Abstract
The aim of this study was to identify and characterize laccase genes produced by Trametes hirsuta Bm-2 in a liquid medium, both with and without induction. The amplification of 5′and 3′regions of laccase sequences was obtained by the RACE-PCR method, and these were assembled to obtain a cDNA of total length. Two new laccase genes were isolated from basal medium (lac-B) and lignocellulosic grapefruit substrate (lac-T), both encoding open reading frames of 2566 bp. Both laccase-predicted proteins consisted of 521 amino acids, four copper-binding regions, a signal peptide, and five potential glycosilation sites (Asn-Xaa-Ser/Tre). Moreover, the deduced amino acid sequences share about 76–85% identity with other laccases of WRF. Sequence comparison showed 47 synonymous point mutations between lac-B and lac-T. In addition, 5′ untranslated regions (UTR) of laccase genes lac-B and lac-T showed differences in length and number of regulatory elements that may affect transcriptional or translational expression of these genes.
Keywords: Trametes hirsuta, Laccase genes, RACE-PCR, Untranslated regions
Introduction
Laccases (benzenediol: oxygen oxidoreductase, EC 1.10.3.2) are multicopper glycoenzymes produced by a large number of plants, fungi, insects, bacteria, and archaea (Givaudan et al. 1993; Brijwani et al. 2010; Uthandi et al. 2010; Kandasamy et al. 2016). Among these organisms, white rot fungi (WRF) are the only ones capable of efficiently degrading lignin due to the secretion of ligninolytic enzymes such as laccases. These enzymes catalyze the four-electron reduction of molecular oxygen to H2O (Thurston 1994).
Many WRF produce multiple laccase enzymes which are encoded by gene families (Wang et al. 2015). For example, from the whole genome of Flammulina velutipes, twelve putative laccase genes fvLac1–12 have been detected (Kim et al. 2014); isoenzyme genes of Pleurotus ostreatus include pox11, pox3, pox4, poxc, poxaa, and poxa1b (Park et al. 2014); and Teerapatsakul et al. found five laccases named KULac1–5 produced by a new strain Ganoderma sp. KU-Alk 4 (Teerapatsakul et al. 2007).
Laccase isoenzymes show different properties related with substrate specificity, optimum pH and temperature. They oxidize a wide range of diverse phenolic compounds including mono-di-phenols, polyphenols, diamines, and recalcitrant compounds, which affect the environment (Kim et al. 2013). Isoenzyme expression is affected by different environmental conditions, i.e., induction by phenols (Terrón et al. 2004), lignocellulosic substrates (Park et al. 2014), and metals such as copper (Vasina et al. 2015). Moreover, posttranscriptional processes (generally glycosylation) could modify each isoenzyme (Morozova et al. 2007). Due to their multiplicity and broad range of specificity, laccases play an important role in several biological functions. They are involved in lignin synthesis (Baldrian 2006), fruiting body and mycelial development (Jin et al. 2018), pigment synthesis, and plant pathogenesis (Feng et al. 2015); however, the biological functions of many laccases remain unknown.
There is great potential concerning the use of laccases, ranging from textile dye colorization, food industry pulp delignification, and removal of phenols from wines, to uses in the pulp and paper industry, synthesis of medical compounds, and the design of biosensors (Kunamneni et al. 2008; Asgher et al. 2014; Viswanath et al. 2014; Palanisamy et al. 2017). The most important obstacles in laccase application are low concentrations of enzyme produced and low stability. In addition, the isoenzyme profile and properties should be considered for particular applications.
Many laccase genes have been isolated and characterized in Trametes villosa, T. versicolor, Rhizoctonia solani, Pleurotus eryngii, Phanerochaete chrysosporium, P. flavido-alba, and Coriolus hirsute (Viswanath et al. 2014). Laccase levels have been improved by cloning, expression and secretion in heterologous hosts like Pichia pastoris (Wang et al. 2015), Saccharomyces cerevisiae (Bulter et al. 2003), Yarrowia lipolytica (Kalyani et al. 2015), and Aspergillus niger (Téllez-Jurado et al. 2006), but the yields are not high enough yet. Thus, more research of genes including from novel endemic white rot fungi, and the development of advanced expression vectors are necessary.
Trametes hirsuta Bm-2 was isolated from wood decay in the Yucatan Peninsula, Mexico (Tapia-Tussell et al. 2011). This fungus increased extracellular laccase activity eightfold when it was grown on a medium induced with agro-industrial substrates, compared to the basal medium. Furthermore, three laccases were purified and characterized from this strain. These enzymes showed high resistance to organic solvents, thermostability, and an ability to decolorize synthetic dyes and textile effluents (Zapata-Castillo et al. 2015). The present study was carried out to elucidate the molecular characteristics of laccase genes of T. hirsuta Bm-2, produced on basal medium and media supplemented with grapefruit peel as inducer.
Materials and methods
Fungal strain, media, and culture conditions
Trametes hirsuta strain Bm-2 (GQ280373.1), was isolated from decaying wood in Yucatan, Mexico (Tapia-Tussell et al. 2011), and used throughout this work. The strain was grown in two culture media: (1) Kirk´s liquid basal medium (BM) pH 6, which consists of 10 g glucose, 5 g ammonium tartrate, 0.2 g MgSO4·7H2O, 2 g KH2PO4, 0.1 g CaCl2·2H2O, 1 mg thiamine, and 10 mL trace compound solution, without Tween 20 or veratryl alcohol (Kirk et al. 1986); and (2) A medium enriched with grapefruit peel (GM) was (g/L): glucose, 2; malt extract, 15; (NH4)2SO4, 0.9; KH2PO4, 2; MgSO4∙7H2O, 0.5; CaCl2 2H2O, 0.1; thiamine-HCl, 1 mg/L and 3% (w/v) of grapefruit peel. 250 mL Erlenmeyer flasks containing 50 mL of each medium were inoculated with 1 mL of cell suspensions, produced in accordance with (Zapata-Castillo et al. 2012). Flasks were incubated at 35 °C and shaken at 150 rpm.
Extraction of total RNA
After 7 days, mycelia were harvested from the liquid culture by vacuum filtration, and frozen in liquid nitrogen. The total RNA was extracted in accordance with the TRIzol™ procedure (Invitrogen, Carlsbad, CA, USA). RNA quantification was measured at 260 nm with a UV–Vis spectrophotometer (NanoDrop 2000, Thermo Scientific™, Waltham, MA, USA). The RNA integrity was visualized in 0.8% (w/v) agarose gel electrophoresis prepared in 1× Tris–Borate-EDTA buffer (0.9 M Tris–borate pH 8; 20 mM EDTA) and stained with ethidium bromide. The analysis was performed with a UVP BioImaging System (UVP. Inc., Upland, CA, USA) using Lab Works 4.0 software.
Cloning of full-length cDNA of laccase genes by 5′/3′ RACE
cDNA synthesis was performed using 1 μg of total RNA as a template with SMARTer® RACE 5′/3′ Kit (Clontech, CA, USA) following the manufacturer’s instructions. Gene-specific primers (GSPs) for 5′ and 3′ RACE were designed (Table 1). The amplified PCR products were purified from agarose gel using the NucleoSpin Gel and PCR Clean-Up kit (Clontech, EE.UU) and cloned into the pUC19 vector in fusion HD cloning kit (Clontech, EE.UU). DNA inserts were sequenced at Macrogen (Seoul, South Korea).
Table 1.
Primers sequences of RACE-PCR for amplification of laccase genes
| 5′ RACE | 3′ RACE |
|---|---|
| RACE adopter primer | RACE adopter primer |
| Outer UPM long: CTAATACGACTCACTATAGGGCAAGCAGTGGTATCACGCAGAGT Inner UPM short: CTAATACGACTCACTATAGGGC |
UPM long: CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT Inner UPM short: CTAATACGACTCACTATAGGGC |
|
Gene-specific primer lacSP R1: CGCTTGATCGGTCGCGGTGAAGTCGTAG lacSP R2: GCATTGGTTCACGAAGGCGGGGCC |
Gene-specific primer lacSP F1: CAGAAGGGGACTAACTGGGCTGACGGCC lacSP F2: AACCAATGCCCGATTGCCACCGGAAAC |
Bioinformatics analysis
The predicted amino acid sequences were aligned with the MUSCLE algorithm, (Edgar 2004). The identity percentages of T. hirsuta Bm-2 amino acid sequence with other laccase sequences were calculated using the BLAST algorithm, at NCBI (http://www.ncbi.nlm.nih.gov/BLAST) (Altschul et al. 1997). The phylogenetic tree was built using the Maximum Likelihood Method, implemented in MEGA 7.0 (Kumar et al. 2016). The support for the branches was evaluated using the bootstrapping method with 1000 replicates.
The signal peptide was predicted using SignalP 4.0 (Nielsen 2017) and the glycosylation sites with NetNGlyc 1.0 (Gupta and Brunak 2001). The hairpins and potential IRES sites were identified with the IRESPred webserver (Kolekar et al. 2016). For the G-quadruplex structures, the Q-GRS Mapper program was used (Kikin et al. 2006).
Results and discussion
Laccases are multi-copper enzymes, present in families of genes, mostly in basidiomycete fungi, and various factors, such as the carbon source, regulate their expression (Wang et al. 2015). In this study, we analyzed the structure of two laccase genes expressed in a basal medium and in a medium enriched with a lignocellulosic agro-industrial residue (grapefruit peel).
For isolation of laccase genes from T. hirsuta Bm-2, the 5′/3′ RACE-PCR technique was utilized, using total RNA as a template, and the specific primers designed from the copper-binding sites I and II (Table 1).
The 5′/3′ RACE-PCR amplification products were sequenced and assembled to obtain two cDNA full-length sequences, 2277 bp and 2339 bp, which were named lac-B (basal medium) and lac-T (grapefruit peel medium), respectively. These genes are in the size range of the laccase genes (1800–2400 bp) reported by Zhou et al. (2014) and Vasina et al. (2015).
The complete sequences for lac-B and lac-T genes are shown in Figs. 1 and 2, respectively. Both sequences presented the same open reading frame size (ORF) of 1566 bp, where 47 single nucleotide polymorphisms were identified between lac-B and lac-T sequences; all these mutations are synonymous, and therefore did not alter the encoded protein.
Fig. 1.
Nucleotide and amino acid sequence of the lac-B gene. The secretion peptide is double underlined, the potential sites of N-glycosylation are shown in boxes, and the four-conserved laccase domains are underlined. An asterisk shows the stop codon. The nucleotides are differentiated with respect to the sequence of the lac-T gene
Fig. 2.
Nucleotide and amino acid sequence of the lac-T gene. The secretion peptide is double underlined, the potential sites of N-glycosylation are shown in boxes, and the four-conserved laccase domains are underlined. An asterisk indicates the stop codon. Highlights show the different nucleotides with respect to the sequence of the lac-B gene
The ORF sizes reported in our study are in the range of the lacA–lacE genes of T. hirsuta strain 072 and coincide with the size of lac C (Table 2) (Vasina et al. 2015). The putative protein of both sequences of 521 amino acid residues contains a secretion signal of 23 amino acids (MRDLTLLRAATAAFLSFGAPALA). The size of the signal peptide varies in the fungal laccases, as is the case of laccases lac1-lac8 from Cerrena sp. HYB07, which have signal peptides in the range of 18–21 amino acids (Yang et al. 2016). While Wang et al. 2015 reported a signal peptide of 23 amino acids for lac4, lac5, and lac11 of F. velutipes.
Table 2.
Properties of identified cDNA and predicted protein sequences for laccases from strain Bm-2 of T. hirsute
| Gene | Full-length cDNA (bp) |
5′UTR (bp) | 3′UTR (bp) | ORF (bp) | Predicted amino acid sequence Length MW pI |
Potential N-glycosylation sites | GenBank accession no. | References |
|---|---|---|---|---|---|---|---|---|
| lacB | 2277 | 441 | 267 | 1566 | 521 56.6 6.1 | 5 | MK159302 | In this work |
| lacT | 2339 | 503 | 267 | 1566 | 521 56.6 6.1 | 5 | MK159303 | In this work |
| lacA | 1811 | 63 | 170 | 1563 | 520 55.9 5.06 | 8 | KP027478 | Vasina et al. (2015) |
| lacB | 1846 | 65 | 192 | 1563 | 520 56.2 6.21 | 6 | KP027484 | Vasina et al. (2015) |
| lacC | 1858 | 80 | 197 | 1566 | 521 55.6 4.40 | 11 | KP027479 | Vasina et al. (2015) |
| lacD | 1837 | 45 | 205 | 1572 | 523 57.6 5.72 | 10 | KP027480 | Vasina et al. (2015) |
| lacE | 1742 | 68 | 99 | 1560 | 519 58.7 6.17 | 6 | KP027481 | Vasina et al. (2015) |
In silico analysis of the potential N-glycosylation sites for laccases of T. hirsuta Bm-2 showed five sites at positions Asn-74, Asn-204, Asn-240, Asn-356, and Asn-458 (Figs. 1 and 2), unlike the laccase GwLAC1 of Ganoderma weberianum TZC-1, which has seven glycosylation sites, three of which coincide with those reported in this work (Asn-75, Asn-355, and Asn-458) (Zhou et al. 2014). Laccases are glycoproteins that have a wide range of glycosylation, between 10 and 25% (Kim et al. 2013). The post-translational modification, by protein glycosylation, is responsible for the structural stability of the enzyme, and protects it from proteolysis and inactivation by free radicals (Vite-Vallejo et al. 2009).
The alignment of the amino acid sequence of the laccase of T. hirsuta Bm-2 (Fig. 3) with other fungal laccases revealed that T. hirsuta Bm-2 laccase has the four typical conserved copper-binding domains: L1 (HWHGFFQ), L2 (HSHLSTQ), L3 (HPFHLHG), and L4 (HCHIDFHL). We also observed ten conserved residues of histidine and a cysteine residue which are located in the signature sequences specific to fungal laccases L1–L4 (Kumar et al. 2003). It is important to note that Bm-2 laccases share a high degree of identity, between 76 and 85%, with the laccases of T. villosa, T. versicolor and other strains of T. hirsuta.
Fig. 3.
Alignment of the amino acid sequence of laccase genes of T. hirsuta Bm-2 and other ligninolytic fungi. The identical residuals are shown with asterisks. The four-conserved laccase domains are indicated in boxes
Phylogenetic relationship analysis between lac-B and lac-T genes of T. hirsuta Bm-2 and other fungal laccases genes is shown in Fig. 4. These results confirm that lac-B and lac-T genes form an independent clade with a 100% branch support. This clade is grouped together with the sub-clade where laccase genes of T. versicolor are located, with a branch support between 99 and 100%.
Fig. 4.
Phylogenetic relationship of laccase genes of Trametes hirsuta Bm-2 with other laccase genes. The MEGA 7.0 program and the Likelihood method with 1000 bootstrap were used to construct the tree from cDNA sequences obtained from the database within the NCBI. The lac-B and lac-T genes of T. hirsuta Bm-2 are shown with circle symbols
The 5′/3′ non-coding regions have important roles in the regulation of gene expression affecting mRNA stability, localization, and translation efficiency (Bradnam and Korf 2008). In this work, the non-coding 3′UTR region showed the same length and sequence (270 pb) in both genes. The 5′UTR regions showed moderate differences in length, lac-B 441 bp and lac-T 503 bp; however, there were clear differences in the structure and number of putative regulatory elements. The in silico analysis predicted that the 5′UTR of both genes is folded into structures with several hairpins that irradiate from a central loop region, whose number and location were different between the genes (Figs. 5 and 6).
Fig. 5.
Predicted secondary structure of 5′UTR regions in lac-B
Fig. 6.
Predicted secondary structure of 5′UTR regions in lac-T
The structures ΔG were − 172.5 kcal/mol for lac-T and − 135.8 kcal/mol for lac-B, suggesting they are stable motifs that could be targeted by proteins that bind to RNA, allowing the migration of the 40S ribosomal subunit, which requires at least − 50 kcal/mol (Mignone et al. 2002).
The 5′UTR sequences were analyzed with the RNA fold program (http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.egi), to explore the possible regulatory elements present.
Both genes present a single potential IRES site (internal ribosome entry site) that allows the translational complex with the 40S to function in a cap-independent process. Contrastingly, lac-T contains twice the number of motifs than lac-B such as hairpins, guanine-rich quadruple G structures (G4) that can fold into a structure very stable to strongly repress translation, and uORF (upstream open reading frame) which can impact on downstream expression by altering the efficiency of translation or initiation at the main ORF (Table 3). The number and nature of the regulatory elements present in the 5′UTR represent an accessibility factor which impacts the regulation of gene expression, by activating or inhibiting the translation of proteins (Ganapathi et al. 2005; Barrett et al. 2013). Both genes also have a high GC content of approximately 58%.
Table 3.
Regulatory elements within the 5′UTR regions in laccase genes from T. hirsuta Bm-2
| Motifs | lac-B | lac-T |
|---|---|---|
| G cuadruplex | 1 | 2 |
| uORF | 1 | 2 |
| IRES | 1 | 1 |
| Hairpin | 6 | 12 |
The analysis of the untranslated sequences has been done in mammals and in cancer cells, but there are very few reports in fungi (Mignone et al. 2002). In eukaryotes, the length of the 5′UTR varies considerably among genes, ranging from a few base pairs to several hundred base pairs (Nagalakshmi et al. 2008). Recent studies in Saccharomyces cerevisiae suggest that the 5′UTR length is related to different functions of genes and that it can influence the regulation of gene expression (Bruno et al. 2010; Lin and Li 2011).
It has been suggested that 5′UTRs of genes with low protein production are on average longer (greater than 100 bases) than those of other genes, and possess a higher degree of predicted secondary structure (Pickering and Willis 2005). By in silico comparisons, it was revealed that the short 5′UTRs, with low GC content (less than 30%), are relatively unstructured, do not contain AUG codons upstream, and generate high levels of protein production (Kochetov et al. 1998). This differs from the study by (Dmitriev et al. 2009), who found that short unstructured 5′UTRs, and highly structured lengths, did not modify the efficiency of mRNA translation of mammalian cells. Kozak mentioned that mRNAs that code for proteins involved in the cell development process often contain long 5′UTRs that must be finely regulated (Kozak 1989). In this study, we determined that although the 5′UTRs of lac-B and lac-T are both long, the expression levels are drastically different. In the medium supplemented with grapefruit, the activity of laccases was 50 times higher with respect to the basal medium (data not shown). The discrepancies in the reports indicate that further studies are still required in these and other non-coding regions to elucidate the molecular mechanisms that control translation.
The results of this study suggest that the presence of regulatory motifs in the 5′UTR of the mRNA expressed in the inducing medium could favor the production of these enzymes at the translational level. However, it is important to consider that the regulation of the 5′UTR region not only involves the length or number of regulatory structures, but also depends on the combined effects of multiple factors that influence protein translation.
Conclusions
In this study, lac-B and lac-T genes of the strain Bm-2 of T. hirsuta were isolated. Both genes exhibited the same characteristics of laccase type, such as the copper-binding sites, glycosylation sites and signal peptide. The structural difference in the 5′UTR region of both genes could influence the transcriptional and/or translational processes of the genes. The perspectives of these studies include the approach of strategies for the use of modified 5′UTRs to increase the yield of recombinant proteins.
Acknowledgement
The authors wish to express their gratitude to National Science and Technology Council, Mexico (CONACYT) for providing the financial support for this research (Project No. 248295).
Author contributions
All the authors contributed to this work. Tapia-Tussell and Solis-Pereira conceived, designed and wrote the paper; Pereira-Patron performed the experiments and analyzed the data; Lizama-Uc, Perez-Brito and Ramirez-Prado participated in the data analysis of untranslated region and writing of the paper. All authors reviewed and approved the manuscript.
Compliance with ethical standards
Conflict of interest
The authors declare that there is no conflict of interest regarding publication of this paper.
Contributor Information
Alejandrina Pereira-Patrón, Email: alejandrinapereira@hotmail.com.
Sara Solis-Pereira, Email: ssolis@itmerida.mx.
Gabriel Lizama-Uc, Email: lizama73@hotmail.com.
Jorge H. Ramírez-Prado, Email: jhramirez@cicy.mx
Daisy Pérez-Brito, Email: daisypb@cicy.mx.
Raul Tapia-Tussell, Phone: +52-999-9300760, Email: rtapia@cicy.mx.
References
- Altschul SF, Madden TL, Schäffer AA, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Asgher M, Yasmeen Q, Iqbal HMN. Development of novel enzymatic bioremediation process for textile industry effluents through response surface methodology. Ecol Eng. 2014;63:1–11. doi: 10.1016/j.ecoleng.2013.09.042. [DOI] [Google Scholar]
- Baldrian P. Fungal laccases–occurrence and properties. FEMS Microbiol Rev. 2006;30:215–242. doi: 10.1111/j.1574-4976.2005.00010.x. [DOI] [PubMed] [Google Scholar]
- Barrett LW, Fletcher S, Wilton SD (2013) Untranslated gene regions and other non-coding elements. In: Untranslated Gene Regions and Other Non-coding Elements. Springer, pp 1–56 [DOI] [PMC free article] [PubMed]
- Bradnam KR, Korf I. Longer first introns are a general property of eukaryotic gene structure. PLoS ONE. 2008;3:e3093. doi: 10.1371/journal.pone.0003093. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brijwani K, Rigdon A, Vadlani PV. Fungal laccases: production, function, and applications in food processing. Enzyme Res. 2010;2010:149748. doi: 10.4061/2010/149748. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bruno VM, Wang Z, Marjani SL, et al. Comprehensive annotation of the transcriptome of the human fungal pathogen Candida albicans using RNA-seq. Genome Res. 2010;20(10):1451–1458. doi: 10.1101/gr.109553.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bulter T, Alcalde M, Sieber V, et al. Functional expression of a fungal laccase in Saccharomyces cerevisiae by directed evolution. Appl Environ Microbiol. 2003;69:987–995. doi: 10.1128/AEM.69.2.987-995.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dmitriev SE, Andreev DE, Ad’ianova ZV, et al. Efficient cap-dependent in vitro and in vivo translation of mammalian mRNAs with long and highly structured 5′-untranslated regions. Mol Biol (Mosk) 2009;43:119–125. doi: 10.1134/S0026893309010154. [DOI] [PubMed] [Google Scholar]
- Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32:1792–1797. doi: 10.1093/nar/gkh340. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Feng BZ, Li PQ, Fu L, Yu XM. Exploring laccase genes from plant pathogen genomes: a bioinformatic approach. Genet Mol Res. 2015;14:14019–14036. doi: 10.4238/2015.October.29.21. [DOI] [PubMed] [Google Scholar]
- Ganapathi M, Srivastava P, Das Sutar SK, et al. Comparative analysis of chromatin landscape in regulatory regions of human housekeeping and tissue specific genes. BMC Bioinform. 2005;6:126. doi: 10.1186/1471-2105-6-126. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Givaudan A, Effosse A, Faure D, et al. Polyphenol oxidase in Azospirillum lipoferum isolated from rice rhizosphere: evidence for laccase activity in non-motile strains of Azospirillum lipoferum. FEMS Microbiol Lett. 1993;108:205–210. doi: 10.1111/j.1574-6968.1993.tb06100.x. [DOI] [Google Scholar]
- Gupta R, Brunak S (2001) Prediction of glycosylation across the human proteome and the correlation to protein function. In: Biocomputing 2002. World Scientific, pp 310–322 [PubMed]
- Jin W, Li J, Feng H, et al. Importance of a laccase gene (Lcc1) in the development of Ganoderma tsugae. Int J Mol Sci. 2018;19:471. doi: 10.3390/ijms19020471. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kalyani D, Tiwari MK, Li J, et al. A highly efficient recombinant laccase from the yeast Yarrowia lipolytica and its application in the hydrolysis of biomass. PLoS ONE. 2015;10:e0120156. doi: 10.1371/journal.pone.0120156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kandasamy S, Muniraj IK, Purushothaman N, et al. High level secretion of laccase (LccH) from a newly isolated white-rot basidiomycete, Hexagonia hirta MSF2. Front Microbiol. 2016;7:707. doi: 10.3389/fmicb.2016.00707. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kikin O, D’Antonio L, Bagga PS. QGRS Mapper: a web-based server for predicting G-quadruplexes in nucleotide sequences. Nucleic Acids Res. 2006;34:W676–W682. doi: 10.1093/nar/gkl253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim J-K, Lim S-H, Kang H-W. Cloning and characterization of a novel laccase gene, fvlac7, based on the genomic sequence of Flammulina velutipes. Mycobiology. 2013;41:37–41. doi: 10.5941/MYCO.2013.41.1.37. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim H-I, Kwon O-C, Kong W-S, et al. Genome-wide identification and characterization of novel laccase genes in the white-rot fungus Flammulina velutipes. Mycobiology. 2014;42:322–330. doi: 10.5941/MYCO.2014.42.4.322. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kirk TK, Croan S, Tien M, et al. Production of multiple ligninases by Phanerochaete chrysosporium: effect of selected growth conditions and use of a mutant strain. Enzyme Microb Technol. 1986;8:27–32. doi: 10.1016/0141-0229(86)90006-2. [DOI] [Google Scholar]
- Kochetov AV, Ischenko IV, Vorobiev DG, et al. Eukaryotic mRNAs encoding abundant and scarce proteins are statistically dissimilar in many structural features. FEBS Lett. 1998;440:351–355. doi: 10.1016/S0014-5793(98)01482-3. [DOI] [PubMed] [Google Scholar]
- Kolekar P, Pataskar A, Kulkarni-Kale U, et al. IRESPred: web server for prediction of cellular and viral internal ribosome entry site (IRES) Sci Rep. 2016;6:27436. doi: 10.1038/srep27436. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kozak M. The scanning model for translation: an update. J Cell Biol. 1989;108:229–241. doi: 10.1083/jcb.108.2.229. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kumar SVS, Phale PS, Durani S, Wangikar PP. Combined sequence and structure analysis of the fungal laccase family. Biotechnol Bioeng. 2003;83:386–394. doi: 10.1002/bit.10681. [DOI] [PubMed] [Google Scholar]
- Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33:1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kunamneni A, Plou FJ, Ballesteros A, Alcalde M. Laccases and their applications: a patent review. Recent Pat Biotechnol. 2008;2:10–24. doi: 10.2174/187220808783330965. [DOI] [PubMed] [Google Scholar]
- Lin Z, Li W-H. Evolution of 5′ untranslated region length and gene expression reprogramming in yeasts. Mol Biol Evol. 2011;29:81–89. doi: 10.1093/molbev/msr143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mignone F, Gissi C, Liuni S, Pesole G. Untranslated regions of mRNAs. Genome Biol. 2002;3:0004. doi: 10.1186/gb-2002-3-3-reviews0004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Morozova OV, Shumakovich GP, Shleev SV, Yaropolov YI. Laccase-mediator systems and their applications: a review. Appl Biochem Microbiol. 2007;43:523–535. doi: 10.1134/S0003683807050055. [DOI] [PubMed] [Google Scholar]
- Nagalakshmi U, Wang Z, Waern K, et al. The transcriptional landscape of the yeast genome defined by RNA sequencing. Science. 2008;320:1344–1349. doi: 10.1126/science.1158441. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nielsen H. Predicting secretory proteins with SignalP. Protein Funct Predict Methods Protoc. 2017;1:59–73. doi: 10.1007/978-1-4939-7015-5_6. [DOI] [PubMed] [Google Scholar]
- Palanisamy S, Ramaraj SK, Chen S-M, et al. A novel laccase biosensor based on laccase immobilized graphene-cellulose microfiber composite modified screen-printed carbon electrode for sensitive determination of catechol. Sci Rep. 2017;7:41214. doi: 10.1038/srep41214. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Park Y-J, Yoon D-E, Kim H-I, et al. Overproduction of laccase by the white-rot fungus Pleurotus ostreatus using apple pomace as inducer. Mycobiology. 2014;42:193–197. doi: 10.5941/MYCO.2014.42.2.193. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pickering BM, Willis AE (2005) The implications of structured 5′ untranslated regions on translation and disease. In: Seminars in cell & developmental biology. Elsevier, New York, pp 39–47 [DOI] [PubMed]
- Tapia-Tussell R, Pérez-Brito D, Rojas-Herrera R, et al. New laccase-producing fungi isolates with biotechnological potential in dye decolorization. Afr J Biotechnol. 2011;10:10134–10142. doi: 10.5897/AJB11.331. [DOI] [Google Scholar]
- Teerapatsakul C, Abe N, Bucke C, et al. Novel laccases of Ganoderma sp. KU-Alk4, regulated by different glucose concentration in alkaline media. World J Microbiol Biotechnol. 2007;23:1559–1567. doi: 10.1007/s11274-007-9401-z. [DOI] [Google Scholar]
- Téllez-Jurado A, Arana-Cuenca A, Becerra AEG, et al. Expression of a heterologous laccase by Aspergillus niger cultured by solid-state and submerged fermentations. Enzyme Microb Technol. 2006;38:665–669. doi: 10.1016/j.enzmictec.2005.07.021. [DOI] [Google Scholar]
- Terrón MC, González T, Carbajo JM, et al. Structural close-related aromatic compounds have different effects on laccase activity and on lcc gene expression in the ligninolytic fungus Trametes Trametes sp. I-62. Fungal Genet Biol. 2004;41:954–962. doi: 10.1016/j.fgb.2004.07.002. [DOI] [PubMed] [Google Scholar]
- Thurston CF. The structure and function of fungal laccases. Microbiology. 1994;140:19–26. doi: 10.1099/13500872-140-1-19. [DOI] [Google Scholar]
- Uthandi S, Saad B, Humbard MA, Maupin-Furlow JA. LccA, an archaeal laccase secreted as a highly stable glycoprotein into the extracellular medium by Haloferax volcanii. Appl Environ Microbiol. 2010;76:733–743. doi: 10.1128/AEM.01757-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vasina DV, Mustafaev ON, Moiseenko KV, et al. The Trametes hirsuta 072 laccase multigene family: genes identification and transcriptional analysis under copper ions induction. Biochimie. 2015;116:154–164. doi: 10.1016/j.biochi.2015.07.015. [DOI] [PubMed] [Google Scholar]
- Viswanath B, Rajesh B, Janardhan A, et al. Fungal laccases and their applications in bioremediation. Enzyme Res. 2014;2014:163242. doi: 10.1155/2014/163242. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vite-Vallejo O, Palomares LA, Dantán-González E, et al. The role of N-glycosylation on the enzymatic activity of a Pycnoporus sanguineus laccase. Enzyme Microb Technol. 2009;45:233–239. doi: 10.1016/j.enzmictec.2009.05.007. [DOI] [Google Scholar]
- Wang W, Liu F, Jiang Y, et al. The multigene family of fungal laccases and their expression in the white rot basidiomycete s. Flammulina velutipes. Gene. 2015;563:142–149. doi: 10.1016/j.gene.2015.03.020. [DOI] [PubMed] [Google Scholar]
- Yang J, Xu X, Ng TB, et al. Laccase gene family in Cerrena sp. HYB07: sequences, heterologous expression and transcriptional analysis. Molecules. 2016;21:1017. doi: 10.3390/molecules21081017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zapata-Castillo P, Villalonga-Santana M, Tamayo-Cortés J, et al. Purification and characterization of laccase from Trametes hirsuta Bm-2 and its contribution to dye and effluent decolorization. Afr J Biotechnol. 2012;11:3603–3611. [Google Scholar]
- Zapata-Castillo P, Villalonga-Santana L, Islas-Flores I, et al. Synergistic action of laccases from Trametes hirsuta Bm2 improves decolourization of indigo carmine. Lett Appl Microbiol. 2015;61:252–258. doi: 10.1111/lam.12451. [DOI] [PubMed] [Google Scholar]
- Zhou YP, Chen QH, Xiao YN, et al. Gene cloning and characterization of a novel laccase from the tropical white-rot fungus Ganoderma weberianum TZC-1. Appl Biochem Microbiol. 2014;50:500–507. doi: 10.1134/S0003683814050147. [DOI] [Google Scholar]






