Abstract
Podocyte injury is a key event for progressive renal failure. We have previously established a mouse model of inducible podocyte injury (NEP25) that progressively develops glomerulosclerosis after immunotoxin injection. We performed polysome analysis of intact and injured podocytes utilizing the NEP25 and RiboTag transgenic mice, in which a hemagglutinin tag is attached to ribosomal protein L22 selectively in podocytes. Podocyte-specific polysomes were successfully obtained by immunoprecipitation with an antihemagglutinin antibody from glomerular homogenate and analyzed using a microarray. Compared with glomerular cells, 353 genes were highly expressed and enriched in podocytes; these included important podocyte genes and also heretofore uncharacterized genes, such as Dach1 and Foxd2. Podocyte injury by immunotoxin induced many genes to be upregulated, including inflammation-related genes despite no infiltration of inflammatory cells in the glomeruli. MafF and Egr-1, which structurally have the potential to antagonize MafB and WT1, respectively, were rapidly and markedly increased in injured podocytes before MafB and WT1 were decreased. We demonstrated that Maff and Egr1 knockdown increased the MafB targets Nphs2 and Ptpro and the WT1 targets Ptpro, Nxph3, and Sulf1, respectively. This indicates that upregulated MafF and Egr-1 may promote deterioration of podocytes by antagonizing MafB and WT1. Our systematic microarray study of the heretofore undescribed behavior of podocyte genes may open new insights into the understanding of podocyte pathophysiology.
Keywords: chronic kidney disease, focal segmental glomerulosclerosis, gene expression, podocyte
INTRODUCTION
Accumulating evidence indicates that podocyte injury plays a key role in the progressive destruction of kidney architecture. Regardless of the nature of the primary injury, once a substantial number of podocytes are lost, the kidneys are irreversibly and progressively injured, leading to end-stage renal failure (38).
Previously, we established a mouse model of podocyte injury (NEP25), which expresses human (h) CD25 selectively on podocytes (25). Injection of the hCD25-targeted immunotoxin LMB2 induces podocyte injury dose-dependently through inhibition of protein synthesis in a similar manner to puromycin but strictly selective to podocytes. A minimum dose [0.625 ng/g body weight (BW)] of LMB2 causes NEP25 mice to develop moderate proteinuria, which peaks 1 wk after injection. Although injected LMB2 is rapidly cleared from the circulation (half-life of 35 min) (19), podocyte injury progresses over weeks and involves neighboring cells. The glomeruli show focal segmental glomerulosclerosis (FSGS) 3 wk after LMB2 injection. Using the chimeric mice made up with podocytes with and without hCD25, we have demonstrated that the initially damaged hCD25 podocytes lead to other non-hCD25 podocytes becoming damaged (24). These indicate that podocytes injured by LMB2 may damage other initially intact podocytes.
To investigate the molecular events in injured podocytes, we sought to analyze the RNA profiles of podocytes from NEP25 mice. To isolate podocyte mRNA, we utilized the RiboTag mice that express the ribosomal protein L22 (Rpl22) tagged with the hemagglutinin (HA) epitope only in cells expressing Cre recombinase (33). Polysomes specific to Cre-expressing cells are able to be obtained from tissue homogenate by immunoprecipitation with an anti-HA antibody without cellular dissociation. RiboTag mice have previously been used for cell-specific translatome analyses in various cell types (4, 9, 10, 12, 15, 32, 35, 36, 41).
In this study, we combined the RiboTag line with a podocyte-specific Cre-expressing line (Nphs1-Cre) (Fig. 1A), then combined with our NEP25 line. Utilizing these mice, we performed global translatome analyses in both normal and injured podocytes.
Fig. 1.

Strategy of podocyte polysome analysis. A: transgene structure of Nphs1-Ribotag mice. RiboTag mice (top) were crossed with Nphs1-Cre mice (middle). In podocytes of RiboTagTG/TG Nphs1-Cre+/WT (Nphs1-Ribotag) mice, Cre recombinase deletes the wild-type exon 4 (E4) of the Rpl22 gene and replaces with HA epitope-fused exon 4. B: HA immunostaining of Nphs1-RiboTag mice. HA was selectively expressed in the podocytes of Nphs1-RiboTag mice. Left and right panels show a low power field (scale bar = 100 μm) and a high-power field (scale bar = 25 μm), respectively. C: schematic outlining the method for podocyte RNA isolation. Glomeruli were isolated from Nphs1-RiboTag mice, homogenized, and immunoprecipitated with an anti-HA antibody to obtain podocyte specific polysomes, then purified to collect the podocyte specific mRNAs. D: RNA levels from the anti-HA antibody (Bound) fraction and the initial glomerular (Input) fraction. Although podocyte-specific RNAs, Nphs1 and Nphs2, were concentrated (left), a mesangial cell specific RNA, Des, and endothelial cell specific RNAs, Tek and Kdr, were diluted (right) in the bound fraction compared with the input fraction. Error bars represent SE (n = 8 for Nphs1 and Nphs2, n = 6 for Des, and n = 7 for Tek and Kdr). HA, hemagglutinin.
MATERIALS AND METHODS
Animal experiments.
The protocols for animal experiments were approved by the Animal Experimentation Committee of Tokai University School of Medicine, in accordance with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health.
RiboTag transgenic mice were obtained from Jackson Laboratory (no. 011029, Bar Harbor, ME) and mated with the Nphs1-Cre and NEP25 mice, obtaining mice carrying RiboTagTG/TGNphs1-Cre+/WT (designated as Nphs1-RiboTag) and mice carrying RiboTagTG/TGNphs1-Cre+/WTNEP25TG/WT (designated as Nphs1-RiboTag-NEP25).
Nphs1-RiboTag-NEP25 mice (n = 4 for each time point, 12–50 wk of age) were injected with 0.625 ng/g BW of LMB2, and glomeruli were isolated 4 and 7 days later. The concentrations of albumin and creatinine in the urine were determined. Kidney sections were immunostained with following antibodies: Dach1 (10914-AP, Proteintech, Tokyo, Japan), Desmin (M0760, Dako, Tokyo, Japan), Egr-1 (4153, Cell Signaling Technology, Tokyo, Japan), HA (11867423001, Roche, Tokyo, Japan), MafF (12771-1-AP, Proteintech), Nephrin (GP-N2, Progen, Heidelberg, Germany), and WT1 (sc-192, Santa Cruz Biotechnology, TX). For MafF and desmin double staining, the desmin antibody was conjugated to Alexa594- anti-mouse IgG1 (Zenon Z 25007, Thermo Fisher Scientific, Yokohama, Japan).
Isolation of glomeruli.
Under anesthesia with pentobarbital sodium (60 μg/g BW ip) and buprenorphine (50 ng/g BW sc) kidneys were perfused through the abdominal aorta with 7 ml saline containing 5 U/ml heparin followed by 5 ml saline containing 35 μl of Dynabeads M450 Tosyl-activated (Thermo Fisher) and 100 μg/ml cycloheximide. Kidneys were dissected, minced, and incubated in Hanks’ balanced salt solution containing 1 mg/ml collagenase A (Roche), 250 U/ml DNase I (Worthington, Lakewood, NJ), and 100 μg/ml cycloheximide at 37°C shaking (100 revolutions/min) for 30 min. The digested kidneys were sieved through a 106-μm metal mesh. Glomeruli were collected from the flow through with a neodymium magnet after washing several times with PBS containing 100 μg/ml cycloheximide.
Immunoprecipitation of podocyte-specific polysomes.
Glomeruli were suspended in 200 μl of a homogenization buffer [50 mM Tris, pH 7.4, 100 mM KCl, 12 mM MgCl2, 1% Nonidet P-40, 1 mM DTT, 200 U/ml RNasin (Promega, Tokyo, Japan), 1 mg/ml heparin, 100 μg/ml cycloheximide, 1% Protease Inhibitor Cocktail (Sigma-Aldrich, Tokyo, Japan)] and vortexed for 1 min. After centrifugation at 10,000 revolutions/min for 10 min at 4°C, the supernatant was separated and 2.5 μg of anti-HA.11 epitope tag antibody (16B12, Convance, Tokyo, Japan) was added, and the sample was rotated for 4 h at 4°C. Dynabeads Protein G (Thermo Fisher) was then added to the samples, and they were rotated overnight at 4°C. On the following day, the samples were placed on a neodymium magnet on ice, and the supernatant was separated. The remaining pellet was washed 3 times for 10 min in a high-salt buffer (50 mM Tris, pH 7.4, 300 mM KCl, 12 mM MgCl2, 1% Nonidet P-40, 1 mM DTT, 100 μg/ml cycloheximide). QIAGEN RLT buffer was added to the remaining pellet. Total RNA was prepared using the RNeasy Micro kit (QIAGEN, Tokyo, Japan) from the pellet and the separated supernatant and quantified with a NanoDrop spectrophotometer (Thermo Fisher). The supernatant contained unprecipitated RNAs.
Gene expression array and quantitative reverse-transcription PCR assays.
RNA samples were labeled using Low Input Quick Amp Labeling Kit (Agilent Technologies, Hachioji, Japan), hybridized to SurePrint G3 Mouse GE 8x60K arrays (Agilent), and scanned. The microarray data are accessible from the Gene Expression Omnibus repository under the accession number GSE108629.
For Nphs1, Nphs2, Wt1, Des, Kdr, and Gapdh mRNAs, TaqMan primer probe sets (Thermo Fisher) were used in quantitative reverse-transcription PCR (qRT-PCR). Primers for other genes are shown in Table 1. Relative amounts of mRNAs were determined using the ΔΔCT method.
Table 1.
Primers for quantitative reverse-transcription PCR
| Gene | Forward | Reverse |
|---|---|---|
| C1qtnf7 | aaaggagagaagggggaaaa | gctggaccgacttctcctt |
| Cxcl1 | gactccagccacactccaac | tgacagcgcagctcattg |
| Dach1 | tctacaatgactgcaccaacg | tgagagttctctggggaagtg |
| Dpp4 | aagctctgaccagcgattatct | cacatttgtgtggtcagtaagttg |
| Egr1 | cctatgagcacctgaccaca | tcgtttggctgggataactc |
| Foxd1 | gcagccgcttcccttacta | gttgagcgacaggttgtgac |
| Foxd2 | accgcttttctgtttgagca | gactgtgaaaggcgcaaag |
| Mafb | gcaacggtagtgtggaggac | acctcgtccttggtgaagc |
| Maff | ggctgtggatcccttatctagc | atcagcgcttcatccgaca |
| Pecam1 | agccagtagcatcatggtca | agcaggacaggtccaacaac |
| Podxl | atcctgtggggcagcatac | agaggtgcccaatggtttg |
| Ptpro | aggctagtctccatgaacgaag | tcctggggtgagttgtatcc |
| Relb | gtgacctctcttccctgtcact | tgtattcgtcgatgatttccaa |
| Synpo | tctggagaaggttgccagtg | gcgacaggtgtagcccattg |
| Tek | cctgaactgtgatgatgaggtg | aatgatggtctctcataaggcttc |
| Tie1 | cggcatgcagtaccttagtg | ctctccgaccagcacatttc |
| Tnfrsf12a | ccgccggagagaaaagtt | actggatcagtgccacacc |
| Vwf | acgccatctccagattcaag | tggctcttctcttcccgata |
Experiments using primary cultured podocytes.
Glomeruli were harvested using the bead method and cultured on a collagen I-coated dish for 7 days in DMEM/F12 containing 5% FBS supplemented with 0.5% insulin-transferrin-selenium A liquid supplement. Cellular outgrowths were detached and passaged after removing remaining glomeruli. Immunostaining with anti-podoplanin antibody (PMab-1, kindly gifted by Dr. Umetsu in Tohoku University, Japan) revealed that more than 95% of these cells were podocytes. The cultured podocytes were used for experiments within 14 days after the first passage.
Podocytes were transfected with siRNAs against Dach1, Foxd1, Foxd2, Maff, and Egr1 or control siRNA (Sigma-Aldrich) using Lipofectamine RNAiMAX Reagent (Thermo Fisher). Subsequently, qRT-PCR analyses, proliferation assays, or 5-ethynyl-2′-deoxyuridine (EdU) assays were performed. For the proliferation assay, 2,000 podocytes were seeded into wells of a 96-well plate. Cell number was evaluated using a Cell-Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan) 5 days after siRNA transfection. For the EdU assay, 1.5 × 104 podocytes were seeded on coverglass. The day after siRNA transfection, EdU was added at 1 μM to the medium. After 22 h, the incorporated EdU was calculated by staining with the Click-iT EdU Imaging kit (Thermo Fisher).
For examining the efficiency of immunoprecipitation, podocytes were cultured from Nphs1-RiboTag mice (n = 7). RNA was extracted from the polysome of cultured cells by immunoprecipitation with an anti-HA antibody. The yield of polysome RNA was, on average, 13.3 ± 9.5 (SD) % of the total cellular RNA.
Statistical analysis.
For microarray analysis, qRT-PCR analyses in Tables 2 and 6, and gene suppression assays unpaired t-tests were used, and the P values were adjusted by the Benjamini-Hochberg procedure. Unpaired t-test was used in the analysis of Table 4. Mann-Whitney U-test was used for quantitative analyses of histology in Fig. 3, B and C. ANOVA and Dunnett’s test were used for urinary albumin/creatinine ratio (UACR) (logarithmically transformed), qRT-PCR analyses in Figs. 3A and 4A, quantitative analyses of histology in Fig. 3D, and cell counting assays.
Table 2.
Representative data of microarray and qRT-PCR analysis for mRNAs obtained by RiboTag method compared with those of glomerular cells
| Microarray |
qRT-PCR |
||||
|---|---|---|---|---|---|
| Gene Symbol | Fold Enrichment | Corrected P Value | Normalized Value of Array Signal in Podocytes | Fold Enrichment | Corrected P Value |
| Podocyte genes | |||||
| Nphs1 | 5.00 | 0.00609 | 8.02 | 9.19 | 1.23E-5 |
| Nphs2 | 1.34 | 0.0235 | 9.44 | 6.27 | 1.88E-5 |
| Podxl | 5.19 | 0.00322 | 7.98 | 5.00 | 0.00173 |
| Synpo | 2.91 | 0.00744 | 7.89 | 3.29 | 0.00268 |
| Wt1 | 4.93 | 0.00304 | 8.85 | 7.93 | 1.61E-5 |
| Nonpodocyte genes | |||||
| Des | 0.161 | 0.00262 | −1.30 | 0.0940 | 5.35E-4 |
| Tie1 | 0.00418 | 0.00400 | −0.890 | 0.109 | 0.00359 |
| Tek | 0.0616 | 0.00681 | −1.01 | 0.212 | 0.00386 |
| Kdr | 0.0791 | 0.00677 | 3.42 | 0.0443 | 0.0139 |
| Vwf | 0.133 | 0.00286 | −4.24 | <0.100 | |
| Pecam1 | 0.0621 | 0.00293 | −1.41 | 0.0767 | 0.00707 |
qRT-PCR, quantitative reverse-transcription PCR.
Table 6.
Representative data of microarray and qRT-PCR analyses in podocytes injured by immunotoxin compared with normal podocytes
| Microarray |
qRT-PCR |
|||||||
|---|---|---|---|---|---|---|---|---|
| 4 Days After LMB2 |
7 Days After LMB2 |
4 Days After LMB2 |
7 Days After LMB2 |
|||||
| Gene Symbol | Fold Change | Corrected P Value | Fold Change | Corrected P Value | Fold Change | Corrected P Value | Fold Change | Corrected P Value |
| Podocyte genes | ||||||||
| Nphs1 | 0.675 | 0.0700 | 0.366 | 0.00271 | 0.383 | 2.21E-5 | 0.312 | 8.72E-6 |
| Nphs2 | 0.869 | 0.284 | 0.874 | 0.402 | 0.706 | 0.0352 | 0.417 | 9.32E-4 |
| Podxl | 0.626 | 0.068 | 0.390 | 0.00170 | 0.575 | 0.0149 | 0.567 | 0.00955 |
| Synpo | 0.751 | 0.181 | 0.486 | 3.80E-4 | 0.611 | 0.0147 | 0.558 | 0.00695 |
| Wt1 | 0.890 | 0.214 | 0.504 | 3.80E-4 | 0.562 | 9.36E-4 | 0.309 | 5.27E-5 |
| Other genes | ||||||||
| Des | 1.10 | 0.660 | 8.09 | 3.54E-4 | 1.39 | 0.779 | 5.63 | 2.94E-4 |
| Relb | 6.23 | 0.0341 | 6.94 | 7.51E-4 | 27.2 | 3.57E-4 | 4.37 | 0.590 |
| Tnfrsf12a | 4.00 | 7.80E-4 | 11.3 | 1.15E-4 | 5.11 | 0.0317 | 9.18 | 7.56E-4 |
| Cxcl1 | 199 | 0.00449 | 159 | 0.00163 | 247 | 4.40E-5 | 67.5 | 0.0593 |
qRT-PCR, quantitative reverse-transcription PCR.
Table 4.
RiboTag method into primary cultured podocytes
| Gene | Fold Enrichment* |
|---|---|
| Highly podocyte-enriched genes | |
| Dach1 | 3.45 |
| Foxd1 | 2.46 |
| Foxd2 | 3.45 |
| Tcf21 | 2.63 |
| Foxc2 | 3.45 |
| Foxl1 | 2.78 |
| Pdpn | 2.65 |
| Sema3g | 2.30 |
| (Average) | 2.90 (P < 0.05 vs. housekeeping genes) |
| Housekeeping genes | |
| Fau | 1.11 |
| Cox5a | 1.67 |
| Cox8a | 1.29 |
| Hspa8 | 1.02 |
| Rpl8 | 0.99 |
| Sod1 | 1.12 |
| (Average) | 1.20 |
Mean ratio of immunoprecipitated polysomes per whole podocyte RNAs.
Fig. 3.
Foxd1, Foxd2, and Dach1 in podocytes. A: quantitative reverse-transcription (qRT-PCR) analysis. Compared with normal glomeruli, normal podocytes highly express Foxd1, Foxd2, Dach1, Foxc1, and Foxc2 mRNAs. Foxd1, Foxd2, Dach1, and Foxc2 but not Foxc1 mRNAs were decreased in podocytes after injection with LMB2. Error bars represent SE (n = 4 each). B: immunostaining for Dach1. Dach1 protein is intensely stained in nuclei of podocytes of normal mice (a), coinciding with WT1 staining on the adjacent section (b). Dach1 staining diminishes in injured podocytes of NEP25 [8 days after injection of LMB2 (5 ng/g body weight) (c), similarly to that of WT1 on the adjacent section (d). Scale bars = 25 μm. Quantitative analysis demonstrated that Dach1-positive podocytes (e) and WT1-positive podocytes (f) decreased in the kidney of NEP25 mice compared with that of normal mice (WT). Each dot shows the number of Dach1-positive or WT1-positive podocytes per glomerulus (2,500–5,500 μm2) in total of 40 glomeruli from 2 mice. C: Dach1 immunostaining in various mouse models. Dach1 staining was diminished in injured glomeruli from mice with Adriamycin nephropathy (ADR) (a), human immunodeficiency virus-1 associated nephropathy (HIVAN) (c), and α-actinin4 nephropathy (Actn4) (e) compared with their controls (b, d, f). Dach1 staining was not diminished in diabetic Akita mice (DM) without nephropathy (g), compared with their control (h). Scale bars = 25 μm. Quantitative analysis confirmed these changes (i–l). Each dot shows the number of Dach1-positive podocytes per glomerulus in total of 40 glomeruli (2,500–5,500 μm2) from 2 mice (i, k, l) or 20 glomeruli from 1 mouse (j). D: DACH1 and WT1 immunostaining in human kidneys. Serial sections were taken from normal areas in a resected kidney with renal carcinoma (a and b) and biopsy samples with minimal change disease (c and d), diabetic nephropathy (e and f), lupus nephropathy (g and h), and immunoglobulin A (IgA) nephropathy (i and j). These were stained for DACH1 (a, c, e, g, and i) and WT1 (b, d, f, h, and j). DACH1 staining in the glomerulus coincided with WT1 staining in normal glomeruli. In glomeruli with diabetic nephropathy, lupus nephropathy, or IgA nephropathy, the number of DACH1-stained cells was markedly decreased compared with normal glomeruli. Scale bars = 50 μm. Quantitative analysis confirmed these changes (k and l). Each dot shows the number of Dach1-positive (k) or WT1-positive (l) podocytes per glomerulus (15,000–35,000 μm2) [n = 20 in normal section, n = 16 in minimal change disease (MCD), n = 20 in diabetic nephropathy (DN), n = 28 in lupus nephropathy (LN), and n = 23 in IgA nephropathy (IgAN)]. E: 5-ethynyl-2′-deoxyuridine (EdU) assays. Compared with podocytes treated with control siRNA, those treated with siRNA for Foxd2 or Dach1 but not Foxd1, showed less EdU incorporation. The incorporation rate of EdU-positive cells (green) per DAPI-positive cells (blue) is shown above each picture. Scale bars = 25 μm. F: gene knockdown assays. Suppression of Foxd1, Foxd2, or Dach1 by siRNAs decreased Dpp4 and Podxl mRNAs. Error bars represent SE (n = 3 each).
Fig. 4.
MafF and Egr-1 in podocytes. A: qRT-PCR analysis. Maff and Egr1 expression was very low in normal podocytes and markedly upregulated after LMB2 injection as early as 4 days after LMB2 injection. Mafb and Wt1 were highly expressed in normal podocytes, and these mRNAs were downregulated after LMB2 injection. Error bars represent SE (n = 4 each). B: immunostaining for MafF. Nuclear MafF staining was increased in the glomerulus of NEP25 mice after LMB2 injection (1.25 ng/g body weight) (top). Double immunostaining revealed that some of MafF-positive cells were also intensely stained for desmin (bottom, arrows), indicating that injured podocytes can express MafF protein. Scale bars = 25 μm. C: immunostaining for Egr-1. Egr-1 protein was not visible in normal glomeruli (top). In NEP25 mice injected with LMB2, Egr1 stained injured podocytes. Injured podocytes were identified by diminished nephrin staining (middle, arrow) or intense expression of desmin (bottom, arrow). Scale bars = 25 μm. D: EGR-1 staining in human kidneys. Serial sections of normal areas in a resected kidney with renal carcinoma (a and b) and kidney biopsy samples with minimal change disease (c and d), membranous glomerulonephropathy (e and f), IgA nephropathy (g and h), and diabetic nephropathy (i and j). These were stained for EGR-1 (a, c, e, g, and i), and nephrin (b, d, f, h, and j). EGR-1 was not observed in normal podocytes. EGR-1 staining in podocytes was positive in membranous glomerulonephropathy and IgA nephropathy but not in minimal change disease and diabetic nephropathy. EGR1 was expressed even in podocytes with normal nephrin staining. Scale bars = 50 μm. E: gene knockdown assays in murine primary podocytes. Maff siRNA suppressed Maff mRNA and upregulated Nphs2 and Ptpro mRNAs without a change in Mafb mRNA (left). Egr1 siRNA suppressed Egr1 mRNA and upregulated Ptpro, Sulf1, and Nxph3 mRNAs, with a slight change of Wt1 mRNA (right). Error bars represent SE (n = 5 each). qRT-PCR, quantitative reverse-transcription PCR.
RESULTS
Isolation of podocyte mRNA in Nphs1-RiboTag mice.
The HA-tag was selectively expressed in podocytes in the Nphs1-RiboTag mice, indicating that the Rpl22 transgene was recombined as expected (Fig. 1B). Nphs1-RiboTag and Nphs1-RiboTag-NEP25 mice without LMB2 showed a normal UACR of 0.085 mg/mg [95% confidence interval (CI) 0.076–0.096] and normal renal morphology.
Glomeruli were isolated from Nphs1-RiboTag mice, homogenized, and immunoprecipitated with an anti-HA antibody (Fig. 1C). Initial analysis by qRT-PCR showed that the podocyte-specific RNAs Nphs1 and Nphs2 were concentrated, whereas a mesangial cell-specific RNA Des and endothelial cell-specific RNAs Tek and Kdr were diluted, in the immunoprecipitated polysomes compared with glomerular RNAs. This indicates that podocyte mRNAs were successfully isolated (Fig. 1D).
Gene array analyses of normal and injured podocytes.
We immunoprecipitated podocyte-specific polysomes from Nphs1-RiboTag mice (n = 4) and compared them with the glomerular RNAs by microarray analysis.
Additionally, we injected LMB2 (0.625 ng/g BW) into Nphs1-RiboTag-NEP25 mice. At 4 and 7 days after LMB2 injection, glomeruli were harvested (n = 4 each) from which podocyte RNAs were obtained and analyzed by microarray. The UACR was increased to 0.19 mg/mg (95% CI 0.10–0.36) 4 days after injection and 76 mg/mg (95% CI 74–78) 7 days after injection (Fig. 2A).
Fig. 2.
Polysome analysis of normal and injured podocytes. A: urinary albumin/creatinine ratios. Without LMB2, all mice showed normal urinary albumin/creatinine ratios. Nphs1-RiboTag-NEP25 mice displayed albuminuria both 4 days and 7 days after LMB2 injection. B: principal component analysis. Normal glomeruli (Glo), normal podocytes (Podo), and podocytes from day 4 and day 7 after LMB2 injection (Podo day 4 and Podo day 7, respectively) (each n = 4) showed good clustering within groups in the first three components with small intersample variability. C: heat maps. Representative podocyte and nonpodocyte genes in normal glomeruli, normal podocytes, and podocytes 4 days and 7 days after LMB2 injection (each n = 4). D: logarithmic scatterplots of gene probe intensities of normal podocytes against those of glomerular cells. Distinct differences in translated RNA levels between normal podocytes and glomerular cells are demonstrated. Each dot represents one probe and selected probes of known podocyte genes and non-podocyte genes are highlighted. Greater than twofold up- and downregulated probes in podocytes are shown in red and green, respectively. E: logarithmic scatterplots of gene probe intensities of injured podocytes against those of normal podocytes. Distinct differences in translated RNA levels between normal podocytes and those 7 days after LMB2 injection are demonstrated. Each dot represents one probe and selected probes are highlighted. Greater than twofold up- and downregulated probes in injured podocytes are shown in red and green, respectively.
We performed principal component analysis on normal glomeruli, normal podocytes, and podocytes 4 and 7 days after LMB2 injection (each n = 4). These showed good clustering within groups in the first three components, with small intersample variability (Fig. 2B).
Normal podocytes have specifically enriched RNAs.
In normal podocytes compared with the glomerulus, many well-known podocyte-specific genes, including Nphs1, Podxl, Synpo, and Wt1, were highly expressed and significantly enriched (Table 2, Fig. 2, C and D). However, the mesangial cell-specific gene Des and endothelial cell-specific genes Tie1, Tek, Kdr, Vwf, and Pecam1 were diluted. These results were validated using qRT-PCR. Mircoarray analysis showed Nphs2 to be enriched only by 1.34-fold in normal podocytes, probably because of saturation of the array signal; however, analysis using qRT-PCR showed that Nphs2 was enriched by 6.3-fold in normal podocytes. The majority of podocyte-enriched genes reported in previous studies (2, 3, 13, 16, 37) were also concentrated in immunoprecipitated RNAs from Nphs1-RiboTag mice (Table 3).
Table 3.
Enriched genes in podocytes
| Author | GEO ID | Method | Mouse | Comparison Subject | Number of Podocyte-Enriched Genes* | Number (%) of Genes Commonly Enriched in Ribotag Podocytes† |
|---|---|---|---|---|---|---|
| Takemoto et al. (37) | None | Flow cytometry | Podocin-Cre;Z/EG mice | Nonpodocyte glomerular cells | 49 | 38 (77.6) |
| Brunskill et al. (3) | GSE17142, GSE17143, GSE17145 | Flow cytometry | MafB-GFP mice | Renal cortex | 138 | 132 (95.7) |
| Boerries et al. (2) | GSE39441 | Flow cytometry | Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J:hNPHS2Cre mice | Nonpodocyte glomerular cells | 864 | 735 (85.1) |
| Grgic et al. (13) | GSE53156 | Immunoprecipitation with anti-eGFP antibody | Col1α1-eGFP-L10a (PodoTRAP) mice | Renal cortex | 1,012 | 671 (66.3) |
GEO, Gene Expression Omnibus; eGFP, enhanced GFP; GFP, enhanced green fluorescent protein.
Takemoto et al., Brunskill et al., Boerreis et al., and Grgic et al. defined >2, >5, >2, and >3-fold changed genes in podocytes compared with each comparison subject as podocyte-enriched genes, respectively.
Significantly (>2-fold) enriched in these genes in podocytes of Nphs1-RiboTag mice.
Given that the contribution of podocytes to the whole glomerular RNA content is one-third, the maximum rate of podocyte versus glomerular RNA is expected to be around three. However, 127 genes showed more than sixfold enrichment in podocyte polysomes. We tested whether mRNAs of these genes were concentrated in polysomes using primary cultured podocytes of Nphs1-RiboTag mice (n = 6). Relative amounts of mRNAs were determined for eight highly enriched podocyte genes and six housekeeping genes in immunoprecipitated polysomes and whole cell lysate. The results showed that podocyte mRNAs highly enriched within RiboTag glomeruli were significantly more concentrated in polysomes than those of the housekeeping genes (Table 4).
Podocytes had 353 genes significantly enriched (>3-fold) and highly expressed (>4 average normalized log2 signal) (Supplemental Table S1; Supplemental Material for this article is available online at the Journal website). Enrichment analyses of these highly expressed podocyte genes with Enrichr (http://amp.pharm.mssm.edu/Enrichr) (20) are summarized in Table 5 (whole data available in Supplemental Table S1). PodoNet genes and FSGS-related genes were significantly enriched, indicating that this gene set contains genes important for maintaining normal podocyte function.
Table 5.
Enrichment analyses in normal podocytes
| Gene-Set Library | Term | P Value |
|---|---|---|
| WikiPathway 2016 | PodNet: protein-protein interactions in the podocyte_Mus musculus_WP2310 | 5.8E-36 |
| XPodNet - protein-protein interactions in the podocyte expanded by STRING_Mus musculus_WP2309 | 3.5E-22 | |
| Primary Focal Segmental Glomerulosclerosis FSGS_Homo sapiens_WP2572 | 1.5E-17 | |
| ChEA 2016 | WT1_25993318_ChIP-Seq_PODOCYTE_Human | 2.5E-43 |
| WT1_20215353_ChIP-ChIP_NEPHRON_PROGENITOR_Mouse | 4.6E-19 | |
| MGI Mammalian Phenotype 2017 | MP:0005325_abnormal_renal_glomerulus_morphology | 2.6E-8 |
| Human Phenotype Ontology | Proteinuria (HP:0000093) | 6.1E-6 |
| FSGS (HP:0000097) | 1.7E-5 | |
| Glomerulosclerosis (HP:0000096) | 1.6E-5 |
ChEA, ChIP Enrichment Analysis; FSGS, focal segmental glomerulosclerosis.
Gene array analyses of injured podocytes.
After induction of podocyte injury, the gene expression profile dramatically changed (Fig. 2, C and E). Four and 7 days after podocyte injury induction, 1,478 (2.7%) and 1,938 (3.5%) probes were significantly (>2-fold) downregulated, respectively. These genes included typical podocyte-specific genes such as Nphs1, Podxl, Synpo, and Wt1 (Table 6). Among the 353 highly podocyte-enriched genes (Supplemental Table S1), 146 genes (41.3%) were significantly (>2-fold) downregulated 7 days after induction of podocyte injury (Supplemental Table S2). On the other hand, 1,881 (3.4%) and 3,130 (5.6%) probes were significantly (>2-fold) upregulated 4 days and 7 days after induction of podocyte injury, respectively (Fig. 2E and Table 7). These included the well-established podocyte injury marker Des and inflammation-related genes such as Relb, Tnfrsf12a, and Cxcl1 (Table 6).
Table 7.
Top 20 upregulated genes in injured podocytes 4 days after immunotoxin injection
| Gene Symbol | Description | Fold Change | Corrected P Value |
|---|---|---|---|
| Epha8 | Mus musculus Eph receptor A8 (Epha8), mRNA (NM_007939) | 6,450 | 0.00124 |
| Thbs4 | Mus musculus thrombospondin 4 (Thbs4), mRNA (NM_011582) | 4,540 | 0.00513 |
| Tmprss9 | Mus musculus transmembrane protease, serine 9 (Tmprss9), mRNA (NM_001081688) | 2,770 | 0.00563 |
| Maff | Mus musculus v-maf musculoaponeurotic fibrosarcoma oncogene family, protein F (avian) (Maff), mRNA (NM_010755) | 874 | 0.00464 |
| P2rx7 | Mus musculus purinergic receptor P2X, ligand-gated ion channel, 7 (P2rx7), transcript variant 1, mRNA (NM_011027) | 435 | 0.00390 |
| Cxcl1 | Mus musculus chemokine (C-X-C motif) ligand 1 (Cxcl1), mRNA (NM_008176) | 199 | 0.00449 |
| Prr7 | Mus musculus proline rich 7 (synaptic) (Prr7), mRNA (NM_001030296) | 159 | 0.00196 |
| Zmynd15 | Mus musculus zinc finger, MYND-type containing 15 (Zmynd15), mRNA (NM_001029929) | 131 | 0.00572 |
| Birc5 | Mus musculus baculoviral IAP repeat-containing 5 (Birc5), transcript variant 3, mRNA (NM_001012273) | 83.5 | 0.0169 |
| Egr1 | Mus musculus early growth response 1 (Egr1), mRNA (NM_007913) | 70.1 | 0.00493 |
| Cirbp | Cold inducible RNA binding protein (Source:MGI Symbol;Acc:MGI:893588) (ENSMUST00000054666) | 40.2 | 0.00229 |
| Gadd45b | Mus musculus growth arrest and DNA-damage-inducible 45 beta (Gadd45b), mRNA (NM_008655) | 29.7 | 0.00530 |
| Ermn | Mus musculus ermin, ERM-like protein (Ermn), mRNA (NM_029972) | 25.2 | 0.0252 |
| Rhox8 | Mus musculus reproductive homeobox 8 (Rhox8), mRNA (NM_001004193) | 23.7 | 0.0222 |
| Gab3 | Mus musculus growth factor receptor bound protein 2-associated protein 3 (Gab3), mRNA (NM_181584) | 23.3 | 0.0188 |
| Gcm1 | Mus musculus glial cells missing homolog 1 (Drosophila) (Gcm1), mRNA (NM_008103) | 23.2 | 0.0221 |
| Gm11974 | Mus musculus predicted gene 11974 (Gm11974), long non-coding RNA (NR_045893) | 22.0 | 0.00885 |
| Ifrd1 | Mus musculus interferon-related developmental regulator 1 (Ifrd1), mRNA (NM_013562) | 21.1 | 0.00530 |
| Dcc | Mus musculus deleted in colorectal carcinoma (Dcc), mRNA (NM_007831) | 20.9 | 0.0188 |
| Slc25a25 | Mus musculus solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25 (Slc25a25), transcript variant 1, mRNA (NM_146118) | 14.6 | 0.00563 |
Representative enrichment analyses from podocytes 7 days after immunotoxin injection of 1,344 downregulated genes (<0.5-fold change, P < 0.05) and 1,179 upregulated genes (>4-fold change, P < 0.05) are summarized in Table 8 (whole data available in Supplemental Tables S3 and S4).
Table 8.
Enrichment analyses in injured podocytes 7 days after immunotoxin injection
| Gene-Set Library | Term | P Value |
|---|---|---|
| Downregulated genes | ||
| KEGG 2016 | Protein processing in endoplasmic reticulum | 2.3E-5 |
| WikiPathway 2016 | PodNet: protein-protein interactions in the podocyte_Mus musculus_WP2310 | 3.8E-5 |
| Reactome 2016 | MAP2K and MAPK activation Homo sapiens_R-HSA-5674135 | 0.012 |
| ChEA 2016 | WT1_25993318_ChIP-Seq_PODOCYTE_Human | 1.4E-12 |
| Upregulated genes | ||
| KEGG 2016 | Cytokine-cytokine receptor interaction | 2.5E-6 |
| TNF signaling pathway | 6.0E-6 | |
| WikiPathways 2016 | TWEAK Signaling Pathway Homo sapiens WP2036 | 1.3E-4 |
| Reactome 2016 | Extracellular matrix organization Homo sapiens R-SHR-1474244 | 6.8E-7 |
| ChEA 2016 | RELA 24523406 CHIP-Seq FIBROSARCOMA Human | 2.6E-9 |
KEGG, Kyoto Encyclopedia of Genes and Genomes; ChEA, ChIP Enrichment Analysis.
The gene expression changes induced in podocytes by immunotoxin injection were remarkably similar to those observed in the podocytes of Actn4-knockout (KO) mice (13). Among the significantly (>2-fold) up- and downregulated genes in the Actn4-KO mice, 37.9% and 33.8% genes were similarly up- or downregulated in our study (>2 or <0.5-fold change 7 days after podocyte injury, P < 0.05) (Supplemental Table S5).
Functional analysis of selected genes in primary cultured podocytes.
The above set of highly expressed podocyte genes (Supplemental Table S1) contained many genes that are well characterized to have important roles in normal podocyte maintenance. We focused on Dach1 and Foxd2, which do not have an established function in podocytes. DACH1 polymorphism has been shown to be associated with chronic kidney disease (CKD) (18, 30) and may modulate or collaborate with Fox transcription factors (40). Foxd2 belongs to the Fox family, and Foxc1 and Foxc2 collaboratively maintain normal podocyte integrity (27). Our microarray and qRT-PCR data showed that Dach1 and Foxd2 mRNAs are highly expressed in podocytes similarly to Foxc1 and Foxc2 and are downregulated after podocyte injury (Fig. 3A). Foxd1 also showed a similar expression pattern, although the expression level was lower.
Immunostaining showed that Dach1 was intensely localized in the nucleus of podocytes, and this was diminished in the NEP25-injured podocytes in a parallel pattern to WT1 (Fig. 3B). Dach1 staining was also diminished in the glomerulus of other podocyte injury models but not in diabetic mice without nephropathy (Fig. 3C). Dach1 staining was also observed in normal human podocytes and was diminished in injured glomeruli in parallel with WT1 staining (Fig. 3D).
We next studied the function of Dach1, Foxd1, and Foxd2 in primary cultured podocytes. Compared with podocyte RNAs obtained by immunoprecipitation from RiboTag mice, Dach1, Foxd1, and Foxd2 mRNAs in primary podocytes cultured for 13 days were decreased by 0.025-, 0.21-, and 0.018-fold, respectively. Nevertheless, the suppression of Dach1 and Foxd2 but not Foxd1 by siRNA decreased cell proliferation (0.723, 0.741, and 0.953 relative ratio versus control siRNA, P = 7.04E-5, 5.30E-5, and 0.702, respectively) as well as the incorporation of EdU (Fig. 3E). We quantified the mRNAs of several Foxc-target genes (27, 37). Foxd1, Foxd2, or Dach1 siRNA decreased Dpp4 and Podxl mRNAs (Fig. 3F).
Among the genes upregulated after podocyte injury, we focused on two transcription factors, MafF and Egr-1. These may antagonize MafB and WT1, respectively, both of which are essential for maintaining normal podocyte functions. Microarray and confirmatory qRT-PCR data demonstrated that baseline levels of Maff and Egr1 mRNAs were very low in podocytes but that they increased markedly after LMB2 injection (Fig. 4A). Interestingly, Maff and Egr1 mRNAs were upregulated (15- and 4.2-fold, respectively) in podocytes freshly isolated from normal glomeruli by flow cytometry compared with podocyte RNAs obtained by immunoprecipitation from the RiboTag mice. This indicates that stress during cellular dissociation may stimulate expression of these genes. Maff and Egr1 mRNAs remained higher (9.0- and 5.2-fold) in primary cultured podocytes compared with RiboTag podocyte RNAs.
Immunostaining showed that nuclear MafF emerged in the glomerulus of NEP25 mice after LMB2 injection (Fig. 4B). Some of the MafF-positive cells were also intensely stained for desmin, indicating that injured podocytes express the MafF protein. Egr-1 was also shown to emerge in damaged podocytes in NEP25 mice, which were identified by diminished nephrin staining and enhanced desmin staining (Fig. 4C). Additionally, EGR-1 staining was negative in podocytes of normal human kidney but positive in membranous glomerulonephropathy and immunoglobulin A nephropathy but not in minimal change disease and diabetic nephropathy (Fig. 4D).
We next studied the effects of Maff and Egr1 siRNA on their respective MafB and WT1-target genes (7, 34) in primary podocytes. Maff knockdown increased Nphs2 and Ptpro mRNAs without altering Mafb mRNA. Egr1 knockdown increased Ptpro, Nxph3, and Sulf1 mRNAs with a slight change in Wt1 mRNA (Fig. 4E).
DISCUSSION
In this study, we obtained podocyte RNA by immunoprecipitation in glomerular homogenate utilizing RiboTag mice. Another method used to isolate podocyte RNA is flow cytometry. As injured cells are fragile and often lost during the dissociation process, it is difficult to apply the flow cytometry method to models with substantial podocyte injury. In addition, cellular dissociation and sorting can have significant effects on gene expression. In fact, our data as well as data from other laboratories have shown that Maff and Egr1 genes are highly increased in normal podocytes obtained by the flow cytometry method (2, 16). Therefore, as the RiboTag method does not need dissociation of glomerular cells, we found that it is more suitable for the purposes of our study.
Many genes in normal podocytes displayed a higher enrichment in podocyte polysomes than what would be expected from the podocyte population in the glomerulus. These genes also showed a higher enrichment in polysomes of primary cultured podocytes compared with housekeeping genes. This finding implies that mRNAs of these genes are concentrated in polysomes by posttranscriptional regulation and are preferentially translated. Shigeoka et al. (35) performed global translatome analysis of the retinal ganglion cell axon utilizing RiboTag mice. They demonstrated that mRNAs are concentrated in the polysome when and where necessary; therefore, it is conceivable that these highly enriched genes have functionally important roles for podocyte maintenance.
Grgic et al. (13) described the profile of podocyte-enriched mRNAs obtained from the Col1α1-eGFP-L10a (PodoTRAP) mice, which displayed eGFP tagged ribosomes. We found that 66.3% of the podocyte-enriched genes in their study were also enriched in podocytes in our present study. This difference may be caused by different comparison subjects; their study used the renal cortex whereas we have used the glomeruli. Additionally, they analyzed the gene expression changes using an FSGS model (Actn4-KO mice). Interestingly, many genes were commonly up- or downregulated in Actn4-KO mice and NEP25 mice. Genes for the TNF signaling pathway are highly enriched in the commonly regulated genes. This indicates that common inflammation-like mechanisms could underlie the development of FSGS after podocyte damage. It should also be noted that the Col1α1 promoter of PodoTRAP mice may not be always specific to podocytes. Pericytes and myofibroblasts also have Col1α1 promoter activity (14). In addition, the promoter activity may be changed in injured podocytes. However, in Nphs1-RiboTag mice the HA tag is added to Rpl22 irreversibly and specifically in podocytes, and the HA-Rpl22 expression is driven by the endogenous Rpl22 promoter.
Our polysome analysis identified highly podocyte-enriched genes, many of which were downregulated after LMB2 injection. These genes included many that are known to play important roles in podocytes. We speculated that genes with similar expression patterns may include some functionally important genes that were previously unrecognized. In this regard, we found that Foxd2 mRNA was highly expressed in normal podocytes and downregulated after LMB2 injection similarly to Foxc2, which is known to play an important role in maintaining normal podocyte integrity (27). No abnormal phenotype was reported for podocytes of Foxd2 knockout mice (21). Nevertheless, it remains conceivable that Foxd2 may collaborate with other Fox members. In this study, we found that suppression of Foxd2 by siRNA in primary cultured podocytes decreased DNA synthesis and proliferation. Interpretation of this phenomenon is difficult because in vivo, podocytes do not proliferate; however, it suggests that Foxd2 could maintain podocyte integrity. Foxd2 knockdown also decreased Podxl and Dpp4 mRNAs, which are Foxc2 targets, further supporting a potentially important role of Foxd2 in podocytes.
We were also interested in Dach1, because DACH1 has been reported to be associated with CKD (18, 30). Dach1 is a putative transcription factor and has been reported to be related to cell fate determination by collaborating with Pax2, Six1, Six2, Eya1, and Eya2 (1). Homozygous mutation in the Dach1 gene leads to postnatal lethality in mice (6). DACH1 protein is highly expressed in adult podocytes and is decreased in kidneys with immunoglobulin A nephropathy, idiopathic membranous nephropathy, or minimal change disease (22). We confirmed in this study that Dach1 mRNA and protein were abundant in normal podocytes but that they decreased after LMB2 injection. Endlich et al. (8) reported that knockdown of the zebrafish ortholog Dachd resulted in downregulation of nephrin and foot process formation in glomeruli. They also showed that the transfection of parietal epithelial cells with a plasmid encoding for Dach1 induced the expression of synaptopodin; however, decrease of synaptopodin mRNA was not observed in our knockdown assay of murine primary podocytes. Cancer research has shown that Dach1 restrains cell proliferation and migration by inhibiting Cyclin D1 expression (5, 23, 39). As podocytes do not proliferate even after LMB2 induced injury, Dach1 may have a completely different role in podocytes. In support of this notion, we found that Dach1 suppression in primary cultured podocytes decreased proliferation. Zhou et al. (40) reported that Dach1 may bind to the same site as Fox. In this study, we tested the effect of Dach1 knockdown on several Fox target genes in primary cultured podocytes and found that Dach1 siRNA decreased Dpp4 and Podxl mRNAs. This suggests that Dach1 may modulate or collaborate with Fox transcription factors in podocytes.
MafF and MafB belong to the same Maf protein family, have highly conserved DNA binding domains, and recognize the same DNA-binding motif (17); however, unlike MafB, MafF lacks the transcriptional activation domain. Likewise, Egr-1 and WT1 belong to the same Egr family and share an almost identical binding motif (26, 28). The transactivation domains are not conserved between Egr-1 and WT1. Both WT1 and MafB are intensely expressed in podocytes and are indispensable for maintaining the differentiation state of podocytes. Therefore, it is conceivable that the induction of MafF and Egr-1 in injured podocytes can actively antagonize MafB and WT1, respectively. In this study, we found that Egr1 and Maff mRNAs were already increased in murine primary cultured podocytes under basal conditions. Maff knockdown increased Nphs2 and Ptpro mRNAs, which are MafB targets, and Egr1 knockdown increased WT1 targets Ptpro, Nxph3, and Sulf1 mRNAs in primary podocytes (7, 34). In this regard, competition between other Maf protein members or between Egr-1 and WT1 has been reported (11, 29, 31).
NEP25 mice 4 days after LMB2 injection displayed only slightly decreased Wt1 levels with no decrease in Mafb, whereas Maff and Egr1 increased by 874- and 70.1-fold, respectively. This suggests that in the early phase of podocyte injury, MafB and WT1 signals are actively shut down, not by downregulation of the transcription factors themselves but by rapid induction of their counteracting factors. It is interesting to know whether such a mechanism would have a biological merit. The possibility exists that dedifferentiated podocytes may in some situations help the repair processes, such as cellular migration and hypertrophy. MafF and Egr-1 are well-known early response gene members. Thus, rapid activation of these transcription factors by stress in podocytes expands podocyte damage. Inhibition of MafF and Egr-1 may prevent this auto-dedifferentiation of injured podocytes; therefore, MafF and Egr-1 may be novel drug targets for preventing progressive podocyte deterioration.
In conclusion, the RiboTag method was a useful tool for isolating podocyte specific mRNAs, and we obtained podocyte-specific translatomes in normal and damaged conditions. These translatomes may reveal the mechanism of podocyte injury, leading to cessation of CKD progression.
GRANTS
This study was supported by a Grant-in-Aid for Scientific Research by the Japan Society for the Promotion of Science.
DISCLOSURES
I. Pastan is an inventor on several patents on immunotoxins that have all been assigned to the NIH. None of the other authors have any conflicts of interest, financial or otherwise, to disclose.
AUTHOR CONTRIBUTIONS
M.O. and T.M. conceived and designed research; M.O. performed experiments; M.O. and T.M. analyzed data; M.O. and T.M. interpreted results of experiments; M.O. and T.M. prepared figures; M.O. drafted manuscript; M.M., Y.M., I.P., T.Y., and T.M. edited and revised manuscript; T.M. approved final version of manuscript.
Supplemental Data
Table S1: Enriched genes in normal podocytes and enrichment analyses - .xlsx (391 KB)
Table S2: Down-regulated genes among highly podocyte-enriched genes after podocyte injury - .xlsx (27 KB)
Table S3: Down-regulated genes in injured podocytes and enrichment analyses - .xlsx (475 KB)
Table S4: Up-regulated genes in injured podocytes and enrichment analyses - .xlsx (400 KB)
Table S5: Commonly regulated genes in podocytes of PodTRAP;Actn4-/- mice and Nphs1-RiboTag-NEP25 mice after immunotoxin injection - .xlsx (20 KB)
ACKNOWLEDGMENTS
We acknowledge Shiho Imai, Chika Sato, and Chie Sakurai, as well as the Support Center for Medical Research and Education of Tokai University for excellent technical assistance. Additionally, we acknowledge Yukiko Tanaka for administrative assistance.
Parts of this study were presented as abstracts at the annual meeting of the American Society of Nephrology in 2015, 2017, and 2018.
REFERENCES
- 1.Ayres JA, Shum L, Akarsu AN, Dashner R, Takahashi K, Ikura T, Slavkin HC, Nuckolls GH. DACH: genomic characterization, evaluation as a candidate for postaxial polydactyly type A2, and developmental expression pattern of the mouse homologue. Genomics 77: 18–26, 2001. doi: 10.1006/geno.2001.6618. [DOI] [PubMed] [Google Scholar]
- 2.Boerries M, Grahammer F, Eiselein S, Buck M, Meyer C, Goedel M, Bechtel W, Zschiedrich S, Pfeifer D, Laloë D, Arrondel C, Gonçalves S, Krüger M, Harvey SJ, Busch H, Dengjel J, Huber TB. Molecular fingerprinting of the podocyte reveals novel gene and protein regulatory networks. Kidney Int 83: 1052–1064, 2013. doi: 10.1038/ki.2012.487. [DOI] [PubMed] [Google Scholar]
- 3.Brunskill EW, Georgas K, Rumballe B, Little MH, Potter SS. Defining the molecular character of the developing and adult kidney podocyte. PLoS One 6: e24640, 2011. doi: 10.1371/journal.pone.0024640. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Chandra R, Engeln M, Francis TC, Konkalmatt P, Patel D, Lobo MK. A role for peroxisome proliferator-activated receptor gamma coactivator-1α in nucleus accumbens neuron subtypes in cocaine action. Biol Psychiatry 81: 564–572, 2017. doi: 10.1016/j.biopsych.2016.10.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Chen K, Wu K, Jiao X, Wang L, Ju X, Wang M, Di Sante G, Xu S, Wang Q, Li K, Sun X, Xu C, Li Z, Casimiro MC, Ertel A, Addya S, McCue PA, Lisanti MP, Wang C, Davis RJ, Mardon G, Pestell RG. The endogenous cell-fate factor dachshund restrains prostate epithelial cell migration via repression of cytokine secretion via a cxcl signaling module. Cancer Res 75: 1992–2004, 2015. doi: 10.1158/0008-5472.CAN-14-0611. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Davis RJ, Shen W, Sandler YI, Amoui M, Purcell P, Maas R, Ou CN, Vogel H, Beaudet AL, Mardon G. Dach1 mutant mice bear no gross abnormalities in eye, limb, and brain development and exhibit postnatal lethality. Mol Cell Biol 21: 1484–1490, 2001. doi: 10.1128/MCB.21.5.1484-1490.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Dong L, Pietsch S, Tan Z, Perner B, Sierig R, Kruspe D, Groth M, Witzgall R, Gröne HJ, Platzer M, Englert C. Integration of cistromic and transcriptomic analyses identifies Nphs2, Mafb, and Magi2 as Wilms’ tumor 1 target genes in podocyte differentiation and maintenance. J Am Soc Nephrol 26: 2118–2128, 2015. doi: 10.1681/ASN.2014080819. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Endlich N, Kliewe F, Kindt F, Schmidt K, Kotb AM, Artelt N, Lindenmeyer MT, Cohen CD, Döring F, Kuss AW, Amann K, Moeller MJ, Kabgani N, Blumenthal A, Endlich K. The transcription factor Dach1 is essential for podocyte function. J Cell Mol Med 22: 2656–2669, 2018. doi: 10.1111/jcmm.13544. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Evans E, Hogarth C, Mitchell D, Griswold M. Riding the spermatogenic wave: profiling gene expression within neonatal germ and sertoli cells during a synchronized initial wave of spermatogenesis in mice. Biol Reprod 90: 108, 2014. doi: 10.1095/biolreprod.114.118034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Everett LA, Cleuren ACA, Khoriaty RN, Ginsburg D. Murine coagulation factor VIII is synthesized in endothelial cells. Blood 123: 3697–3705, 2014. doi: 10.1182/blood-2014-02-554501. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Gannon AM, Turner EC, Reid HM, Kinsella BT. Regulated expression of the alpha isoform of the human thromboxane A2 receptor during megakaryocyte differentiation: a coordinated role for WT1, Egr1, and Sp1. J Mol Biol 394: 29–45, 2009. doi: 10.1016/j.jmb.2009.09.007. [DOI] [PubMed] [Google Scholar]
- 12.De Gendt K, Verhoeven G, Amieux PS, Wilkinson MF. Genome-wide identification of AR-regulated genes translated in Sertoli cells in vivo using the RiboTag approach. Mol Endocrinol 28: 575–591, 2014. doi: 10.1210/me.2013-1391. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Grgic I, Hofmeister AF, Genovese G, Bernhardy AJ, Sun H, Maarouf OH, Bijol V, Pollak MR, Humphreys BD. Discovery of new glomerular disease-relevant genes by translational profiling of podocytes in vivo. Kidney Int 86: 1116–1129, 2014. doi: 10.1038/ki.2014.204. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Grgic I, Krautzberger AM, Hofmeister A, Lalli M, DiRocco DP, Fleig SV, Liu J, Duffield JS, McMahon AP, Aronow B, Humphreys BD. Translational profiles of medullary myofibroblasts during kidney fibrosis. J Am Soc Nephrol 25: 1979–1990, 2014. doi: 10.1681/ASN.2013101143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Hörnberg H, Cioni J-M, Harris WA, Holt CE. Hermes regulates axon sorting in the optic tract by post-trancriptional regulation of neuropilin 1. J Neurosci 36: 12697–12706, 2016. doi: 10.1523/JNEUROSCI.2400-16.2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Kann M, Ettou S, Jung YL, Lenz MO, Taglienti ME, Park PJ, Schermer B, Benzing T, Kreidberg JA. Genome-wide analysis of Wilms’ tumor 1-controlled gene expression in podocytes reveals key regulatory mechanisms. J Am Soc Nephrol 26: 2097–2104, 2015. doi: 10.1681/ASN.2014090940. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Katsuoka F, Yamamoto M. Small Maf proteins (MafF, MafG, MafK): history, structure and function. Gene 586: 197–205, 2016. doi: 10.1016/j.gene.2016.03.058. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Köttgen A, Pattaro C, Böger CA, Fuchsberger C, Olden M, Glazer NL, Parsa A, Gao X, Yang Q, Smith AV, O’Connell JR, Li M, Schmidt H, Tanaka T, Isaacs A, Ketkar S, Hwang SJ, Johnson AD, Dehghan A, Teumer A, Paré G, Atkinson EJ, Zeller T, Lohman K, Cornelis MC, Probst-Hensch NM, Kronenberg F, Tönjes A, Hayward C, Aspelund T, Eiriksdottir G, Launer LJ, Harris TB, Rampersaud E, Mitchell BD, Arking DE, Boerwinkle E, Struchalin M, Cavalieri M, Singleton A, Giallauria F, Metter J, de Boer IH, Haritunians T, Lumley T, Siscovick D, Psaty BM, Zillikens MC, Oostra BA, Feitosa M, Province M, de Andrade M, Turner ST, Schillert A, Ziegler A, Wild PS, Schnabel RB, Wilde S, Munzel TF, Leak TS, Illig T, Klopp N, Meisinger C, Wichmann HE, Koenig W, Zgaga L, Zemunik T, Kolcic I, Minelli C, Hu FB, Johansson A, Igl W, Zaboli G, Wild SH, Wright AF, Campbell H, Ellinghaus D, Schreiber S, Aulchenko YS, Felix JF, Rivadeneira F, Uitterlinden AG, Hofman A, Imboden M, Nitsch D, Brandstätter A, Kollerits B, Kedenko L, Mägi R, Stumvoll M, Kovacs P, Boban M, Campbell S, Endlich K, Völzke H, Kroemer HK, Nauck M, Völker U, Polasek O, Vitart V, Badola S, Parker AN, Ridker PM, Kardia SLR, Blankenberg S, Liu Y, Curhan GC, Franke A, Rochat T, Paulweber B, Prokopenko I, Wang W, Gudnason V, Shuldiner AR, Coresh J, Schmidt R, Ferrucci L, Shlipak MG, van Duijn CM, Borecki I, Krämer BK, Rudan I, Gyllensten U, Wilson JF, Witteman JC, Pramstaller PP, Rettig R, Hastie N, Chasman DI, Kao WH, Heid IM, Fox CS. New loci associated with kidney function and chronic kidney disease. Nat Genet 42: 376–384, 2010. doi: 10.1038/ng.568. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kreitman RJ, Pastan I. Accumulation of a recombinant immunotoxin in a tumor in vivo: fewer than 1000 molecules per cell are sufficient for complete responses. Cancer Res 58: 968–975, 1998. [PubMed] [Google Scholar]
- 20.Kuleshov MV, Jones MR, Rouillard AD, Fernandez NF, Duan Q, Wang Z, Koplev S, Jenkins SL, Jagodnik KM, Lachmann A, McDermott MG, Monteiro CD, Gundersen GW, Ma’ayan A. Enrichr: a comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Res 44: W90–W97, 2016. doi: 10.1093/nar/gkw377. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Kume T, Deng K, Hogan BL. Minimal phenotype of mice homozygous for a null mutation in the forkhead/winged helix gene, Mf2. Mol Cell Biol 20: 1419–1425, 2000. doi: 10.1128/MCB.20.4.1419-1425.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Liu Q-Q, Zhou YQ, Liu H-Q, Qiu WH, Liu H, Hu T-Y, Xu Q, Lv Y-M, Wu K-M. Decreased DACH1 expression in glomerulopathy is associated with disease progression and severity. Oncotarget 7: 86547–86560, 2016. doi: 10.18632/oncotarget.13470. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Liu Y, Han N, Zhou S, Zhou R, Yuan X, Xu H, Zhang C, Yin T, Wu K. The DACH/EYA/SIX gene network and its role in tumor initiation and progression. Int J Cancer 138: 1067–1075, 2016. doi: 10.1002/ijc.29560. [DOI] [PubMed] [Google Scholar]
- 24.Matsusaka T, Sandgren E, Shintani A, Kon V, Pastan I, Fogo AB, Ichikawa I. Podocyte injury damages other podocytes. J Am Soc Nephrol 22: 1275–1285, 2011. doi: 10.1681/ASN.2010090963. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Matsusaka T, Xin J, Niwa S, Kobayashi K, Akatsuka A, Hashizume H, Wang Q-C, Pastan I, Fogo AB, Ichikawa I. Genetic engineering of glomerular sclerosis in the mouse via control of onset and severity of podocyte-specific injury. J Am Soc Nephrol 16: 1013–1023, 2005. doi: 10.1681/ASN.2004080720. [DOI] [PubMed] [Google Scholar]
- 26.Motamedi FJ, Badro DA, Clarkson M, Lecca MR, Bradford ST, Buske FA, Saar K, Hübner N, Brändli AW, Schedl A. WT1 controls antagonistic FGF and BMP-pSMAD pathways in early renal progenitors. Nat Commun 5: 4444, 2014. doi: 10.1038/ncomms5444. [DOI] [PubMed] [Google Scholar]
- 27.Motojima M, Kume T, Matsusaka T. Foxc1 and Foxc2 are necessary to maintain glomerular podocytes. Exp Cell Res 352: 265–272, 2017. doi: 10.1016/j.yexcr.2017.02.016. [DOI] [PubMed] [Google Scholar]
- 28.Nakagama H, Heinrich G, Pelletier J, Housman DE. Sequence and structural requirements for high-affinity DNA binding by the WT1 gene product. Mol Cell Biol 15: 1489–1498, 1995. doi: 10.1128/MCB.15.3.1489. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Nomoto H, Kondo T, Miyoshi H, Nakamura A, Hida Y, Yamashita K, Sharma AJ, Atsumi T. Inhibition of small Maf function in pancreatic β-cells improves glucose tolerance through the enhancement of insulin gene transcription and insulin secretion. Endocrinology 156: 3570–3580, 2015. doi: 10.1210/en.2014-1906. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Pattaro C, Teumer A, Gorski M, Chu AY, Li M, Mijatovic V, Garnaas M, Tin A, Sorice R, Li Y, Taliun D, Olden M, Foster M, Yang Q, Chen M-H, Pers TH, Johnson AD, Ko Y-A, Fuchsberger C, Tayo B, Nalls M, Feitosa MF, Isaacs A, Dehghan A, d’Adamo P, Adeyemo A, Dieffenbach AK, Zonderman AB, Nolte IM, van der Most PJ, Wright AF, Shuldiner AR, Morrison AC, Hofman A, Smith AV, Dreisbach AW, Franke A, Uitterlinden AG, Metspalu A, Tonjes A, Lupo A, Robino A, Johansson Å, Demirkan A, Kollerits B, Freedman BI, Ponte B, Oostra BA, Paulweber B, Krämer BK, Mitchell BD, Buckley BM, Peralta CA, Hayward C, Helmer C, Rotimi CN, Shaffer CM, Müller C, Sala C, van Duijn CM, Saint-Pierre A, Ackermann D, Shriner D, Ruggiero D, Toniolo D, Lu Y, Cusi D, Czamara D, Ellinghaus D, Siscovick DS, Ruderfer D, Gieger C, Grallert H, Rochtchina E, Atkinson EJ, Holliday EG, Boerwinkle E, Salvi E, Bottinger EP, Murgia F, Rivadeneira F, Ernst F, Kronenberg F, Hu FB, Navis GJ, Curhan GC, Ehret GB, Homuth G, Coassin S, Thun G-A, Pistis G, Gambaro G, Malerba G, Montgomery GW, Eiriksdottir G, Jacobs G, Li G, Wichmann H-E, Campbell H, Schmidt H, Wallaschofski H, Völzke H, Brenner H, Kroemer HK, Kramer H, Lin H, Leach IM, Ford I, Guessous I, Rudan I, Prokopenko I, Borecki I, Heid IM, Kolcic I, Persico I, Jukema JW, Wilson JF, Felix JF, Divers J, Lambert J-C, Stafford JM, Gaspoz J-M, Smith JA, Faul JD, Wang JJ, Ding J, Hirschhorn JN, Attia J, Whitfield JB, Chalmers J, Viikari J, Coresh J, Denny JC, Karjalainen J, Fernandes JK, Endlich K, Butterbach K, Keene KL, Lohman K, Portas L, Launer LJ, Lyytikäinen L-P, Yengo L, Franke L, Ferrucci L, Rose LM, Kedenko L, Rao M, Struchalin M, Kleber ME, Cavalieri M, Haun M, Cornelis MC, Ciullo M, Pirastu M, de Andrade M, McEvoy MA, Woodward M, Adam M, Cocca M, Nauck M, Imboden M, Waldenberger M, Pruijm M, Metzger M, Stumvoll M, Evans MK, Sale MM, Kähönen M, Boban M, Bochud M, Rheinberger M, Verweij N, Bouatia-Naji N, Martin NG, Hastie N, Probst-Hensch N, Soranzo N, Devuyst O, Raitakari O, Gottesman O, Franco OH, Polasek O, Gasparini P, Munroe PB, Ridker PM, Mitchell P, Muntner P, Meisinger C, Smit JH, Kovacs P, Wild PS, Froguel P, Rettig R, Mägi R, Biffar R, Schmidt R, Middelberg RP, Carroll RJ, Penninx BW, Scott RJ, Katz R, Sedaghat S, Wild SH, Kardia SL, Ulivi S, Hwang SJ, Enroth S, Kloiber S, Trompet S, Stengel B, Hancock SJ, Turner ST, Rosas SE, Stracke S, Harris TB, Zeller T, Zemunik T, Lehtimäki T, Illig T, Aspelund T, Nikopensius T, Esko T, Tanaka T, Gyllensten U, Völker U, Emilsson V, Vitart V, Aalto V, Gudnason V, Chouraki V, Chen WM, Igl W, März W, Koenig W, Lieb W, Loos RJ, Liu Y, Snieder H, Pramstaller PP, Parsa A, O’Connell JR, Susztak K, Hamet P, Tremblay J, de Boer IH, Böger CA, Goessling W, Chasman DI, Köttgen A, Kao WH, Fox CS; ICBP Consortium; AGEN Consortium; CARDIOGRAM; CHARGe-Heart Failure Group; ECHOGen Consortium . Genetic associations at 53 loci highlight cell types and biological pathways relevant for kidney function. Nat Commun 7: 10023, 2016. doi: 10.1038/ncomms10023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Ritchie MF, Zhou Y, Soboloff J. WT1/EGR1-mediated control of STIM1 expression and function in cancer cells. Front Biosci (Landmark Ed) 16: 2402–2415, 2011. doi: 10.2741/3862. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Sanz E, Evanoff R, Quintana A, Evans E, Miller JA, Ko C, Amieux PS, Griswold MD, McKnight GS. RiboTag analysis of actively translated mRNAs in Sertoli and Leydig cells in vivo. PLoS One 8: e66179, 2013. doi: 10.1371/journal.pone.0066179. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Sanz E, Yang L, Su T, Morris DR, McKnight GS, Amieux PS. Cell-type-specific isolation of ribosome-associated mRNA from complex tissues. Proc Natl Acad Sci USA 106: 13939–13944, 2009. doi: 10.1073/pnas.0907143106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Schumacher VA, Schlötzer-Schrehardt U, Karumanchi SA, Shi X, Zaia J, Jeruschke S, Zhang D, Pavenstädt H, Drenckhan A, Amann K, Ng C, Hartwig S, Ng K-H, Ho J, Kreidberg JA, Taglienti M, Royer-Pokora B, Ai X. WT1-dependent sulfatase expression maintains the normal glomerular filtration barrier. J Am Soc Nephrol 22: 1286–1296, 2011. [Erratum in J Am Soc Nephrol 22: 2332, 2011]. doi: 10.1681/ASN.2010080860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Shigeoka T, Jung H, Jung J, Turner-Bridger B, Ohk J, Lin JQ, Amieux PS, Holt CE. Dynamic axonal translation in developing and mature visual circuits. Cell 166: 181–192, 2016. doi: 10.1016/j.cell.2016.05.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Srinivasan R, Lu T-Y, Chai H, Xu J, Huang BS, Golshani P, Coppola G, Khakh BS. New transgenic mouse lines for selectively targeting astrocytes and studying calcium signals in astrocyte processes in situ and in vivo. Neuron 92: 1181–1195, 2016. doi: 10.1016/j.neuron.2016.11.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Takemoto M, He L, Norlin J, Patrakka J, Xiao Z, Petrova T, Bondjers C, Asp J, Wallgard E, Sun Y, Samuelsson T, Mostad P, Lundin S, Miura N, Sado Y, Alitalo K, Quaggin SE, Tryggvason K, Betsholtz C. Large-scale identification of genes implicated in kidney glomerulus development and function. EMBO J 25: 1160–1174, 2006. doi: 10.1038/sj.emboj.7601014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Wiggins RC. The spectrum of podocytopathies: a unifying view of glomerular diseases. Kidney Int 71: 1205–1214, 2007. doi: 10.1038/sj.ki.5002222. [DOI] [PubMed] [Google Scholar]
- 39.Wu K, Li A, Rao M, Liu M, Dailey V, Yang Y, Di Vizio D, Wang C, Lisanti MP, Sauter G, Russell RG, Cvekl A, Pestell RG. DACH1 is a cell fate determination factor that inhibits cyclin D1 and breast tumor growth. Mol Cell Biol 26: 7116–7129, 2006. doi: 10.1128/MCB.00268-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Zhou J, Wang C, Wang Z, Dampier W, Wu K, Casimiro MC, Chepelev I, Popov VM, Quong A, Tozeren A, Zhao K, Lisanti MP, Pestell RG. Attenuation of Forkhead signaling by the retinal determination factor DACH1. Proc Natl Acad Sci USA 107: 6864–6869, 2010. doi: 10.1073/pnas.1002746107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Zhu Y, Lyapichev K, Lee DH, Motti D, Ferraro NM, Zhang Y, Yahn S, Soderblom C, Zha J, Bethea JR, Spiller KL, Lemmon VP, Lee JK. Macrophage transcriptional profile identifies lipid catabolic pathways that can be therapeutically targeted after spinal cord injury. J Neurosci 37: 2362–2376, 2017. doi: 10.1523/JNEUROSCI.2751-16.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Table S1: Enriched genes in normal podocytes and enrichment analyses - .xlsx (391 KB)
Table S2: Down-regulated genes among highly podocyte-enriched genes after podocyte injury - .xlsx (27 KB)
Table S3: Down-regulated genes in injured podocytes and enrichment analyses - .xlsx (475 KB)
Table S4: Up-regulated genes in injured podocytes and enrichment analyses - .xlsx (400 KB)
Table S5: Commonly regulated genes in podocytes of PodTRAP;Actn4-/- mice and Nphs1-RiboTag-NEP25 mice after immunotoxin injection - .xlsx (20 KB)



