Abstract
Cluster of differentiation (CD)1 molecules are a highly conserved family of MCH-like transmembrane glycoproteins that bind lipid and glycolipid antigens and present a diverse range of microbial and self-glycolipids to antigen-specific T cells. The current study aimed to find out the impact of CD1A and CD1D polymorphisms on pulmonary tuberculosis (PTB). This case-control study encompassed 172 PTB patients and 180 healthy subjects. Genotyping of CD1A and CD1D variants was achieved using the polymerase chain reaction restriction fragment length polymorphism method. The results revealed that CD1A rs411089 variant significantly increased the risk of PTB in recessive model [odds ratio (OR)=2.71, 95% confidence interval (CI)=1.38-5.57, CC vs. TT+TC, P=0.005]. CD1D rs859009 polymorphism significantly reduced the risk of PTB in heterozygous codominant (OR=0.50, 95% CI=0.29-0.86, P=0.011, GC vs. GG) and dominant (OR=0.53, 95% CI=0.31-0.88, P=0.019, GC+CC vs. GG) inheritance model. The CD1A rs366316, CD1D rs973742 and CD1D rs859010 were not associated with the risk/protection from PTB (P>0.05). The results of the present study suggest that CD1A rs411089 and CD1D rs859009 but not CD1A rs366316, CD1D rs973742 and CD1D rs859010 polymorphisms are associated with PTB in a sample of the Iranian population. Further investigation with different ethnicities and larger sample sizes are necessary to certify the findings of the present study.
Keywords: tuberculosis, cluster of differentiation 1A, cluster of differentiation 1D, polymorphism
Introduction
Mycobacterium tuberculosis (MTB) is respiratory tract infectious disease but can affect nearly all of the body, including the brain, the kidneys and the bones (1). Tuberculosis is still a major health problem and a leading cause of mortalities from infectious disease throughout the world (2). Based on a World Health Organization report 10.4 million new TB cases and 1.3 million fatalities occurred in 2016 globally (3). The prevalence of TB in Sistan and Baluchistan province is higher than other provinces of Iran. Whereas one-third of the world's population is infected with MTB, 5-10% of infected cases go on to develop active TB, which indicates that in addition to the environment host genetics factors may influence the risk of the disease (2,4,5).
Cluster of differentiation 1 (CD1) genes, mapped to human chromosome 1 (1q23.1), encoding five isoforms of the CD1 molecule, namely CD1a, CD1b, CD1c, CD1d and CD1e (6-9). CD1 is a family of glycoproteins which are expressed on antigen presenting cells (APCs) (10). They are belongs to major histocompatibility complex class Ι (MHC) and participate in presentation of lipid antigens to T cells (11) but unlike MHCs their expression is nearly identical in all humans (11). The CD1 family can be divided into three groups. Group 1 consists of CD1a, CD1b and CD1c that present lipid antigens to T-helper cells. CD1D belongs to group 2 and presents lipid antigens to natural killer T cells and group 3 that composed of CD1E (12).
It is clear that CD1 molecules participate in cell-mediated immune responses against MTB (13). Indeed, several kinds of mycobacterial lipids function as antigens in this system (11). CD1-restricted T cells identify MTB and react to mycobacterium cell wall lipid antigens (14). CD1 molecules, unlike classical MHC molecules, exhibit limited polymorphism (10,15) but, these few polymorphisms are demonstrated to be associated with susceptibility or resistance to certain diseases (12,14,16,17). Single nucleotide polymorphism (SNPs), the most common type of genetic variants can affect the expression and function of the gene (18,19). There is little data regarding the impact of CD1 gene polymorphisms and tuberculosis susceptibility (14). Seshadri et al (14) investigated the association between rs366316, rs2269714, rs411089 and rs389293 polymorphisms of CD1A gene and risk of tuberculosis. They reported that rs411089 and rs366316 variants were significantly correlated with the development of tuberculosis. To the best of our knowledge, no study investigated the impact of CDID polymorphisms on tuberculosis susceptibility. The present study aimed to examine the association between CD1A (rs411089 and rs366316) and CD1D (rs973742, rs859009 and rs859010) polymorphisms and the risk of PTB in a sample of the southeast Iranian population.
Materials and methods
Patients
A total of 352 subjects including 172 clinically diagnosed patients with pulmonary tuberculosis (PTB) between 12 and 86 years of age (69 males and 103 females), and 180 unrelated healthy individuals ranging between 20 and 85 years of age (74 males and 106 females) were recruited in the study from May 2014 to March 2018. The cases were selected from PTB patients admitted to the University Affiliated Hospital (Bouali Hospital, Zahedan, Iran; referral center for TB). The diagnosis of PTB depended on clinical findings, radiological evidence, positive smear for MTB, culture and response to antituberculosis chemotherapy as described previously (20-23). The control individuals did not have a history of TB and inflammatory disease or other of chronic infectious disease; they were of the same ethnicity as patients and living in the same area as the patients with PTB (Southeast Iran). The local Ethics Committee of the Zahedan University of Medical Sciences (Zahedan, Iran) approved the project and written informed consent was taken from all participants. Blood samples (5 ml) were collected in Na-EDTA tubes from patients and healthy controls and stored at -20 until DNA extraction. Genomic DNA was extracted from whole blood by salting-out method as described previously (24).
Genotyping
Genotyping of CD1A and CD1D was achieved by polymerase chain reaction amplification-restriction fragment length polymorphism assays. The primers were synthesized by Metabion International AG (Erding, Germany) and the restriction enzyme were purchased from Fermentas; Thermo Fisher Scientific, Inc. (Waltham, MA, USA). Primer sequences restriction enzymes and length of the fragments are summarized in Table I. Amplification was achieved in a final volume of 20 µl containing 1 µl genomic DNA (~100 ng/ml), 1 µl each primer (10 µM) and 10 µl of 2X Prime Taq Premix (Genet Bio, Daejeon, Korea), and 7 µl ddH2O. The PCR conditions were set as follows: 95˚C for 5 min, 30 cycles of 95˚C for 30 sec, 62˚C for CD1A rs411089, CD1D rs859009 and CD1D rs859010, 60˚C for CD1D rs973742, 65˚C for CD1A rs366316 and 72˚C for 30 sec and a final extension step of 72˚C for 5 min. Then, 10 µl of PCR product was digested with suitable restriction enzyme (Table II) and resolved on 2.5% agarose gel containing 0.5 µg/ml ethidium bromide and visualized under UV light. A total of ~10% of the random samples were regenotyped and the finding were confirmed as 100% concordant.
Table I.
Primer sequences of polymerase chain reaction-restriction fragment length polymorphism for detection of CD1A and CD1D polymorphisms.
| Primer sequences (5'-3') | Restriction enzyme | Fragment (bp) | |
|---|---|---|---|
| CD1A rs411089 | F: TGTGTGTGGTTTCCCTAGCA | BseGI | T allele: 297 |
| R: CGATCCAGGTGACATGGAAG | C allele: 205+92 | ||
| CD1A rs366316 | F: TGGGAAAATATTGAAAAGGACAG | AlW26I | G allele: 401 |
| R: ATTGGTCTTTGATTTCTGTTCCA | A allele: 254+147 | ||
| CD1D rs973742 | F: TGGGGAGTCTGCCATAATAGA | TaiI | A allele: 502 |
| R: TGCCCATTTATTATCTGAATGTTG | G allele: 273+229 | ||
| CD1D rs859009 | F: TGGCTGTCCAGGTACACACT | MwoI | G allele 440 |
| R: GCAGTACATGTCTCTAGGTGGAA | C allele 338,102 | ||
| CD1D rs859010 | F: TGGCTGTCCAGGTACACACT | ALw26I | A allele 152, 271 |
| R: GCAGTACATGTCTCTAGGTGGAA | T allele 423 |
CD, cluster of differentiation; F, forward; R, reverse.
Table II.
The genotypes and allele frequency distribution of CD1A polymorphism in pulmonary tuberculosis patients and control groups.
| Polymorphism | Patients n (%) | Controls n (%) | OR (95% CI) | P-value | PC | HWE (P-value) |
|---|---|---|---|---|---|---|
| CD1A rs411089 | 0.000 | |||||
| Codominant | ||||||
| TT | 21 (12.2) | 20 (11.1) | 1.00 | - | - | |
| TC | 121 (70.3) | 147 (81.7) | 0.78 (0.41-1.47) | 0.503 | - | |
| CC | 30 (17.5) | 13 (7.2) | 2.20 (0.89-5.25) | 0.118 | - | |
| Dominant | ||||||
| TT | 21 (12.2) | 20 (11.1) | 1.00 | |||
| TC+CC | 151 (87.8) | 160 (88.9) | 0.90 (0.48-1.69) | 0.868 | - | |
| Recessive | ||||||
| TT+TC | 142 (82.5) | 167 (92.8) | 1.00 | |||
| CC | 30 (17.5) | 13 (7.2) | 2.71 (1.38-5.57) | 0.005 | 0.010 | |
| Alleles | ||||||
| T | 163 (47.4) | 187 (51.9) | 1.00 | |||
| C | 181 (52.6) | 173 (48.1) | 1.20 (0.89-1.61) | 0.221 | - | |
| CD1A rs366316 | 0.079 | |||||
| Codominant | ||||||
| AA | 70 (40.7) | 61 (33.9) | 1.00 | |||
| AG | 81 (47.1) | 97 (53.9) | 0.73 (0.46-1.14) | 0.205 | - | |
| GG | 21 (12.2) | 22 (12.2) | 0.83 (0.42-1.66) | 0.725 | ||
| Dominant | ||||||
| AA | 70 (40.7) | 61 (33.9) | 1.00 | |||
| AG+GG | 102 (59.3) | 119 (66.1) | 0.74 (0.48-1.16) | 0.225 | - | |
| Recessive | ||||||
| AA+AG | 151 (47.8) | 158 (87.8) | 1.00 | |||
| GG | 21 (12.2) | 10 (12.2) | 2.20 (1.05-4.62) | 0.058 | - | |
| Alleles | ||||||
| A | 221 (64.2) | 219 (60.8) | 1.00 | |||
| G | 123 (35.8) | 141 (39.2) | 0.86 (0.64-1.17) | 0.391 | - | |
The association was performed using logistic regression analysis. HWE was tested by χ2 test. OR, odds ratio; CI, confidence interval; PC, Bonferroni corrected P-value; HWE, Hardy-Weinberg equilibrium; CD, cluster of differentiation.
Statistical analysis
Analysis of the data was achieved by the statistical package SPSS 20 software (IBM Corp., Armonk, NY, USA). Association among variants and PTB risk was estimated by calculation the odds ratio (OR) and 95% confidence intervals (CI) from logistic regression analysis. The Bonferroni correction test was performed by multiplying P-values of logistic regression analysis by the number of SNPs examined for each gene.
Haplotype analysis was executed using SNPStats: A web tool for the analysis of association studies (25). P<0.05 was considered to indicate a statistically significant difference.
The observed genotype frequencies in the controls were examined for Hardy-Weinberg equilibrium (HWE) using the χ2-test. The Bonferroni correction test was performed by multiplying P-values by the number of SNPs examined for each gene.
Results
Patients
The study participants include 172 patients with PTB (69 males and 103 females; mean age, 50.01±20.57 years) and 180 healthy individuals (74 males and 106 females; mean age, 49.92±15.10 years). There was no statistically significant difference between the groups regarding sex and age (P=0.486 and 0.572, respectively).
Association between the CD1A variants and PTB risk
The genotype and allelic frequencies of CD1A rs411089 and CD1A rs366316 gene polymorphisms in cases and controls are presented in Table II. The results demonstrated that the CC genotype of CD1A rs411089 polymorphism in recessive inheritance model increased the risk of PTB in comparison with TT+TC genotypes (OR=2.71, 95% CI=1.36-5.40, P=0.004). As presented in Table II there was no significant difference in genotype and allelic distribution of CD1A rs366316 gene polymorphisms between PTB patients and controls (P>0.05).
Association between the CD1D variants and PTB risk
Table III summarized the genotype and allele frequencies of CD1D rs973742, CD1D rs859009 and CD1D rs859010 polymorphisms in PTB patients and the control groups. The GC genotype as well as the GC+CC genotype of CD1D rs859009 polymorphism decreased the risk of PTB (OR=0.49, 95% CI=0.29-0.85, P=0.01 and OR=0.53, 95% CI=0.31-0.89, P=0.01, respectively). The allele frequency of CD1D rs859009 Polymorphism was not significantly different between the groups (P=0.22). The genotype and allele frequencies of CD1D rs973742 and CD1D rs859010 were not significantly different between two groups (χ2=2.206, P=0.332 and χ2=2.252, P=0.324, respectively). The results demonstrated that CD1D rs973742 and CD1D rs859010 variants were not associated with risk of/protection from PTB in codominant, dominant and recessive tested inheritance models (Table II). The results demonstrated that the rs366316, rs859010 polymorphisms but not rs411089, rs973742 and rs859009 polymorphisms were in present in HWE, Tables II and III).
Table III.
The genotypes and allele distribution of CD1D polymorphisms in pulmonary tuberculosis patients and control groups.
| Polymorphism | Patients n (%) | Controls n (%) | OR (95% CI) | P-value | PC | HWE (P-value) |
|---|---|---|---|---|---|---|
| CD1A rs973742 | 0.000 | |||||
| Codominant | ||||||
| AA | 61 (35.5) | 67 (37.2) | 1.00 | - | - | |
| AG | 93 (54.1) | 102 (56.7) | 1.00 (0.64-1.56) | 0.999 | - | |
| GG | 18 (10.4) | 11 (6.1) | 1.80 (0.76-3.91) | 0.217 | - | |
| Dominant | ||||||
| AA | 61 (35.5) | 67 (37.2) | 1.00 | |||
| AG+GG | 111 (64.5) | 113 (62.8) | 1.08 (0.69-1.68) | 0.741 | - | |
| Recessive | ||||||
| AA+AG | 154 (89.6) | 169 (93.9) | 1.00 | |||
| GG | 18 (10.4) | 11 (6.1) | 1.80 (0.84-4.05) | 0.175 | - | |
| Alleles | ||||||
| A | 215 (62.5) | 236 (65.6) | 1.00 | - | - | |
| G | 129 (37.5) | 124 (34.4) | 1.14 (0.84-1.56) | 0.432 | - | |
| CD1D rs859009 | 0.000 | |||||
| Codominant | ||||||
| GG | 46 (26.7) | 29 (16.1) | 1.00 | - | - | |
| GC | 97 (56.4) | 123 (68.3) | 0.50 (0.29-0.86) | 0.011 | 0.033 | |
| CC | 29 (16.9) | 28 (15.6) | 0.65 (0.32-1.31) | 0.287 | - | |
| Dominant | ||||||
| GG | 46 (26.7) | 29 (16.1) | 1.00 | - | - | |
| GC+CC | 126 (73.3) | 151 (83.9) | 0.53 (0.31-0.88) | 0.019 | 0.057 | |
| Recessive | ||||||
| GG+GC | 143 (83.1) | 152 (84.4) | 1.00 | - | - | |
| CC | 29 (16.9) | 28 (15.6) | 1.10 (0.63-1.92) | 0.773 | - | |
| Alleles | ||||||
| G | 189 (54.9) | 181 (50.3) | 1.00 | - | - | |
| C | 155 (45.1) | 179 (49.7) | 0.82 (0.61-1.11) | 0.227 | - | |
| CD1D rs859010 | 0.183 | |||||
| Codominant | ||||||
| AA | 89 (51.8) | 105 (58.4) | 1.00 | - | - | |
| AT | 73 (42.4) | 69 (38.3) | 1.25 (0.80-1.94) | 0.322 | - | |
| TT | 10 (5.8) | 6 (3.3) | 1.97 (0.74-5.61) | 0.297 | - | |
| Dominant | ||||||
| AA | 89 (51.8) | 105 (58.4) | 1.00 | - | - | |
| AT+TT | 83 (48.2) | 75 (41.6) | 1.31 (0.86-1.98) | 0.239 | - | |
| Recessive | ||||||
| AA+AT | 154 (89.6) | 169 (93.9) | 1.00 | - | - | |
| TT | 18 (10.4) | 11 (6.1) | 1.80 (0.84-4.10) | 0.175 | - | |
| Alleles | ||||||
| A | 251 (72.9) | 279 (77.5) | 1.00 | |||
| T | 93 (27.1) | 81 (22.5) | 1.28 (0.91-1.79) | 0.190 | - | |
The association was performed using logistic regression analysis. HWE was tested by χ2 test. OR, odds ratio; CI, confidence interval; PC, Bonferroni corrected P-value; HWE, Hardy-Weinberg equilibrium.
Haplotypes analysis
Haplotypes analysis was achieved (Table IV) and the results demonstrated that haplotypes TGACA, TAACA, and TAAGA significantly decreased the risk of PTB in comparison with CAGGA (rs411089C/rs366316A/rs973742G/rs859009G/rs859010A).
Table IV.
Haplotype association of CD1A (rs411089 and rs366316) and CD1D (rs973742, rs859009 and rs859010) variants with pulmonary tuberculosis risk.
| rs411089 | rs366316 | rs973742 | rs859009 | rs859010 | Cases (frequency) | Control (frequency) | OR (95% CI) | P-value |
|---|---|---|---|---|---|---|---|---|
| C | A | G | G | A | 0.1133 | 0.1432 | 1.00 | - |
| T | G | A | C | A | 0.1522 | 0.1241 | 0.32 (0.13-0.75) | 0.0092 |
| C | A | A | C | A | 0.0836 | 0.1096 | 1.22 (0.46-3.27) | 0.69 |
| T | A | A | G | T | 0.0517 | 0.0804 | 0.86 (0.31-2.41) | 0.78 |
| C | A | A | G | T | 0.0588 | 0.0632 | 0.97 (0.34-2.75) | 0.96 |
| C | A | G | C | A | 0.0659 | 0.0598 | 0.47 (0.15-1.46) | 0.19 |
| T | G | G | C | A | 0.0674 | 0.0587 | 0.79 (0.20-3.11) | 0.74 |
| T | A | A | C | A | 0.0679 | 0.0419 | 0.14 (0.02-0.89) | 0.038 |
| T | G | A | G | T | 0.0307 | 0.0409 | 0.75 (0.17-3.30) | 0.7 |
| T | A | A | G | A | 0.0634 | 0.0407 | 0.12 (0.03-0.57) | 0.0076 |
| C | A | A | G | A | 0.072 | 0.0378 | 0.99 (0.17-5.86) | 1 |
| T | G | A | G | A | NA | 0.0296 | 1.16 (0.24-5.53) | 0.85 |
| C | G | A | C | A | NA | 0.0283 | 0.99 (0.08-11.45) | 0.99 |
| T | G | A | C | T | 0.0384 | 0.0189 | 0.91 (0.11-7.40) | 0.93 |
| C | G | A | G | A | 0.0166 | 0.0186 | 0.40 (0.06-2.70) | 0.35 |
Haplotype analysis was executed using SNPStats software. Each row represents separate polymorphisms. CD, cluster of differentiation.
Discussion
CD1 is a family of antigen presenting molecules that belongs to the MHC class I molecules but, unlike those that exist on all nucleated cells, the CD1 groups are expressed only on APCs, cortical thymocytes and dendritic cells (DC) (10,26). The human CD1 proteins present lipid antigens of MTB to T cells (27). Mounting evidence revealed a link between CD1 polymorphisms and certain autoimmune and inflammatory diseases including inflammatory neuropathies (12), tuberculosis (14), cancer (28), multiple sclerosis (16,29), and Guillain-Barre syndromes (30). In the current study the possible association between CD1 and the risk pf PTB in a sample of a southeast Iranian population was investigated. The results of the present study indicated that CD1A rs411089 as well as CD1D rs859009 variant was significantly associated with the risk of PTB. The CC genotype of CD1A rs411089 polymorphism in recessive model increased the risk of PTB, while the GC genotype as well as GC+CC genotype of CD1D rs859009 polymorphism significantly decreased the risk of PTB.
To the best of the authors' knowledge, only one study has been performed on the impact of CD1 gene variants on the susceptibility to TB (14). Seshadri et al (14) in a case-population study genotyped rs366316, rs2269714, rs411089 and rs389293 in a discovery cohort of 352 cases and 382 controls. They identified that the rs366316 and rs411089 polymorphisms were significantly associated with the development of TB. In a next step they genotyped rs366316 and rs411089 in a validation cohort of 339 cases and 376 controls and another time discovered a significant association between rs411089 and TB, however they did not find any association between rs366316 and TB (14). In agreement with the results of the present study they demonstrated that the minor homozygous genotype of rs411089 was associated with an increased risk of TB in a recessive model (14). It seems that the minor homozygous genotype of rs411089 accompanied with a functional CD1A-deficiency and this polymorphism cause a low CD1A expression level. Sieling et al (31) demonstrated an increased expression of CD1 proteins (CD1A, CD1B and CD1C) at the site of tuberculoid leprosy lesions. Buettner et al (32) detected DCs in bronchoalveolar lavage specimens of tuberculosis patients with strongly upregulated of CD1A, CD83 and CCR7. Roura-Mir et al (33) have identified that MTB or its cell wall lipids caused increased expression level of CD1A, CD1B and CD1C but not CD1D. CD1A-deficient cells failed to present mycobacterium peptides to T cells. Behar et al (34) demonstrated that CD1D-deficient mice were not significantly different in their susceptibility to infection compared with control mice. This information demonstrates the use of a population genetics study to understanding the role of CD1 antigen-presenting molecules in human disease.
It has been reported that the rs366316 variant which is located in the in the promoter region is strongly associated with low CD1a surface expression (18). The rs411089, an intronic variant, is strongly linked to rs858998 and may regulate transcription independently of rs366316(14). rs973742 is located 4-kb downstream from the CD1D gene and the functional role of this variant is unknown (35). The impact of intronic rs859009 and rs859010 polymorphisms on CD1D expression has not been recognized.
There is no clear explanation for the departure from HWE in the study population regarding rs411089, rs973742 and rs859009 polymorphisms. It may be owing to a small sample size, genetic drift or consanguineous marriages, which is common in this region of the country.
A limitation of this study is that there is no data regarding smoking, diabetes mellitus, socioeconomic status and other risk factor for PTB.
In conclusion, the results of the present study revealed that CD1A (rs411089) and CD1D (rs859009) polymorphisms protect against PTB in a sample of the Iranian population. More well-designed studies in diverse ethnicities are necessary to verify the present results.
Acknowledgements
We would like to thank all individuals who participated in the study.
Funding
The present study was supported by the Deputy for research, Zahedan University of Medical Sciences, Zahedan, Iran (grant no. 7033).
Availability of data and materials
All data generated or analyzed during the present study are included in this published article.
Authors' contributions
MT, MH conceived and designed the study; HD, FB and GB performed the experiments and analyzed the data; MN performed data collection. All authors contributed to the writing of the manuscript and reviewed and approved the final manuscript.
Ethics approval and consent to participate
The local Ethics Committee of the Zahedan University of Medical Sciences approved the project and written informed consent was taken from all participants.
Patient consent for publication
Not applicable.
Conflict of interest
The authors declare no conflict of interest. The abstract of the present study was previously presented at a conference (https://www.nature.com/articles/s41431-018-0248-6).
References
- 1.Smith I. Mycobacterium tuberculosis pathogenesis and molecular determinants of virulence. Clin Microbiol Rev. 2003;16:463–496. doi: 10.1128/CMR.16.3.463-496.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Harishankar M, Selvaraj P, Bethunaickan R. Influence of Genetic Polymorphism Towards Pulmonary Tuberculosis Susceptibility. Front Med (Lausanne) 2018;5(213) doi: 10.3389/fmed.2018.00213. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. WHO: Global Tuberculosis Report 2017. World Health Organization, 2017. [Google Scholar]
- 4.Wei Z, Wenhao S, Yuanyuan M, Yang L, Daming Z, Jiangchun X, Jijun J. A single nucleotide polymorphism in the interferon-γ gene (IFNG +874 T/A) is associated with susceptibility to tuberculosis. Oncotarget. 2017;8:50415–50429. doi: 10.18632/oncotarget.17304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Naderi M, Hashemi M, Ansari H. Macrophage migration inhibitory factor -173G>C polymorphism and risk of tuberculosis: A meta-analysis. EXCLI J. 2017;16:313–320. doi: 10.17179/excli2016-662. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Barral DC, Brenner MB. CD1 antigen presentation: How it works. Nat Rev Immunol. 2007;7:929–941. doi: 10.1038/nri2191. [DOI] [PubMed] [Google Scholar]
- 7.Brigl M, Brenner MB. CD1: Antigen presentation and T cell function. Annu Rev Immunol. 2004;22:817–890. doi: 10.1146/annurev.immunol.22.012703.104608. [DOI] [PubMed] [Google Scholar]
- 8.Aureli A, Oumhani K, Del Beato T, Di Rocco M, Tessitore A, El Aouad R, Piancatelli D. Increased CD1D polymorphism: Identification of two novel alleles, CD1D*03 and *04, in individuals from Morocco. Int J Immunogenet. 2015;42:287–291. doi: 10.1111/iji.12210. [DOI] [PubMed] [Google Scholar]
- 9.Chancellor A, Gadola SD, Mansour S. The versatility of the CD1 lipid antigen presentation pathway. Immunology. 2018;154:196–203. doi: 10.1111/imm.12912. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Siddiqui S, Visvabharathy L, Wang CR. Role of group 1 CD1-restricted T cells in infectious disease. Front Immunol. 2015;6(337) doi: 10.3389/fimmu.2015.00337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Van Rhijn I, Moody DB. CD1 and mycobacterial lipids activate human T cells. Immunol Rev. 2015;264:138–153. doi: 10.1111/imr.12253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Uncini A, Notturno F, Pace M, Caporale CM. Polymorphism of CD1 and SH2D2A genes in inflammatory neuropathies. J Peripher Nerv Syst. 2011;16 (Suppl 1):48–51. doi: 10.1111/j.1529-8027.2011.00307.x. [DOI] [PubMed] [Google Scholar]
- 13.Huang S. Targeting Innate-Like T Cells in Tuberculosis. Front Immunol. 2016;7(594) doi: 10.3389/fimmu.2016.00594. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Seshadri C, Thuong NT, Yen NT, Bang ND, Chau TT, Thwaites GE, Dunstan SJ, Hawn TR. A polymorphism in human CD1A is associated with susceptibility to tuberculosis. Genes Immun. 2014;15:195–198. doi: 10.1038/gene.2014.5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.DeWitt WS, Yu KKQ, Wilburn DB, Sherwood A, Vignali M, Day CL, Scriba TJ, Robins HS, Swanson WJ, Emerson RO, et al. A diverse lipid antigen-specific TCR repertoire is clonally expanded during active tuberculosis. J Immunol. 2018;201:888–896. doi: 10.4049/jimmunol.1800186. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Caporale CM, Notturno F, Pace M, Aureli A, Di Tommaso V, De Luca G, Farina D, Giovannini A, Uncini A. CD1A and CD1E gene polymorphisms are associated with susceptibility to multiple sclerosis. Int J Immunopathol Pharmacol. 2011;24:175–183. doi: 10.1177/039463201102400120. [DOI] [PubMed] [Google Scholar]
- 17.Kuijf ML, Geleijns K, Ennaji N, van Rijs W, van Doorn PA, Jacobs BC. Susceptibility to Guillain-Barré syndrome is not associated with CD1A and CD1E gene polymorphisms. J Neuroimmunol. 2008;205:110–112. doi: 10.1016/j.jneuroim.2008.08.013. [DOI] [PubMed] [Google Scholar]
- 18.Seshadri C, Shenoy M, Wells RD, Hensley-McBain T, Andersen-Nissen E, McElrath MJ, Cheng TY, Moody DB, Hawn TR. Human CD1a deficiency is common and genetically regulated. J Immunol. 2013;191:1586–1593. doi: 10.4049/jimmunol.1300575. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Lundtoft C, Awuah AA, Güler A, Harling K, Schaal H, Mayatepek E, Phillips RO, Nausch N, Owusu-Dabo E, Jacobsen M. An IL7RA exon 5 polymorphism is associated with impaired IL-7Rα splicing and protection against tuberculosis in Ghana. Genes Immun: Oct 31. 2018 doi: 10.1038/s41435-018-0049-5. (Epub ahead of print) [DOI] [PubMed] [Google Scholar]
- 20.Hashemi M, Eskandari-Nasab E, Moazeni-Roodi A, Naderi M, Sharifi-Mood B, Taheri M. Association of CTSZ rs34069356 and MC3R rs6127698 gene polymorphisms with pulmonary tuberculosis. Int J Tuberc Lung Dis. 2013;17:1224–1228. doi: 10.5588/ijtld.12.0762. [DOI] [PubMed] [Google Scholar]
- 21.Naderi M, Hashemi M, Safdari A, Bahari G, Taheri M. Association of genetic polymorphisms of CISH with the risk of pulmonary tuberculosis in Zahedan, Southeast Iran. Braz J Infect Dis. 2016;20:379–383. doi: 10.1016/j.bjid.2016.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Naderi M, Hashemi M, Amininia S. Association of TAP1 and TAP2 gene polymorphisms with susceptibility to pulmonary tuberculosis. Iran J Allergy Asthma Immunol. 2016;15:62–68. [PubMed] [Google Scholar]
- 23.Naderi M, Hashemi M, Pourmontaseri Z, Eskandari-Nasab E, Bahari G, Taheri M. TIRAP rs8177374 gene polymorphism increased the risk of pulmonary tuberculosis in Zahedan, southeast Iran. Asian Pac J Trop Med. 2014;7:451–455. doi: 10.1016/S1995-7645(14)60073-0. [DOI] [PubMed] [Google Scholar]
- 24.Hashemi M, Hanafi Bojd H, Eskandari Nasab E, Bahari A, Hashemzehi NA, Shafieipour S, Narouie B, Taheri M, Ghavami S. Association of adiponectin rs1501299 and rs266729 gene polymorphisms with nonalcoholic fatty liver disease. Hepat Mon. 2013;13(e9527) doi: 10.5812/hepatmon.9527. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Solé X, Guinó E, Valls J, Iniesta R, Moreno V. SNPStats: A web tool for the analysis of association studies. Bioinformatics. 2006;22:1928–1929. doi: 10.1093/bioinformatics/btl268. [DOI] [PubMed] [Google Scholar]
- 26.Ulrichs T, Moody DB, Grant E, Kaufmann SH, Porcelli SA. T-cell responses to CD1-presented lipid antigens in humans with Mycobacterium tuberculosis infection. Infect Immun. 2003;71:3076–3087. doi: 10.1128/IAI.71.6.3076-3087.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Seshadri C, Thuong NT, Mai NT, Bang ND, Chau TT, Lewinsohn DM, Thwaites GE, Dunstan SJ, Hawn TR. A polymorphism in human MR1 is associated with mRNA expression and susceptibility to tuberculosis. Genes Immun. 2017;18:8–14. doi: 10.1038/gene.2016.41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Golmoghaddam H, Pezeshki AM, Ghaderi A, Doroudchi M. CD1a and CD1d genes polymorphisms in breast, colorectal and lung cancers. Pathol Oncol Res. 2011;17:669–675. doi: 10.1007/s12253-011-9367-x. [DOI] [PubMed] [Google Scholar]
- 29.Jamshidian A, Nikseresht AR, Vessal M, Kamali-Sarvestani E. Association of CD1A +622 T/C, +737 G/C and CD1E +6129 A/G genes polymorphisms with multiple sclerosis. Immunol Invest. 2010;39:874–889. doi: 10.3109/08820139.2010.503768. [DOI] [PubMed] [Google Scholar]
- 30.Liu H, Xing Y, Guo Y, Liu P, Zhang H, Xue B, Shou J, Qian J, Peng J, Wang R, et al. Polymorphisms in exon 2 of CD1 genes are associated with susceptibility to Guillain-Barré syndrome. J Neurol Sci. 2016;369:39–42. doi: 10.1016/j.jns.2016.07.029. [DOI] [PubMed] [Google Scholar]
- 31.Sieling PA, Jullien D, Dahlem M, Tedder TF, Rea TH, Modlin RL, Porcelli SA. CD1 expression by dendritic cells in human leprosy lesions: Correlation with effective host immunity. J Immunol. 1999;162:1851–1858. [PubMed] [Google Scholar]
- 32.Buettner M, Meinken C, Bastian M, Bhat R, Stössel E, Faller G, Cianciolo G, Ficker J, Wagner M, Röllinghoff M, et al. Inverse correlation of maturity and antibacterial activity in human dendritic cells. J Immunol. 2005;174:4203–4209. doi: 10.4049/jimmunol.174.7.4203. [DOI] [PubMed] [Google Scholar]
- 33.Roura-Mir C, Wang L, Cheng TY, Matsunaga I, Dascher CC, Peng SL, Fenton MJ, Kirschning C, Moody DB. Mycobacterium tuberculosis regulates CD1 antigen presentation pathways through TLR-2. J Immunol. 2005;175:1758–1766. doi: 10.4049/jimmunol.175.3.1758. [DOI] [PubMed] [Google Scholar]
- 34.Behar SM, Dascher CC, Grusby MJ, Wang CR, Brenner MB. Susceptibility of mice deficient in CD1D or TAP1 to infection with Mycobacterium tuberculosis. J Exp Med. 1999;189:1973–1980. doi: 10.1084/jem.189.12.1973. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Barbier M, Sabbagh A, Kasper E, Asheuer M, Ahouansou O, Pribill I, Forss-Petter S, Vidaud M, Berger J, Aubourg P. CD1 gene polymorphisms and phenotypic variability in X-linked adrenoleukodystrophy. PLoS One. 2012;7(e29872) doi: 10.1371/journal.pone.0029872. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data generated or analyzed during the present study are included in this published article.