souza M., Marutani V.H.B., Sampaio Baptista A.A., Garcia J.L., Alfieri A.A., Headley S.A. Systemic histomoniasis in a leucistic Indian peafowl (Pavo cristatus) from Southern Brazil. Avian Dis. 2017;61:325–329. doi: 10.1637/11583-010617-RegR. [DOI] [PubMed] [Google Scholar]
  36. Mueller M.G., Kinne J., Schuster R.K., Walochnik J. Outbreak of micro sporidiosis caused by Enterocytozoon bieneusi in falcons. Vet. Parasitol. 2008;152:67–78. doi: 10.1016/j.vetpar.2007.11.019. [DOI] [PubMed] [Google Scholar]
  37. Nakamura A.A., Meireles M.V. Cryptosporidium infections in birds--a review. Rev. Bras. Parasitol. Vet. 2015;24:253–267. doi: 10.1590/S1984-29612015063. [DOI] [PubMed] [Google Scholar]
  38. Nakamura A.A., Simoes D.C., Antunes R.G., da Silva D.C., Meireles M.V. Molecular characterization of Cryptosporidium spp. from fecal samples of birds kept in captivity in Brazil. Vet. Parasitol. 2009;166:47–51. doi: 10.1016/j.vetpar.2009.07.033. [DOI] [PubMed] [Google Scholar]
  39. Nemejc K., Sak B., Kvetonova D., Hanzal V., Janiszewski P., Forejtek P., Rajsky D., Kotkova M., Ravaszova P., McEvoy J., Kvac M. Prevalence and diversity of Encephalitozoon spp. and Enterocytozoon bieneusi in wild boars (Sus scrofa) in central Europe. Parasitol. Res. 2014;113:761–767. doi: 10.1007/s00436-013-3707-6. [DOI] [PubMed] [Google Scholar]
  40. Ng J., Pavlasek I., Ryan U. Identification of novel Cryptosporidium genotypes from avian hosts. Appl. Environ. Microbiol. 2006;72:7548–7553. doi: 10.1128/AEM.01352-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Nolan M.J., Jex A.R., Haydon S.R., Stevens M.A., Gasser R.B. Molecular detection of Cryptosporidium cuniculus in rabbits in Australia. Infect. Genet. Evol. 2010;10:1179–1187. doi: 10.1016/j.meegid.2010.07.020. [DOI] [PubMed] [Google Scholar]
  42. Novaes R.S., Pires M.S., Sudre A.P., Bergamo do Bomfim T.C. Captive-bred neotropical birds diagnosed with Cryptosporidium Avian genotype III. Acta Trop. 2018;78:297–302. doi: 10.1016/j.actatropica.2017.12.013. [DOI] [PubMed] [Google Scholar]
  43. Perec-Matysiak A., Bunkowska-Gawlik K., Kvac M., Sak B., Hildebrand J., Lesnianska K. Diversity of Enterocytozoon bieneusi genotypes among small rodents in southwestern Poland. Vet. Parasitol. 2015;214:242–246. doi: 10.1016/j.vetpar.2015.10.018. [DOI] [PubMed] [Google Scholar]
  44. Perec-Matysiak A., Wesolowska M., Lesnianska K., Bunkowska-Gawlik K., Hildebrand J., Kicia M. Survey for zoonotic microsporidian pathogens in wild living urban rooks (Corvus frugilegus) J. Eukaryot. Microbiol. 2017;64:721–724. doi: 10.1111/jeu.12402. [DOI] [PubMed] [Google Scholar]
  45. Pirestani M., Sadraei J., Forouzandeh M. Molecular characterization and genotyping of human related microsporidia in free-ranging and captive pigeons of Tehran, Iran. Infect. Genet. Evol. 2013;20:495–499. [PubMed] [Google Scholar]
  46. Prasertbun R., Mori H., Pintong A.-r., Sanyanusin S., Popruk S., Komalamisra C., Changbunjong T., Buddhirongawatr R., Sukthana Y., Mahittikorn A. Zoonotic potential of Enterocytozoon genotypes in humans and pigs in Thailand. Vet. Parasitol. 2017;233:73–79. doi: 10.1016/j.vetpar.2016.12.002. [DOI] [PubMed] [Google Scholar]
  47. Qi M., Huang L., Wang R., Xiao L., Xu L., Li J., Zhang L. Natural infection of Cryptosporidium muris in ostriches (Struthio camelus) Vet. Parasitol. 2014;205:518–522. doi: 10.1016/j.vetpar.2014.06.035. [DOI] [PubMed] [Google Scholar]
  48. Qi M., Wang R., Ning C., Li X., Zhang L., Jian F., Sun Y., Xiao L. Cryptosporidium spp. in pet birds: genetic diversity and potential public health significance. Exp. Parasitol. 2011;128:336–340. doi: 10.1016/j.exppara.2011.04.003. [DOI] [PubMed] [Google Scholar]
  49. Qi M., Wang R., Wang H., Jian F., Li J., Zhao J., Dong H., Zhu H., Ning C., Zhang L. Enterocytozoon bieneusi genotypes in grazing horses in China and their zoonotic transmission potential. J. Eukaryot. Microbiol. 2016;63:591–597. doi: 10.1111/jeu.12308. [DOI] [PubMed] [Google Scholar]
  50. Ravich M.L., Reavill D.R., Hess L., Childress A.L., Wellehan J.F., Jr. Gastrointestinal cryptosporidiosis in captive psittacine birds in the United States: a case review. J. Avian Med. Surg. 2014;28:297–303. doi: 10.1647/1082-6742-28.4.297. [DOI] [PubMed] [Google Scholar]
  51. Rodrigues da Cunha M.J., Cury M.C., Santin M. Widespread presence of human-pathogenic Enterocytozoon bieneusi genotypes in chickens. Vet. Parasitol. 2016;217:108–112. doi: 10.1016/j.vetpar.2015.12.019. [DOI] [PubMed] [Google Scholar]
  52. Ryan U. Cryptosporidium in birds, fish and amphibians. Exp. Parasitol. 2010;124:113–120. doi: 10.1016/j.exppara.2009.02.002. [DOI] [PubMed] [Google Scholar]
  53. Ryan U., Xiao L.H., Read C., Zhou L., Lal A.A., Pavlasek I. Identification of novel Cryptosporidium genotypes from the Czech republic. Appl. Environ. Microbiol. 2003;69:4302–4307. doi: 10.1128/AEM.69.7.4302-4307.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Ryan U., Zahedi A., Paparini A. Cryptosporidium in humans and animalsa one health approach to prophylaxis. Parasite Immunol. 2016;38:535–547. doi: 10.1111/pim.12350. [DOI] [PubMed] [Google Scholar]
  55. Santin M., Fayer R. Enterocytozoon bieneusi genotype nomenclature based on the internal transcribed spacer sequence: a consensus. J. Eukaryot. Microbiol. 2009;56:34–38. doi: 10.1111/j.1550-7408.2008.00380.x. [DOI] [PubMed] [Google Scholar]
  56. Santin M., Trout J.M., Fayer R. Enterocytozoon bieneusi genotypes in dairy cattle in the eastern United States. Parasitol. Res. 2005;97:535–538. doi: 10.1007/s00436-005-1482-8. [DOI] [PubMed] [Google Scholar]
  57. Slavin D. Cryptosporidium meleagridis (sp. nov.) J. Comp. Pathol. 1955;65:262–266. doi: 10.1016/s0368-1742(55)80025-2. [DOI] [PubMed] [Google Scholar]
  58. Slodkowicz-Kowalska A., Graczyk T.K., Nowosad A., Majewska A.C. First detection of microsporidia in raised pigeons in Poland. Ann. Agric. Environ. Med. 2013;20:13–15. [PubMed] [Google Scholar]
  59. Tamura K., Stecher G., Peterson D., Filipski A., Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013;30:2725–2729. doi: 10.1093/molbev/mst197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Tavalla M., Mardani-Kateki M., Abdizadeh R., Soltani S., Saki J. Molecular diagnosis of potentially human pathogenic Enterocytozoon bieneusi and Encephalitozoon species in exotic birds in Southwestern Iran. J. Infect. Public Health. 2018;11:192–196. doi: 10.1016/j.jiph.2017.07.028. [DOI] [PubMed] [Google Scholar]
  61. Teixeira M., Monteiro J.P., Catenacci L.S., de Azevedo Rodrigues M.d.L., Brasil Sato M.d.C. Ascaridiasis in peafowl Pavo cristatus (Phasianidae) due to Ascaridia galli Schrank, 1788. J. Zoo Wildl. Med. 2012;43:585–587. doi: 10.1638/2011-0122R2.1. [DOI] [PubMed] [Google Scholar]
  62. Tian Y.M., Dai F.Y., Huang S.Y., Deng Z.H., Duan G., Zhou D.H., Yang J.F., Weng Y.B., Zhu X.Q., Zou F.C. First report of Toxoplasma gondii seroprevalence in peafowls in Yunnan province, southwestern China. Parasites Vectors. 2012;5:205. doi: 10.1186/1756-3305-5-205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Wang L., Zhang H., Zhao X., Zhang L., Zhang G., Guo M., Liu L., Feng Y., Xiao L. Zoonotic Cryptosporidium species and Enterocytozoon bieneusi genotypes in HIV-Positive patients on antiretroviral therapy. J. Clin. Microbiol. 2013;51:557–563. doi: 10.1128/JCM.02758-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Wang R., Wang F., Zhao J., Qi M., Ning C., Zhang L., Xiao L. Cryptosporidium spp. in quails (Coturnix coturnix japonica) in Henan, China: molecular characterization and public health significance. Vet. Parasitol. 2012;187:534–537. doi: 10.1016/j.vetpar.2012.02.002. [DOI] [PubMed] [Google Scholar]
  65. Wang T., Fan Y., Koehler A.V., Ma G., Li T., Hu M., Gasser R.B. First survey of Cryptosporidium, Giardia and Enterocytozoon in diarrhoeic children from Wuhan, China. Infect. Genet. Evol. 2017;51:127–131. doi: 10.1016/j.meegid.2017.03.006. [DOI] [PubMed] [Google Scholar]
  66. Xu H., Jin Y., Wu W., Li P., Wang L., Li N., Feng Y., Xiao L. Genotypes of Cryptosporidium spp., Enterocytozoon bieneusi and Giardia duodenalis in dogs and cats in Shanghai, China. Parasites Vectors. 2016;9:121. doi: 10.1186/s13071-016-1409-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Yang Z., Zhao W., Shen Y., Zhang W., Shi Y., Ren G., Yang D., Ling H., Yang F., Liu A., Cao J. Subtyping of Cryptosporidium cuniculus and genotyping of Enterocytozoon bieneusi in rabbits in two farms in Heilongjiang Province, China. Parasite. 2016;23:52. doi: 10.1051/parasite/2016063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Yao Q.X., Zhang X.X., Chen K., Ma J.G., Zheng W.B., Xu X.Q., Zhu X.Q. Prevalence and genetic characterization of Cryptosporidium infection in Java sparrows (Lonchura oryzivora) in Northern China. BioMed Res. Int. 2017;2017:2318476. doi: 10.1155/2017/2318476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Yue D.M., Ma J.G., Li F.C., Hou J.L., Zheng W.B., Zhao Q., Zhang X.X., Zhu X.Q. Occurrence of Enterocytozoon bieneusi in donkeys (Equus asinus) in China: a public health concern. Front. Microbiol. 2017;8:565. doi: 10.3389/fmicb.2017.00565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Zhang X.X., Cong W., Lou Z.L., Ma J.G., Zheng W.B., Yao Q.X., Zhao Q., Zhu X.Q. Prevalence, risk factors and multilocus genotyping of Enterocytozoon bieneusi in farmed foxes (Vulpes lagopus), Northern China. Parasites Vectors. 2016;9:72. doi: 10.1186/s13071-016-1356-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Zhang X.X., Zhang N.Z., Zhao G.H., Zhao Q., Zhu X.Q. Prevalence and genotyping of Cryptosporidium infection in pet parrots in North China. BioMed Res. Int. 2015;2015:549798. doi: 10.1155/2015/549798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Zhang X.X., Jiang R.L., Ma J.G., Xu C., Zhao Q., Hou G., Liu G.H. Enterocytozoon bieneusi in minks (Neovison vison) in Northern China: a public health concern. Front. Microbiol. 2018;9:1221. doi: 10.3389/fmicb.2018.01221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Zhang Y., Koehler A.V., Wang T., Haydon S.R., Gasser R.B. First detection and genetic characterisation of Enterocytozoon bieneusi in wild deer in Melbourne's water catchments in Australia. Parasites Vectors. 2018;11:2. doi: 10.1186/s13071-017-2577-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Zhao W., Yu S., Yang Z., Zhang Y., Zhang L., Wang R., Zhang W., Yang F., Liu A. Genotyping of Enterocytozoon bieneusi (Microsporidia) isolated from various birds in China. Infect. Genet. Evol. 2016;40:151–154. doi: 10.1016/j.meegid.2016.02.037. [DOI] [PubMed] [Google Scholar]
  75. Zhao W., Zhang W., Yang D., Zhang L., Wang R., Liu A. Prevalence of Enterocytozoon bieneusi and genetic diversity of ITS genotypes in sheep and goats in China. Infect. Genet. Evol. 2015;32:265–270. doi: 10.1016/j.meegid.2015.03.026. [DOI] [PubMed] [Google Scholar]
  76. Zhao W., Zhang W., Yang F., Cao J., Liu H., Yang D., Shen Y., Liu A. High prevalence of Enterocytozoon bieneusi in asymptomatic pigs and assessment of zoonotic risk at the genotype level. Appl. Environ. Microbiol. 2014;80:3699–3707. doi: 10.1128/AEM.00807-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Zhou L., Kassa H., Tischler M.L., Xiao L.H. Host-adapted Cryptosporidium spp. in Canada geese (Branta canadensis) Appl. Environ. Microbiol. 2004;70:4211–4215. doi: 10.1128/AEM.70.7.4211-4215.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from International Journal for Parasitology: Parasites and Wildlife are provided here courtesy of Elsevier

RESOURCES