Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2019 Mar 28;57(4):e01173-18. doi: 10.1128/JCM.01173-18

Comparison of Loop-Mediated Isothermal Amplification and Real-Time PCR Assays for Detection of Strongyloides Larvae in Different Specimen Matrices

Matthew R Watts a,b,c,✉, Rady Kim a, Vishal Ahuja a, Gemma J Robertson d, Yasmin Sultana a, Michael C Wehrhahn e,f, Richard S Bradbury g, Gwendolyn L Gilbert b,c, Rogan Lee a,b,c
Editor: Michael J Loeffelholzh
PMCID: PMC6440779  PMID: 30728195

Strongyloides stercoralis can cause disease that ranges from asymptomatic chronic infection to fatal hyperinfection. Diagnosis from stool can be challenging because the most sensitive conventional tests require live larvae to be effective and there can be low larval output in chronic infection.

KEYWORDS: PCR, Strongyloides, bronchoalveolar lavage, diagnosis, loop-mediated isothermal amplification, nucleic acid amplification tests, polymerase chain reaction, serum, stool, strongyloidiasis

ABSTRACT

Strongyloides stercoralis can cause disease that ranges from asymptomatic chronic infection to fatal hyperinfection. Diagnosis from stool can be challenging because the most sensitive conventional tests require live larvae to be effective and there can be low larval output in chronic infection. Nucleic acid amplification tests (NAAT) have been developed to complement existing diagnostic methods. We compared a recently developed loop-mediated isothermal amplification (LAMP) assay with a real-time PCR that has previously been validated with larval microscopy. The limits of detection—quantified using serial dilutions of DNA extracts from single Strongyloides ratti third-stage (L3) larvae spiked into approximately 250 µl of 5 different S. stercoralis-negative stool specimens—were 10−3 (1/5 replicates) and 10−2 (1/5 replicates) dilutions for PCR and LAMP, respectively. PCR was positive for 4/5 replicates at 10−2. LAMP was compared to PCR using extracts from 396 stool specimens collected in Bangladesh and Australia, of which 53 were positive and 343 were negative by PCR. The positive percentage agreement of LAMP was 77.3% (95% score confidence interval [CI], 64.5 to 86.6). The negative percentage agreement was 100% (95% CI, 98.9 to 100). In a preliminary investigation, PCR and LAMP assays were positive using DNA extracted from serum (PCR, 3/16 extracts; LAMP, 2/16 extracts) and bronchoalveolar lavage fluid (PCR and LAMP, 2/2 extracts), demonstrating proof of concept. Compared to PCR, the lower number of positive results using the LAMP assay may have been due to reaction inhibitors and DNA degradation, and strategies to improve the LAMP assay are discussed.

INTRODUCTION

Strongyloides stercoralis is a microscopic nematode that can cause a fatal hyperinfection where large numbers of larvae spread throughout the body (1). It is endemic in the tropics and subtropics, and has recently been estimated to infect at least 370 million people worldwide (2). Acquisition typically occurs where there is contact with fecally contaminated soil, allowing infective-stage larvae to penetrate the skin, but it may also occur in health institutions (1). Chronic autoinfection may last for many decades, and thus disease can persist in areas where sanitation has since improved or in people who have migrated from areas where Strongyloides is endemic to areas where it is nonendemic (1, 3).

The gold standard for Strongyloides diagnosis is the morphological identification of adults or larvae in clinical specimens (4). Diagnosis is often based on the detection of larvae in stool specimens or serological tests (4). Strongyloides may also be identified in histopathological specimens (4). Hyperinfection is usually triggered by immunosuppression, which can reduce the sensitivity of serological tests, but in these cases large numbers of larvae will be detected in stool, respiratory secretions, and body fluids (1, 4, 5). At the other end of the disease spectrum, serology may be positive in the context of negative stool tests, as the diagnosis of asymptomatic chronic infection can be complicated by low larval output (6).

The most sensitive conventional techniques for the detection of Strongyloides larvae in stool are dependent on live larvae and include agar plate culture, Harada culture, and the Baermann technique (4). These methods can be compromised in routine laboratory practice, due to preservatives or refrigeration causing larval death (7). While nucleic acid amplification tests (NAAT) do not require live larvae, their effectiveness may be reduced due to low numbers of larvae, reaction inhibition, and nucleases (8, 9). Real-time PCR based on the primers developed by Verweij et al. is the most characterized method, and clinical validation studies have demonstrated sensitivities from 33% to 93% and specificities of 85% to 99%, depending on the comparator methods (10–15). A recent meta-analysis of clinical validation studies calculated a PCR sensitivity of 71.8% compared to morphological identification, while a study comparing PCR to a comprehensive range of stool culture and concentration methods determined a PCR sensitivity of >90% (16, 17). Loop-mediated isothermal amplification (LAMP) is another NAAT that has been adapted for Strongyloides diagnosis (18, 19). The LAMP method is rapid and can be performed with simple, cost-effective equipment (20, 21). However, the evaluations of Strongyloides LAMP assays have primarily been laboratory validations (18, 19).

To further evaluate the performance of the LAMP assay, we compared it to a real-time PCR assay (using primers developed by Verweij et al.) using spiked Strongyloides ratti larvae to determine the limit of detection, and DNA extracted from clinical stool specimens from Dhaka in Bangladesh, regional northern Queensland, and metropolitan Sydney, Australia (10, 12, 22). In cases of hyperinfection patients may be seronegative, have a paralytic ileus, and be unable to produce a fecal sample, so we also performed a preliminary investigation into the use of serum and bronchoalveolar lavage specimens for Strongyloides NAAT (1).

MATERIALS AND METHODS

Samples and DNA extraction methods.

DNA was extracted from the stool samples using the PowerSoil DNA isolation kit (Mo Bio Laboratories, Carlsbad, CA). DNA was eluted from the spin column using the supplied C6 (Tris) buffer or Tris-EDTA (TE) buffer (10 mM Tris-HCl, 1 mM EDTA [pH 8.0]; Sigma-Aldrich, St. Louis, MO). Tris-EDTA was recommended in the manufacturer’s instructions for cases where DNA degradation is a concern. Previous use of the PowerSoil DNA isolation kit with the Strongyloides PCR assay was associated with a higher limit of detection (12).

Laboratory cultured S. ratti third-stage (L3) larvae were isolated from rat feces using the Baermann technique (23). A single larva in water was aspirated into a 10-µl pipette and then spiked into approximately 250-µl aliquots of human stool from 5 separate people, previously confirmed to be negative for Strongyloides by agar plate culture, PCR, and LAMP (18). DNA was eluted using Tris-EDTA buffer. Strongyloides ratti larvae were used instead of S. stercoralis, as S. ratti larvae were available in culture, are nonpathogenic to humans, and contain the conserved target sequences of the PCR and LAMP assays.

DNA extracts from 156 stool specimens collected in a survey of S. stercoralis infection in Dhaka and DNA extracts from 219 clinical stool specimens from regional northern Queensland were obtained from −20°C storage (12, 22). The stool specimens from Dhaka were collected as part of a research project and transported frozen on dry ice (without preservative) to Sydney, where the DNA was extracted (12). The clinical stool specimens from Queensland were transported to a diagnostic laboratory in Townsville, Queensland, some over long distances with the possibility of fluctuations in temperature (22). Specimens were stored at 4°C for 1 to 7 days prior to DNA extraction. DNA was extracted in Townsville and transported to Sydney with freeze-thawing and periods at room temperature. Both sets of specimens were eluted using the C6 (Tris) buffer. DNA was also extracted from clinical stool specimens from metropolitan Sydney, which were stored unpreserved at −20°C. Six were positive on single agar plate culture for S. stercoralis and 15 were negative. The six agar-positive stool specimens were from 5 male patients between the ages of 51 and 76 years old who had either resided in or travelled to areas where Strongyloides is endemic. Stool specimens were collected from one patient before and after ivermectin therapy. The details of any immunosuppressive therapy were not available. DNA was eluted in Tris-EDTA buffer.

Previously Strongyloides antibody-positive serum specimens from a survey of Strongyloides infection in Dhaka, Bangladesh, were taken from −20°C storage (24). They had been stored for >3 years. Seven specimens were from participants who were stool culture-positive for S. stercoralis and 7 were from stool culture-negative participants. Serum was also collected from 2 patients from Sydney, Australia, with S. stercoralis hyperinfection, which was confirmed on the basis of larvae identified on bronchoalveolar lavage fluid by direct microscopy. One patient was a 27-year-old man with Crohn’s disease and HIV, and the other was a 60-year-old man with ulcerative colitis and pemphigus vulgaris (25). Both were treated with azathioprine and corticosteroids and spent time in areas where S. stercoralis is endemic. The serum and bronchoalveolar lavage fluid from the patient with Crohn’s disease were stored at −20°C for approximately 3 years prior to DNA extraction, and the serum and bronchoalveolar lavage fluid from the patient with ulcerative colitis were stored at −20°C for approximately 1 month prior to extraction. The NucliSENS easyMag system (bioMérieux, Marcy-l’Etoile, France) was used to extract DNA from 250 µl of serum, according to the manufacturer’s instructions. DNA was extracted from 250 µl of the bronchoalveolar lavage fluid containing S. stercoralis using the High Pure DNA template preparation kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions.

Approval for the use of clinical specimens from Bangladesh was obtained from the National Research Ethics Committee, Bangladesh Medical Research Council (BMRC/NREC/2007-2010/1256) (12). Approval for the use of stool specimens from northern Queensland, Australia, was obtained from the Townsville Hospital and Health Service Human Research Ethics Committee (HREC/14/QTHS/4) (22). Approval for the use of clinical specimens from metropolitan Sydney, Australia, was obtained from Human Research Ethics Committee, Sydney West Area Health Service [HREC2014/9/6.3 (4907) QA].

Real-time PCR assay method.

The real-time PCR method used the primers and probe designed by Verweij et al., which target the small subunit rRNA gene, primers Stro18S-1530F (GAATTCCAAGTAAACGTAAGTCATTAGC) and Stro18S-1630R (TGCCTCTGGATATTGCTCAGTTC) and probe Stro18S-1586T (carboxyfluorescein [FAM]-ACACACCGGCCGTCGCTGC-black hole quencher 1 [BHQ1]) (10, 12). The primers and probe were manufactured by Sigma-Aldrich and purified by high-performance liquid chromatography (HPLC). The PCR mixture contained 25 µl of HotStarTaq master mix (catalogue number 203446; Qiagen, Hilden, Germany). The final concentrations of other components of the reaction mixture were 300 nM forward and reverse primers, 200 nM probe, 5 mM MgCl2, and 0.1 mg/ml of bovine serum albumin (BSA) (Promega, Alexandria, Australia). Molecular biology purity H2O and 10 µl of DNA extract (or H2O for nontemplate controls) made up a reaction volume of 50 µl.

The reaction mixture was amplified using a Rotor-Gene 6000 instrument (Corbett Research, Sydney, Australia) with the following protocol: 15 min at 95°C, then 40 cycles of 15 s at 95°C for denaturation, 30 s at 62°C for annealing, and 30 s at 72°C for extension. This was followed by 5 min at 72°C as a final extension and then cooling to room temperature. All PCR products in the study were sequenced using the primers, and, while they did not cover the full target, they matched Strongyloides spp. identified by NCBI blastn analysis.

LAMP assay method.

The LAMP assay used primers which targeted the 28S ribosomal subunit gene: forward outer primer (F3), GTGTAGGCTGGCGTAGT; backward outer primer (B3), TTTCAATTTTAGCTTAGGACC; forward inner composite primer (FIP; F1c-F2), GCTACTATCACCAAGATCTGCAC-GCATTGAAGGTTATAAGCGTAAG; backward inner composite primer (BIP; B1c-B2) ACACAAGTGAGAATCTTGTGGAC-CTAACTCACAGTCAAATGATGT; and loop backward primer (LB), CGAAGTGGAAAAGGGTTTCACG (18). The primers were manufactured by Sigma-Aldrich and purified by HPLC.

The amounts of primers in the reaction mixture were as follows: FIP and BIP, 40 pmol; F3 and B3, 20 pmol; and LB, 20 pmol. The final concentration of other components of the reaction mixture were as follows: ThermoPol buffer [1× dilution consisting of 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 10 mM (NH2)2SO4, 0.1% Triton X-100, 2 mM Mg2SO4; New England Biolabs, Ipswich, MA], 0.8 M betaine, deoxynucleoside triphosphates (dNTPs) 1.4 mM each, 6 mM Mg2SO4, BSA 0.1% (wt/vol), polyvinylpyrrolidone (PVP) 1% (wt/vol), and 15 μM Syto 82 fluorescent dye (Life Technologies, Carlsbad, CA). Initially the mixture was made up to a volume of 19 µl with molecular biology purity H2O, and 5 µl of DNA extract was added, except in the case of nontemplate controls, where an additional 5 µl of H2O was added.

The reaction mixture was then heated to 95°C and allowed to cool to room temperature. Eight units (1 μL) of Bst (large fragment) DNA polymerase (New England Biolabs) were added to each tube, making the total volume of the reaction mixture 25 µl. Tubes were then pulse centrifuged and heated to 60°C for a period of 60 min in a Rotor Gene 6000 instrument (Corbett Research), with an increase in fluorescence, indicative of amplification, detected through the yellow channel (excitation, 530 nm; detection, 555 nm). The mixture was then heated to 95°C for 3 min to inactivate the DNA polymerase. Fluorescence was visible with the naked eye under normal white lighting conditions (18). Reaction products were also visualized using agarose gel electrophoresis and had the characteristic “ladder pattern” (18).

Comparison of PCR and LAMP assays.

The DNA extracts from single S. ratti larva were serially diluted in TE buffer, with 5 replicates made. These were tested with LAMP and PCR to determine the respective limits of detection and to indicate the highest cycle threshold (CT) or longest time to amplification for a known positive specimen.

The stool DNA extracts from Dhaka, Sydney, and Queensland were tested by trained operators who were blind to sample identity. As the comparison was between NAAT, percentage agreements rather than sensitivity and specificity were calculated, in accordance with CLSI and FDA recommendations (26, 27). Score confidence intervals (CI) were calculated using Wilson’s method (27). Comparison was also made between the DNA extracts from serum and bronchoalveolar lavage fluid.

When each PCR and LAMP assay was performed, negative (H2O nontemplate) controls were used, and in the case of clinical specimens, stool spiked with S. ratti were used as positive controls. Results for positive and negative controls were as expected for all reactions. The duration of time between testing particular DNA extracts with the LAMP and PCR assays was less than 2 weeks.

RESULTS

Limits of detection based on Strongyloides ratti larvae spiked into stool.

The maximum limits of detection, median PCR CT values and ranges, and median LAMP reaction times and ranges are listed in Table 1. The maximum limit of detection for PCR was 10 times greater (10−3) than that of the LAMP assay (10−2). PCR was positive for 4 of 5 replicates at 10−2.

TABLE 1.

PCR and LAMP assay limits of detection based on DNA extracted from single Strongyloides ratti L3 larvae spiked into 5 separate stool specimens

Assay result Serial dilution of DNA extracts
Neat 10−1 10−2 10−3 10−4
PCR (no. positive/no. tested) 5/5 5/5 4/5 1/5 0/5
    CTa
        Median 28.39 31.84 35.67 35.83
        Range 3.46 (26.38–29.84) 3.13 (29.84–32.97) 2.45 (34.71–37.16)
LAMP (no. positive/no. tested) 5/5 5/5 1/5 0/5 0/5
    Reaction time (min)
        Median 29 35 44
        Range 19 (27–46) 22 (32–54)
a

CT, cycle threshold.

Clinical stool specimens from Dhaka (Bangladesh), Sydney (Australia), and northern Queensland (Australia).

The results of the comparison between the LAMP and PCR assays using DNA extracted from 396 stool specimens collected in Dhaka, Sydney, and regional northern Queensland are summarized in Tables 2 and 3. The total positive percentage agreement was 77.3% (95% CI, 64.5 to 86.6) and the negative percentage agreement was 100% (95% CI, 98.9 to 100). The median PCR CT values and ranges for the DNA extracts that were also positive using the LAMP assay were lower than the median CT values and ranges for the total number of PCR-positive extracts.

TABLE 2.

Comparison of PCR and LAMP assays using DNA extracts from stool collected in Dhaka (Bangladesh), Sydney (Australia), and northern Queensland (Australia)

LAMP result PCR resulta
Positive
Negative
Total
Dha Syd Qld Dha Syd Qld
Positiveb 11 5 25 0 0 0 41
Negativec 1 1 10 144 15 184 355
Total 53 343 396
a

Dha, Dhaka, Bangladesh; Syd, Sydney, Australia; Qld, northern Queensland, Australia.

b

Total positive percentage agreement, 41/53 = 77.3% (95% score confidence interval [CI] [27], 64.5 to 86.6).

c

Total negative percentage agreement, 343/343 = 100% (95% CI, 98.9 to 100).

TABLE 3.

Median values and ranges for PCR cycle thresholds and LAMP reaction times, using DNA extracts from stool collected in Dhaka (Bangladesh), Sydney (Australia), and northern Queensland (Australia)a

Assay result Total Dha Syd Qld
PCR CTb (total)
    Median 32.31 30.29 24.81 34.11
    Range 21.91 (16.34–38.25) 15.23 (23.02–38.25) 10.41 (20.74–31.16) 20.79 (16.34–37.13)
PCR CT (LAMP+)
    Median 31.24 29.89 23.15 33.09
    Range 20.78 (16.34–37.12) 10.18 (23.03–33.20) 6.12 (20.74–26.86) 20.78 (16.34–37.12)
LAMP reaction time (min)
    Median 31 32 29 29
    Range 41 (16–57) 14 (28–42) 16 (28–44) 41 (16–57)
a

PCR cycle thresholds reported for total positive extracts and LAMP-positive (LAMP+) extracts. Dha, Dhaka, Bangladesh; Syd, Sydney, Australia; Qld, northern Queensland (Australia).

b

CT, cycle threshold.

For the stool specimens collected in Dhaka, the positive percentage agreement was 91.6% (95% CI, 64.6 to 98.5) and the negative percentage agreement was 100% (95% CI, 97.4 to 100). For the stool specimens from Sydney, the positive percentage agreement was 83.3% (95% CI, 43.7 to 97.0) and the negative percentage agreement was 100% (95%, CI 79.6 to 100). For the Queensland stool specimens, the positive percentage agreement was 71.4% (95% CI, 55.0 to 83.7) and the negative percentage agreement was 100% (95% CI, 97.8 to 100).

Detection in serum and bronchoalveolar lavage specimens.

The results of the PCR and LAMP assays on DNA extracted from serum are summarized in Table 4. DNA extracts from the bronchoalveolar lavage fluid were positive by both the PCR and LAMP assays.

TABLE 4.

Strongyloides PCR and LAMP assay results using DNA extracted from serum

Serum Positive microscopy
Negative microscopy stoolb (n = 7)
BAL fluidc (n = 2) Stool (n = 7)
PCR-positive CTd 2 (31.44 and 31.83) 1a (34.53) 0
LAMP positive reaction time (min) 1 (33) 1a (38) 0
a

Positive serum was from the same study participant, who was stool positive by LAMP and PCR (CT, 25.63).

b

Stool microscopy negative study participants were Strongyloides antibody positive, indicating current or past infection.

c

BAL, bronchoalveolar lavage.

d

CT, cycle threshold.

DISCUSSION

The accurate diagnosis and treatment of strongyloidiasis is important for epidemiological reasons, the management of symptoms, and the prevention of complications, including low birth weight in infants and malnutrition (1, 28–30). The screening of patients with risk factors prior to immunosuppression is necessary to prevent hyperinfection (1, 31). Studies that measured the clinical sensitivity of the PCR assay designed by Verweij et al. compared to morphological identification have provided a benchmark for comparison with the LAMP assay (10–15, 17). The PCR and LAMP assays both targeted components of the ribosomal cistron, which is a single transcription unit (32).

In this study, the limit of detection using serial dilutions of extracts from spiked single S. ratti larva was 10−2 for the LAMP assay and 10−3 for the PCR assay. Almost all of the positive stored stool extracts, excluding 1 sample each for the LAMP and PCR assays, fell within the range of CT values or LAMP reaction times that were recorded for the stool specimens spiked with S. ratti larvae. The range of reaction times or CT values for known positive results is necessary for determining result cutoffs, as extended reactions have been associated with false-positive results in PCR and LAMP assays (33–35).

The greater number of positive serially diluted DNA extracts was also associated with a greater number of PCR-positive DNA extracts from Dhaka, Sydney, and northern Queensland, and lower median CT values and ranges for the LAMP-positive extracts. These results indicated that the LAMP assay was less effective, but also raised the possibility that there may have been nonspecific amplification with the PCR primers to account for the difference. However, the PCR and LAMP primers have both been tested for analytical specificity using DNA extracts from a wide range of organisms found in stool, and there was 100% negative agreement between the PCR and LAMP assay in this study (10, 12, 18). While the amplified PCR sequences did not cover the full target, they matched Strongyloides spp. The PCR primers have previously demonstrated a clinical specificity of >85% (10–15). In these studies, if the comparator methods relied on the presence of live larvae, nonviable larvae may lead to a “true positive” PCR result being labeled “false positive” (10).

In a previous study, the Strongyloides LAMP assay was able to detect <10 copies of DNA when a plasmid containing the target sequence was serially diluted in Tris-EDTA (18). This indicated that the reaction had a high analytical sensitivity in controlled circumstances. When diagnostic specimens are used, the decreased limit of detection and lower number of positive specimens may be related to reaction inhibition or increased degradation of the longer LAMP target (184 bp), compared to the PCR target (101 bp) (8, 9, 36, 37). The difference between the positive percentage agreement in stool DNA extracts from Queensland (71.4%) compared to those from Dhaka (91.6%) and Sydney (83.3%) may have been related to the transportation and storage of the stool specimens and the elution of DNA in Tris buffer, rather than in Tris-EDTA, leaving the LAMP target more susceptible to nucleases (38, 39). Other components of stool, tannic and humic acids bound to the DNA template, had a greater inhibitory effect on longer target sequences when investigated using PCR (9). Accordingly, geographical variation in diet and stool composition may also have accounted for some of the difference in percentage agreement between the stool extracts (8, 40). Due to low volumes of the stored DNA extracts, it was not possible to determine if extract dilution would reduce the effect of inhibitors (8, 18). Repeated freeze-thawing and bead beating can fragment DNA, but these processes have less impact on sequences as short as the targets of both assays (36, 37). While the PowerSoil DNA isolation kit extraction method utilizes bead beating, it was an effective method for Strongyloides DNA extraction in a previous comparison, leading to high analytical sensitivity (12). If the amount of target DNA is close to the assay limit of detection, the effects of sampling error, inhibitors, and DNA degradation may lead to a negative result (8). The efficiency of a Salmonella enterica serovar Typhi LAMP assay was reportedly unaffected by the addition of 1 µl of decanted feces into a reaction volume of 25 µl; however, a relatively large amount of target DNA (1,000 copies) was used in the study (41).

DNA degradation would be mitigated by DNA extraction as close to the time of specimen collection as possible and by DNA elution in Tris-EDTA. Where there will be a delay in DNA extraction, the use of ethanol or transport buffers to stabilize DNA may minimize degradation (17, 42–44). A shorter duration of bead beating may also reduce DNA fragmentation. The limit of detection of the LAMP assay using S. ratti larvae spiked into stool also reflects the capacity of DNA extraction methods to remove reaction inhibitors (12). If an effective extraction method could be incorporated into the Strongyloides assay, like those in the LAMP assays for Mycobacterium tuberculosis and influenza virus, this would simplify the assay and facilitate its use in resource-limited settings (20). The primers that were used in the Strongyloides LAMP assay were designed with a comparatively short target sequence (with 5 primers), and the options for primer sets were limited by the AT-rich genome (18, 45). The primers were found to be specific (18) compared to trial primer sets that also amplified Candida parapsilosis DNA despite specificity in silico (unpublished data).

The process of preheating the reaction mixture and extract to 95°C prior to the addition of DNA polymerase increases the sensitivity of the LAMP assay (18, 46). A homologue of Bst (large fragment) DNA polymerase, Bst 3.0 (catalogue number M374S; New England Biolabs) has been reported to have good performance in whole blood despite polymerase inhibitors (47). While this is yet to be compared with standard Bst (large fragment) using stool extracts, there may be benefit to its use. Lyophilization may not necessarily increase assay sensitivity, but it can contribute to the stability of reagents and facilitate diagnostics in settings where resources are limited (48, 49). Syto 82 intercalating dye is an effective means of detecting amplified DNA without the need to open the reaction tube, minimizing the risk of contamination (18, 50, 51). Based on previous data, a lower concentration of Syto 82 (<15 µM) could be used to visually detect target amplification while increasing reaction efficiency (18). Amplicon detection methods, such as hybridization probes, may improve assay specificity with high analytical sensitivity (52, 53). Multiplexed LAMP assays for stool pathogens could include primers that target internal control DNA (8, 52, 53). These could be used to identify reaction inhibition and improve quality assurance.

Strongyloides DNA has previously been detected in urine, and we detected DNA in the sera of 2 patients with hyperinfection and another person with a comparatively low CT (25.63) on stool PCR (19, 54). These preliminary results indicate that the diagnosis of strongyloidiasis on the basis of serum NAAT would be relatively insensitive but may be useful if stool is not available due to paralytic ileus. The detection of DNA in bronchoalveolar lavage fluid was expected, considering the visible larvae on microscopy, and further investigation will be required to determine the sensitivity of NAAT in respiratory secretions.

Operators were blind to sample identity, except when testing the bronchoalveolar and serum specimens from the 2 patients known to have Strongyloides hyperinfection. While the study used stored material with selective sampling and was not designed to calculate clinical sensitivity and specificity, it identified the need for further optimization of the Strongyloides LAMP assay prior to a field trial (26, 27).

The potential for low numbers of larvae in stool requires that NAAT for Strongyloides are highly sensitive. While not as effective as PCR in this study, the ease of use of LAMP assays is suited to the diagnosis of strongyloidiasis, and further research and development would be valuable. The NAAT detection of Strongyloides in non-stool specimens may be clinically useful, and additional study is warranted.

ACKNOWLEDGMENTS

M.R.W. designed, planned and performed experimental work, and wrote and revised the manuscript. R.K. and V.A. performed experimental work and edited the manuscript. G.J.R., Y.S., M.W., and R.S.B. provided samples for experimental work and edited the manuscript. G.L.G. and R.L. supervised experimental work, secured funding, and edited the manuscript.

R.S.B. coauthored the manuscript in his personal capacity and in his capacity as an adjunct academic at Central Queensland University.

We gratefully acknowledge Pam Konecny, Nicole Gilroy, Robert Stevens, Peter Taylor, Jan Williamson, and staff of the Centre for Infectious Diseases and Microbiology, Institute for Clinical Pathology and Medical Research–New South Wales Health Pathology, Westmead Hospital, for their assistance with sample collection.

This project was funded by the Centre for Infectious Diseases and Microbiology Public Health, Institute for Clinical Pathology and Medical Research–New South Wales Health Pathology, Westmead Hospital. The National Health and Medical Research Council, Commonwealth of Australia, provided funding to M.R.W. through a Postgraduate Research Scholarship (GNT1040002).

We have no conflicts of interest to declare.

REFERENCES

  • 1.Nutman TB. 2017. Human infection with Strongyloides stercoralis and other related Strongyloides species. Parasitology 144:263–273. doi: 10.1017/S0031182016000834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bisoffi Z, Buonfrate D, Montresor A, Requena-Mendez A, Munoz J, Krolewiecki AJ, Gotuzzo E, Mena MA, Chiodini PL, Anselmi M, Moreira J, Albonico M. 2013. Strongyloides stercoralis: a plea for action. PLoS Negl Trop Dis 7:e2214. doi: 10.1371/journal.pntd.0002214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Tanaka T, Hirata T, Parrott G, Higashiarakawa M, Kinjo T, Kinjo T, Hokama A, Fujita J. 2016. Relationship among Strongyloides stercoralis infection, human T-cell lymphotropic virus type 1 infection, and cancer: a 24-year cohort inpatient study in Okinawa, Japan. Am J Trop Med Hyg 94:365–370. doi: 10.4269/ajtmh.15-0556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Watts MR, Robertson G, Bradbury RS. 2016. The laboratory diagnosis of Strongyloides stercoralis. Microbiol Aust 27:4–9. [Google Scholar]
  • 5.Schaffel R, Nucci M, Carvalho E, Braga M, Almeida L, Portugal R, Pulcheri W. 2001. The value of an immunoenzymatic test (enzyme-linked immunosorbent assay) for the diagnosis of strongyloidiasis in patients immunosuppressed by hematologic malignancies. Am J Trop Med Hyg 65:346–350. doi: 10.4269/ajtmh.2001.65.346. [DOI] [PubMed] [Google Scholar]
  • 6.Bisoffi Z, Buonfrate D, Sequi M, Mejia R, Cimino RO, Krolewiecki AJ, Albonico M, Gobbo M, Bonafini S, Angheben A, Requena-Mendez A, Muñoz J, Nutman TB. 2014. Diagnostic accuracy of five serologic tests for Strongyloides stercoralis infection. PLoS Negl Trop Dis 8:e2640. doi: 10.1371/journal.pntd.0002640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Shiwaku K, Chigusa Y, Kadosaka T, Kaneko K. 1988. Factors influencing development of free-living generations of Strongyloides stercoralis. Parasitology 97:129–138. doi: 10.1017/S0031182000066804. [DOI] [PubMed] [Google Scholar]
  • 8.Schrader C, Schielke A, Ellerbroek L, Johne R. 2012. PCR inhibitors—occurrence, properties and removal. J Appl Microbiol 113:1014–1026. doi: 10.1111/j.1365-2672.2012.05384.x. [DOI] [PubMed] [Google Scholar]
  • 9.Opel KL, Chung D, McCord BR. 2010. A study of PCR inhibition mechanisms using real time PCR. J Forensic Sci 55:25–33. doi: 10.1111/j.1556-4029.2009.01245.x. [DOI] [PubMed] [Google Scholar]
  • 10.Verweij JJ, Canales M, Polman K, Ziem J, Brienen EA, Polderman AM, van Lieshout L. 2009. Molecular diagnosis of Strongyloides stercoralis in faecal samples using real-time PCR. Trans R Soc Trop Med Hyg 103:342–346. doi: 10.1016/j.trstmh.2008.12.001. [DOI] [PubMed] [Google Scholar]
  • 11.Schar F, Odermatt P, Khieu V, Panning M, Duong S, Muth S, Marti H, Kramme S. 2013. Evaluation of real-time PCR for Strongyloides stercoralis and hookworm as diagnostic tool in asymptomatic schoolchildren in Cambodia. Acta Trop 126:89–92. doi: 10.1016/j.actatropica.2012.12.012. [DOI] [PubMed] [Google Scholar]
  • 12.Sultana Y, Jeoffreys N, Watts MR, Gilbert GL, Lee R. 2013. Real-time polymerase chain reaction for detection of Strongyloides stercoralis in stool. Am J Trop Med Hyg 88:1048–1051. doi: 10.4269/ajtmh.12-0437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Sitta RB, Malta FM, Pinho JR, Chieffi PP, Gryschek RC, Paula FM. 2014. Conventional PCR for molecular diagnosis of human strongyloidiasis. Parasitology 141:716–721. doi: 10.1017/S0031182013002035. [DOI] [PubMed] [Google Scholar]
  • 14.Saugar JM, Merino FJ, Martín-Rabadán P, Fernández-Soto P, Ortega S, Gárate T, Rodríguez E. 2015. Application of real-time PCR for the detection of Strongyloides spp. in clinical samples in a reference center in Spain. Acta Trop 142:20–25. doi: 10.1016/j.actatropica.2014.10.020. [DOI] [PubMed] [Google Scholar]
  • 15.Paula FM, Malta FM, Marques PD, Sitta RB, Pinho JRR, Gryschek RCB, Chieffi PP. 2015. Molecular diagnosis of strongyloidiasis in tropical areas: a comparison of conventional and real-time polymerase chain reaction with parasitological methods. Mem Inst Oswaldo Cruz 110:272–274. doi: 10.1590/0074-02760140371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Buonfrate D, Requena-Mendez A, Angheben A, Cinquini M, Cruciani M, Fittipaldo A, Giorli G, Gobbi F, Piubelli C, Bisoffi Z. 2018. Accuracy of molecular biology techniques for the diagnosis of Strongyloides stercoralis infection—a systematic review and meta-analysis. PLoS Negl Trop Dis 12:e0006229. doi: 10.1371/journal.pntd.0006229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Meurs L, Polderman AM, Vinkeles Melchers NV, Brienen EA, Verweij JJ, Groosjohan B, Mendes F, Mechendura M, Hepp DH, Langenberg MC, Edelenbosch R, Polman K, van Lieshout L. 2017. Diagnosing polyparasitism in a high-prevalence setting in Beira, Mozambique: detection of intestinal parasites in fecal samples by microscopy and real-time PCR. PLoS Negl Trop Dis 11:e0005310. doi: 10.1371/journal.pntd.0005310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Watts MR, James G, Sultana Y, Ginn AN, Outhred AC, Kong F, Verweij JJ, Iredell JR, Chen SC, Lee R. 2014. A loop-mediated isothermal amplification (LAMP) assay for Strongyloides stercoralis in stool that uses a visual detection method with SYTO-82 fluorescent dye. Am J Trop Med Hyg 90:306–311. doi: 10.4269/ajtmh.13-0583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Fernandez-Soto P, Sanchez-Hernandez A, Gandasegui J, Bajo Santos C, Lopez-Aban J, Saugar JM, Rodriguez E, Vicente B, Muro A. 2016. Strong-LAMP: a LAMP assay for Strongyloides spp. detection in stool and urine samples. towards the diagnosis of human strongyloidiasis starting from a rodent model. PLoS Negl Trop Dis 10:e0004836. doi: 10.1371/journal.pntd.0004836. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Notomi T, Mori Y, Tomita N, Kanda H. 2015. Loop-mediated isothermal amplification (LAMP): principle, features, and future prospects. J Microbiol 53:1–5. doi: 10.1007/s12275-015-4656-9. [DOI] [PubMed] [Google Scholar]
  • 21.Yan L, Xiao H, Zhang Q. 2016. Systematic review: comparison of Xpert MTB/RIF, LAMP and SAT methods for the diagnosis of pulmonary tuberculosis. Tuberculosis (Edinb) 96:75–86. doi: 10.1016/j.tube.2015.11.005. [DOI] [PubMed] [Google Scholar]
  • 22.Robertson GJ, Koehler AV, Gasser RB, Watts MR, Norton R, Bradbury RS. 2017. Application of PCR-based tools to explore Strongyloides infection in people in parts of Northern Australia. Trop Med Infect Dis 2:E62. doi: 10.3390/tropicalmed2040062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Garcia LS. 2016. Diagnostic medical parasitology, 6th ed ASM Press, Washington, DC. [Google Scholar]
  • 24.Sultana Y, Gilbert GL, Ahmed BN, Lee R. 2012. Strongyloidiasis in a high risk community of Dhaka, Bangladesh. Trans R Soc Trop Med Hyg 106:756–762. doi: 10.1016/j.trstmh.2012.08.011. [DOI] [PubMed] [Google Scholar]
  • 25.Konecny P, Weatherall CJ, Adhikari SA, Duflou J, Marjoniemi V, Pretorius CJ, McWhinney B. 2018. Case report: subcutaneous ivermectin pharmacokinetics in disseminated Strongyloides infection: plasma and postmortem analysis. Am J Trop Med Hyg 99:1580–1582. doi: 10.4269/ajtmh.18-0387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.U.S. Food and Drug Administration Center for Devices and Radiological Health. 2007. Statistical guidance on reporting results from studies evaluating diagnostic tests—guidance for industry and FDA staff. U.S. FDA Center for Devices and Radiological Health, Silver Spring, MD: https://www.fda.gov/RegulatoryInformation/Guidances/ucm071148.htm. [Google Scholar]
  • 27.CLSI. 2008. User protocol for evaluation of qualitative test performance; approved guideline, 2nd ed CLSI document EP12-A2 CLSI, Wayne, PA. [Google Scholar]
  • 28.Mangklabruks A, Rerkasem A, Wongthanee A, Rerkasem K, Chiowanich P, Sritara P, Pruenglampoo S, Yipintsoi T, Tongsong T, Marshall T, Tantiprabha W. 2012. The risk factors of low birth weight infants in the northern part of Thailand. J Med Assoc Thai 95:358–365. [PubMed] [Google Scholar]
  • 29.Dreyfuss ML, Msamanga GI, Spiegelman D, Hunter DJ, Urassa EJN, Hertzmark E, Fawzi WW. 2001. Determinants of low birth weight among HIV-infected pregnant women in Tanzania. Am J Clin Nutr 74:814–826. doi: 10.1093/ajcn/74.6.814. [DOI] [PubMed] [Google Scholar]
  • 30.Stephenson LS, Latham MC, Ottesen EA. 2000. Malnutrition and parasitic helminth infections. Parasitology 121:S23–S38. doi: 10.1017/S0031182000006491. [DOI] [PubMed] [Google Scholar]
  • 31.Roxby AC, Gottlieb GS, Limaye AP. 2009. Strongyloidiasis in transplant patients. Clin Infect Dis 49:1411–1423. doi: 10.1086/630201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Torres-Machorro AL, Hernández R, Cevallos AM, López-Villaseñor I. 2010. Ribosomal RNA genes in eukaryotic microorganisms: witnesses of phylogeny? FEMS Microbiol Rev 34:59–86. doi: 10.1111/j.1574-6976.2009.00196.x. [DOI] [PubMed] [Google Scholar]
  • 33.Caraguel CG, Stryhn H, Gagne N, Dohoo IR, Hammell KL. 2011. Selection of a cutoff value for real-time polymerase chain reaction results to fit a diagnostic purpose: analytical and epidemiologic approaches. J Vet Diagn Invest 23:2–15. doi: 10.1177/104063871102300102. [DOI] [PubMed] [Google Scholar]
  • 34.Kimura Y, de Hoon MJ, Aoki S, Ishizu Y, Kawai Y, Kogo Y, Daub CO, Lezhava A, Arner E, Hayashizaki Y. 2011. Optimization of turn-back primers in isothermal amplification. Nucleic Acids Res 39:e59. doi: 10.1093/nar/gkr041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Lee D, La Mura M, Allnutt TR, Powell W. 2009. Detection of genetically modified organisms (GMOs) using isothermal amplification of target DNA sequences. BMC Biotechnol 9:7. doi: 10.1186/1472-6750-9-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Rossmanith P, Roder B, Fruhwirth K, Vogl C, Wagner M. 2011. Mechanisms of degradation of DNA standards for calibration function during storage. Appl Microbiol Biotechnol 89:407–417. doi: 10.1007/s00253-010-2943-2. [DOI] [PubMed] [Google Scholar]
  • 37.Miller DN, Bryant JE, Madsen EL, Ghiorse WC. 1999. Evaluation and optimization of DNA extraction and purification procedures for soil and sediment samples. Appl Environ Microbiol 65:4715–4724. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Barra GB, Santa Rita TH, de Almeida Vasques J, Chianca CF, Nery LF, Santana Soares Costa S. 2015. EDTA-mediated inhibition of DNases protects circulating cell-free DNA from ex vivo degradation in blood samples. Clin Biochem 48:976–981. doi: 10.1016/j.clinbiochem.2015.02.014. [DOI] [PubMed] [Google Scholar]
  • 39.Yagi N, Satonaka K, Horio M, Shimogaki H, Tokuda Y, Maeda S. 1996. The role of DNase and EDTA on DNA degradation in formaldehyde fixed tissues. Biotech Histochem 71:123–129. doi: 10.3109/10520299609117148. [DOI] [PubMed] [Google Scholar]
  • 40.Gupta VK, Paul S, Dutta C. 2017. Geography, ethnicity or subsistence-specific variations in human microbiome composition and diversity. Front Microbiol 8:1162. doi: 10.3389/fmicb.2017.01162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Francois P, Tangomo M, Hibbs J, Bonetti EJ, Boehme CC, Notomi T, Perkins MD, Schrenzel J. 2011. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. FEMS Immunol Med Microbiol 62:41–48. doi: 10.1111/j.1574-695X.2011.00785.x. [DOI] [PubMed] [Google Scholar]
  • 42.Zou H, Harrington JJ, Klatt KK, Ahlquist DA. 2006. A sensitive method to quantify human long DNA in stool: relevance to colorectal cancer screening. Cancer Epidemiol Biomarkers Prev 15:1115–1119. doi: 10.1158/1055-9965.EPI-05-0992. [DOI] [PubMed] [Google Scholar]
  • 43.Mathay C, Hamot G, Henry E, Georges L, Bellora C, Lebrun L, de Witt B, Ammerlaan W, Buschart A, Wilmes P, Betsou F. 2015. Method optimization for fecal sample collection and fecal DNA extraction. Biopreserv Biobank 13:79–93. doi: 10.1089/bio.2014.0031. [DOI] [PubMed] [Google Scholar]
  • 44.Beknazarova M, Millsteed S, Robertson G, Whiley H, Ross K. 2017. Validation of DESS as a DNA preservation method for the detection of Strongyloides spp. in canine feces. Int J Environ Res Public Health 14:E624. doi: 10.3390/ijerph14060624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Hunt VL, Tsai IJ, Coghlan A, Reid AJ, Holroyd N, Foth BJ, Tracey A, Cotton JA, Stanley EJ, Beasley H, Bennett HM, Brooks K, Harsha B, Kajitani R, Kulkarni A, Harbecke D, Nagayasu E, Nichol S, Ogura Y, Quail MA, Randle N, Xia D, Brattig NW, Soblik H, Ribeiro DM, Sanchez-Flores A, Hayashi T, Itoh T, Denver DR, Grant W, Stoltzfus JD, Lok JB, Murayama H, Wastling J, Streit A, Kikuchi T, Viney M, Berriman M. 2016. The genomic basis of parasitism in the Strongyloides clade of nematodes. Nat Genet 48:299–307. doi: 10.1038/ng.3495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Wang DG, Brewster JD, Paul M, Tomasula PM. 2015. Two methods for increased specificity and sensitivity in loop-mediated isothermal amplification. Molecules (Basel, Switzerland) 20:6048–6059. doi: 10.3390/molecules20046048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Lee D, Shin Y, Chung S, Hwang KS, Yoon DS, Lee JH. 2016. Simple and highly sensitive molecular diagnosis of Zika virus by lateral flow assays. Anal Chem 88:12272–12278. doi: 10.1021/acs.analchem.6b03460. [DOI] [PubMed] [Google Scholar]
  • 48.Carter C, Akrami K, Hall D, Smith D, Aronoff-Spencer E. 2017. Lyophilized visually readable loop-mediated isothermal reverse transcriptase nucleic acid amplification test for detection Ebola Zaire RNA. J Virol Methods 244:32–38. doi: 10.1016/j.jviromet.2017.02.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Howson ELA, Armson B, Madi M, Kasanga CJ, Kandusi S, Sallu R, Chepkwony E, Siddle A, Martin P, Wood J, Mioulet V, King DP, Lembo T, Cleaveland S, Fowler VL. 2017. Evaluation of two lyophilized molecular assays to rapidly detect foot-and-mouth disease virus directly from clinical samples in field settings. Transbound Emerg Dis 64:861–871. doi: 10.1111/tbed.12451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Oscorbin IP, Belousova EA, Zakabunin AI, Boyarskikh UA, Filipenko ML. 2016. Comparison of fluorescent intercalating dyes for quantitative loop-mediated isothermal amplification (qLAMP). Biotechniques 61:20–25. doi: 10.2144/000114432. [DOI] [PubMed] [Google Scholar]
  • 51.Ahmad F, Seyrig G, Tourlousse DM, Stedtfeld RD, Tiedje JM, Hashsham SA. 2011. A CCD-based fluorescence imaging system for real-time loop-mediated isothermal amplification-based rapid and sensitive detection of waterborne pathogens on microchips. Biomed Microdevices 13:929–937. doi: 10.1007/s10544-011-9562-2. [DOI] [PubMed] [Google Scholar]
  • 52.Jiang YS, Riedel TE, Popoola JA, Morrow BR, Cai S, Ellington AD, Bhadra S. 2018. Portable platform for rapid in-field identification of human fecal pollution in water. Water Res 131:186–195. doi: 10.1016/j.watres.2017.12.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Mauk MG, Song J, Liu C, Bau HH. 2018. Simple approaches to minimally-instrumented, microfluidic-based point-of-care nucleic acid amplification tests. Biosensors 8:E17. doi: 10.3390/bios8010017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Lodh N, Caro R, Sofer S, Scott A, Krolewiecki A, Shiff C. 2016. Diagnosis of Strongyloides stercoralis: detection of parasite-derived DNA in urine. Acta Trop 163:9–13. doi: 10.1016/j.actatropica.2016.07.014. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES