Skip to main content
NCBI home page
Heliyon logoLink to Heliyon
. 2019 Apr 2;5(4):e01418. doi: 10.1016/j.heliyon.2019.e01418

Verification of miRNAs in ginseng decoction by high-throughput sequencing and quantitative real-time PCR

Yingfang Wang a,b,∗, Mengyuan Peng a, Wenjuan Wang a, Yanlin Chen a, Zhihua He a, Jingjing Cao a, Zhiyun Lin a, Zemin Yang c, Mengjuan Gong a, Yongqin Yin a
PMCID: PMC6446053  PMID: 30984884

Abstract

Panax ginseng C. A. Meyer is a precious traditional Chinese medicine that has been clinically used for over thousands of years. In general, ginseng needs to be prepared to ginseng decoction before taking it. MicroRNAs are a class of small (18–24 nt), single-stranded molecules that regulate gene expression at the post-transcriptional level. Considering that ginseng miRNAs may be bioactive compounds, we used Illumina high-throughput sequencing and quantitative real-time PCR (qRT-PCR) to validate the existence of miRNAs in fresh ginseng decoction which have been boiled at high temperature. Our previous studies have demonstrated that there are several miRNAs in fresh ginseng. The roots of fresh Panax ginseng were prepared according to routine methods, from which miRNAs were extracted and sequenced. A total of 43 miRNAs were identified from water decoction by Illumina high-throughput sequencing, belonging to 71 miRNA families. The target genes of these miRNAs were predicted by sequencing, and were annotated by GO, KEGG and Nr databases. The functions of these target genes mainly included plant hormone signal transduction, transcription regulation, macromolecular metabolism and auxin signaling. Nine highly expressed miRNAs (miR159, miR167, miR396, miR166, miR168, miR156, miR165, miR162 and miR394) were verified by qRT-PCR, and the results of Illumina high-throughput sequencing and qRT-PCR were consistent. Results from this study indicate that miRNAs remained stable in P. ginseng after high-temperature boiling. Additionally, Illumina high-throughput sequencing was superior in the acquisition of higher amount of small RNAs.

Keywords: Bioinformatics, Molecular biology

1. Introduction

Panax ginseng C. A. Meyer which belongs to the Araliaceae family has been regarded as an important traditional Chinese medicine in north-eastern Asia. It has been used for human health for several millennia. During long-term empirical clinical use, ginseng is mostly prepared by boiling with water into decoctions (water extracts) for oral administration (S. S. Zhou et al., 2016). The presence of small molecules in the decoctions of Glycyrrhiza uralensis, Lonicera japonica (miR2911) and Oryza sativa (miR168a) has been well-proved (Shao et al., 2015; Zhang et al., 2012; Z. Zhou et al., 2015). Whether miRNAs exist in ginseng decoction is unknown, so studies on the molecular level are of great significance to the innovation of ginseng.

MiRNAs are endogenous non-protein coding RNAs with the lengths of approximately 22 nucleotides (nt), which negatively regulate gene expressions by complementarily binding the ORF or UTR regions of target messenger RNAs(Liang et al., 2010). They are widespread in animals and plants, being more stable in vivo (Ludwig et al., 2017). MiRNAs can be detected with a variety of technologies, including quantitative PCR, microarrays, solution-based hybridization, etc. (Roberts et al., 2015). Due to satisfactory technical performance, high-throughput sequencing is also a powerful method for the discovery and quantification of miRNAs(Alon et al., 2011). The aim of this study was to detect miRNAs in ginseng decoction by high-throughput sequencing, and to confirm the results by quantitative real-time PCR (qRT-PCR). The findings provide a theoretical basis for molecular pharmacology studies of ginseng.

2. Materials and methods

2.1. Preparation of plant materials

Six-year-old fresh ginseng plant originating from China Changbai Mountain (Jilin Province, China) was purchased from Qingping Chinese Herbal Medicine Market. The plant was washed by tap water to remove sticky soil, sterilized with 70% ethanol solution for 1 min, washed with sterile water, and dried on disinfected filter paper. Afterwards, fresh ginseng root (30 g) was chopped, added 8 times the amount of water, soaked for 30 min, boiled at 85 °C for 2 h, and filtered. Then the residue was added 8 times the amount of water and filtered. The two filtrates were combined, appropriately concentrated, and finally stored in a −80 °C refrigerator.

2.2. Small RNA library construction

MiRNAs were isolated from collected seedlings by miRNA kit (Bioteke, China) following the manufacturer's instructions. Polyacrylamide gel electrophoresis was used to enrich RNA molecules with the sizes of 18–30 nt. Then 3′ adapters were added and 36–44 nt RNAs were enriched, to which 5′ adapters were then ligated. The ligated products were reversely transcribed by PCR amplification, and 140-160bp PCR products were enriched to generate a cDNA library which was thereafter sequenced by using Illumina HiSeqTM 2500 (Gene Denovo Biotechnology Co., Guangzhou, China).

2.3. Identification of known miRNAs in ginseng decoction

Reads obtained from sequencing included dirty reads containing adapters or low-quality bases. Dirty reads affected subsequent assembly and analysis. Thus, raw reads were further filtered according to the following rules:(i) removal of low-quality reads containing more than one low-quality (Q-value≤20) base or unknown nucleotides(N); (ii)removal of reads without 3′adapters or containing 5′adapters; (iii) removal of reads containing 3′ and 5′ adapters but no small RNA fragment between them; (iv)removal of reads containing ploy A in small RNA fragment; (v)removal of reads shorter than 18nt (not including adapters). All clean tags were aligned with small RNAs in the GenBank database (Release 209.0) to identify and to remove rRNA, scRNA, snoRNA, snRNA and tRNA. All the clean tags were also aligned with reference genome. These tags were removed because those mapped to exons or introns may be fragments from mRNA degradation. Moreover, the tags mapped to repeat sequences were also removed (Kozomara and Griffiths-Jones, 2014).

2.4. Identification of novel miRNAs in ginseng decoction

All clean tags were then searched against the miRBase database (Release 21.0; all plant species database) to identify known miRNAs (existing miRNAs). So far, the miRNA sequences of some species have not been included in the miRBase database. For these species, known miRNAs were identified through alignment with those of other species. All unannotated tags were aligned with reference genome. According to the genome positions and hairpin structures predicted by Mireap_v0.2 software, novel miRNA candidates were identified. After tags were annotated as mentioned previously, the annotation results were determined following a descending order of rRNA > existing miRNA > existing miRNA edit > known miRNA > repeat > exon > novel miRNA > intron. The tags that cannot be annotated as any of the above molecules were recorded as unann (Deng et al., 2017; Islam et al., 2015).

2.5. Analysis of miRNAs expression profiles in ginseng decoction

Total miRNA consists of existing miRNA, known miRNA and novel miRNA. The miRNA expression level in each sample was calculated and normalized to transcripts per million (TPM) using the equation below:

TPM = Actual miRNA counts/total counts of clean tags×106

In addition, the expression levels of existing miRNA, known miRNA and novel miRNA were also analyzed individually.

Meanwhile, miRNA families were analyzed to clarify whether the miRNAs existed in other species. The analysis result was marked as “+” or “-” which corresponded to existing or non-existing.

2.6. Prediction of miRNA target genes

Based on the sequences of existing, known and novel miRNAs, the candidate target genes were predicted as follows (Allen et al., 2005; Schwab et al., 2005):(i) no more than four mismatches between small RNA and target (G-Ubases: 0 to 5mismatches); (ii) no more than two adjacent mismatches between miRNA and target duplex; (iii) no adjacent mismatches between sites 2 to 12 of miRNA and target duplex (5′ of miRNA); (iv) no mismatches between sites 10–11 of miRNA and target duplex; (v) no more than 2 to 5 mismatches between sites 1 to 12 of miRNA and target duplex (5′ of miRNA); (vi) minimum free energy of miRNA and target duplex should be ≥74% of that of the miRNA bound to its perfect complement.

2.7. qRT-PCR

qRT-PCR was carried out to validate differentially expressed miRNAs and their corresponding target unigenes that were chosen randomly. Based on mature miRNA sequences, forward primers were designed, and reverse primers were frequently used ones. U6 was employed as endogenous control. By using M-MLV reverse transcriptase (Promega, M1701) first-strand cDNAswere synthesized, and amplifications were performed with SYBR Green qPCR Super Mix (Invitrogen, C11744500). For miRNA targets, primers were designed using Beacon Designer version7.7 (Promega, USA), with 18S rRNA as endogenous control gene. Amplifications were performed with SYBR Green Real-time PCR Master Mix (Toyobo, Japan) and ABI PRISM® 7300 Sequence Detection System (Applied Biosystems, USA).

There lative expression levels of miRNAs were calculated by the 2-ΔΔCt method and compared with those of their targets as described previously. Each sample was tested in triplicate.

3. Results

3.1. Analysis of small RNA library

After raw data were sequenced, low-quality reads were removed, leaving clean reads. Then the fragment types, numbers and percentages of small RNAs in ginseng decoction were analyzed by the Solexa system (Table 1). Additionally, the types and numbers of small RNAs were calculated and their distribution was analyzed statistically (Fig. 1).

Table 1.

Fragment types, numbers and percent ages of small RNAs in ginseng decoction.

Fragment type Number Percentage
Clean reads 11692788 100%
High quality 10902997 93.2455%
3′adapter_null 21900 0.2009%
Insert null 238881 2.1910%
5′adapter contaminants 100218 0.9192%
Smaller than 18nt 2660169 24.3985%
polyA 45 0.0004%
low cutoff 165172 1.5149%
clean_tags 7716612 70.7751%
Open in a new tab

Fig. 1.

Fig. 1

Open in a new tab

Length distributions of small RNAs in ginseng decoction.

The small RNAs of different samples can be compared based on the length distributions of clean reads. In general, the length distribution of plant sample has a peak at 21/25bp. In some cases, such as viral infection and drug therapy, samples are more prone to mRNA degradation, generating more fragments that render the peak abnormal. Probably, the samples per se underwent RNA degradation after being decocted at high temperature.

3.2. Identification of known miRNAs

To identify known miRNAs in ginseng decoction, we compared our database with the miRNA precursors in the plant miRNA database (Release 21.0) to construct an expression profile (Lang et al., 2011; Yin et al., 2008). We obtained 29 miRNAs from ginseng decoction, and identified the secondary structures of 5 of them (Table 2) which were expressed in most plant species. At the same time, we analyzed the family of these miRNAs to explore its species belonging to other species, including O. sativa, Arabidopsis thaliana, Populus tremula, Triticum aestivum, Solanum lycopersicum, Brassica oleracea, Saccharum officinarum, Vitis vinifera, Zea mays, Sorghum bicolor, Gossypium hirsutum, Glycine max and other 23 species (Fig. 2). Comparing the miRNA sequences obtained from ginseng with conserved miRNAs in 23 plant species revealed that miR166, miR167 and miR159 existed in multiple plant families, indicating that they were widespread in plants.

Table 2.

Identification of known miRNAs from ginseng decoction.

Mature id Hair pin id Mature arm Hair pin energe (kcal/mol) Hair pin MFEI Mature seq Mature length (nt)
miR166-y m0001 3p −41.4 0.81 UCGGACCAGGCUUCAUUCCCC 21
miR167-x m0002 5p −64.9 1 UGAAGCUGCCAGCAUGAUCUA 21
miR319-y m0003 3p −82.6 0.94 UUGGACUGAAGGGAGCUCCCU 21
miR166-y m0004 3p −52 0.63 UCGGACCAGGCUUCAUUCCCC 21
miR159-y m0005 3p −79 0.95 UUUGGAUUGAAGGGAGCUCUA 21
Open in a new tab

Fig. 2.

Fig. 2

Open in a new tab

Circular heat map of conserved miRNAs identified in ginseng among different model plants. Each color represents a plant species and white color represents the absence of miRNA. MiRNA that was found in at least 9 plants was considered as conserved.

3.3. Identification of novel miRNAs

The principle of prediction is that the upstream of hairpin structure is highly conserved and located on the two arms of such structure (Ge et al., 2013; Tsai et al., 2014). A conserved restriction site generally does not offset the lower folding free energy of the hairpin precursor. The precursor of landmark hairpin structure as well as highly conserved mature plant sequences were searched against a related nucleic acid sequence database using the homologous search alignment method. Intercepting a certain length of the genome sequence alignment revealed its secondary structure, enzyme site information, energy and other characteristics.

To predict and to identify miRNAs newly discovered in ginseng decoction, we compared the genomes of plants with databases using Mireap_v0.2 software, and predicted the specific secondary structures of miRNAs to explore the possible existence of novel ones (He et al., 2015; Wan et al., 2012a; Wan et al., 2012b; Xu et al., 2015). We obtained a total of 84 sequences, 24 of which were aligned to the genome. Eventually, the specific structures of only 14 miRNAs were determined. As predicted by Mireap_v0.2 software, these 14 novel miRNAs were mostly 21 or 22 nt in length. The information of seven novel miRNAs is listed in Table 3.

Table 3.

Information of seven novel miRNAs.

Mature id Hairpin id Hairpin energe (kcal/mol) Hairpin MFEI Mature seq Mature length (nt)
novel-m0001-3p novel-m0001 −35.1 0.68 CCCGCCGGGGCGGGGGUGCCG 21
novel-m0003-5p novel-m0003 −69.8 0.68 GAGGGAGAGGGAGAGGGAGAGA 22
novel-m0005-3p novel-m0005 −61.6 0.5 GUGGUGGUGGUGGUGGUGGUGG 22
novel-m0010-3p novel-m0010 −27.2 0.56 AACGGAUCGCCCACUUCCUAC 21
novel-m0010-5p novel-m0010 −27.2 0.56 GGGAAUCGUGGGUGCCGUAGA 21
novel-m0011-3p novel-m0011 −107.4 0.66 GUGGUGGUGGUGGUGGUGGUGG 22
novel-m0012-5p novel-m0012 −37.8 0.65 GCGCGGUAGCGUUCGUGGUGG 21
Open in a new tab

3.4. Identified target genes of miRNAs

We performed complementary pairing of small RNAs and target genes by using PatMatch_v1.2 software, and then predicted the final results by programmed screening (Yan et al., 2005). Software prediction showed that 38 miRNAs in ginseng decoction corresponded to 2,238 target gene loci. Subsequently, all the predicted target genes were enriched by GO analysis to study the biological functions of all miRNAs after boiling at high temperature (Fig. 3). These target genes mainly involved intracellular material formation and pathways (formation of intracellular membranes, formation of cytoplasmic proton transport channels, formation of the cell membrane system, etc.), signal transduction, macromolecular metabolism and auxin signaling pathways. These biological functions participated in the entire growth and development processes of plants, playing important roles in energy metabolism and regulation.

Fig. 3.

Fig. 3

Open in a new tab

GO enrichment analysis of all predicted target genes in ginseng.

3.5. Validation of miRNAs and their target genes by qRT-PCR

Totally, we verified the expressions of 9 miRNAs retrieved from the database by qRT-PCR (Table 4, Fig. 4). The miRNA expressions of control group (fresh ginseng) and treatment group (ginseng decoction) were negatively correlated, which both decreased. Compared with the control group, the expression levels of target genes comp63622, comp59886, comp63996, comp63909 and comp47306 in the treatment group increased, whereas those of comp62398, comp64090, comp58543 and comp50760 decreased.

Table 4.

Primers of miRNAs of ginseng decoction used in the study.

miRNA Sequence
miR159-F 5′ ACACTCCAGCTGGGTTTGGATTGAAGGGAGCT
miR159-RT 5′CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTAGAGCTC
miR167-F 5′ ACACTCCAGCTGGGTGAAGCTGCCAGCATGAT
miR167-RT 5′ CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTAGATCAT
miR396-F 5′ ACACTCCAGCTGGGTTCCACAGCTTTCTTGAA
miR396-RT 5′CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAAGTTCAA
miR166-F: 5′ ACACTCCAGCTGGGTCGGACCAGGCTTCATTC
miR166-RF: 5′CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGGGGAATG
miR168-F: 5′ ACACTCCAGCTGGGTCGCTTGGTGCAGGTCGG
miR168-RT 5′ CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTTCCCGAC
miR156-F: 5′ ACACTCCAGCTGGGTTGACAGAAGAGAGTGAG
miR156-RT: 5′ CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGTGCTCAC
miR165-F: 5′ ACACTCCAGCTGGGTCGGACCAGGCTTCATCC
miR165-RT 5′ CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGGGGGATG
miR162-F: 5′ ACACTCCAGCTGGGTCGATAAACCTCTGCATC
miR162-RT 5′ CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTGGATGC
miR394-F: 5′ ACACTCCAGCTGGGTTGGCATTCTGTCCACC
miR394-RT: 5′ CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGGAGGTGG
miRNA-R 5′ CTCAACTGGTGTCGTGGA
U6-F: 5′ CTCGCTTCGGCAGCACA
U6-R: 5′ AACGCTTCACGAATTTGCGT
U6-RT: 5′ AACGCTTCACGAATTTGCGT
Open in a new tab

Fig. 4.

Fig. 4

Open in a new tab

Expressions of 9 miRNAs(A) and target genes(B).

4. Discussion

Since the first report, miRNAs have been found to widely exist in the nature, and miRNAs also commonly in Chinese herbal plants. For example, Yang et al. found a large number of miRNAs in Rehmannia glutinosa, extracted them from roots, stems and leaves, and identified them by high-throughput sequencing (Yang et al., 2011). The small RNA database of ginseng root, stem, leaf and flower has been constructed using high-throughput sequencing, confirming the abundance of such RNAs(Arata et al., 2012; Wu et al., 2012).

As a class of small, endogenous, single-stranded RNAs with the lengths of about 18–24 nt, miRNAs primarily regulate eukaryotic cells at the post-transcriptional level (Bartel, 2004). MiRNAs dominate in the growth and development of the body, metabolism and diseases.

Researchers have endeavored to identify miRNAs and then to study their functions. Bioinformatics analysis combined with high-throughput sequencing is one of the most effective methods for identifying miRNAs and predicting novel ones. Considerable miRNA sequences can be analyzed by high-throughput sequencing at once, and bioinformatics and software analyses allow large-scale prediction and identification of miRNAs(Xu et al., 2015).

MiRNAs in ginseng decoction were herein identified by high-throughput sequencing for the first time, and five known miRNAs and seven novel miRNAs were obtained by database comparison. Nine miRNAs and their target genes were selected for qRT-PCR, giving consistent results.

Ginseng is a rare Chinese herbal medicine with a long history of clinical application. It was reported that Panax ginseng and its active constituents has been used for various diseases and proven its great efficacy in managing neurodegenerative diseases (Rajabian et al., 2019), cancer (Li and Qi, 2019), and immune-modulation (Riaz et al., 2019), ect. As many TCMs are hepatotoxic, ginseng, especially ginsenosides, is widely used in the adjunctive therapy of the liver diseases. The hepatoprotective mechanisms of ginsenosides, such as anti-oxidation (Ning et al., 2018), anti-inflammation and effect on drug metabolism (Sun et al., 2019) in liver, have been well studies.

The existing research on the effective material basis of ginseng mostly focuses on ginsenosides, ginseng polysaccharides and other components. However, it cannot fully reveal the complex clinical effects of ginseng. This paper studies ginseng, high-throughput sequencing and qRT-PCR from the perspective of miRNAs, which confirm the existence of miRNAs in ginseng decoction. What needs to be further discussed is whether miRNAs in ginseng decoction can enter the body and play a role. The content can be found in the master's thesis (Wang, 2018) partly. The study of honeysuckle gives inspiration (Zhou et al., 2015), which will provide reference for ginseng research.

Declarations

Author contribution statement

Yingfang Wang: Conceived and designed the experiments, Wrote the paper.

Zemin Yang: Conceived and designed the experiments.

Mengyuan Peng, Wenjuan Wang: Analysed and interpreted the dara; Performed the experiments.

Zhihua He: performed the experiments.

Yanlin Chen, Jingjing Cao, Zhiyun Lin, Mengjuan Gong, Yongqin Yin: contributed reagents, materials, analysis tools or data.

Funding statement

This work was supported by grants from the National Natural Science Foundation for Young Scholars of China (81403195) and the Natural Science Foundation of Guangdong Province (S2013010015418).

Competing interest statement

The authors declare no conflict of interest.

Additional information

No additional information is available for this paper.

References

  1. Allen E., Xie Z.X., Gustafson A.M., Carrington J.C. microRNA-directed phasing during trans-acting siRNA biogenesis in plants. Cell. 2005;121(2):207–221. doi: 10.1016/j.cell.2005.04.004. [DOI] [PubMed] [Google Scholar]
  2. Alon S., Vigneault F., Eminaga S., Christodoulou D.C., Seidman J.G., Church G.M., Eisenberg E. Barcoding bias in high-throughput multiplex sequencing of miRNA. Genome Res. 2011;21(9):1506–1511. doi: 10.1101/gr.121715.111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Arata H., Komatsu H., Han A.S., Hosokawa K., Maeda M. Rapid microRNA detection using power-free microfluidic chip: coaxial stacking effect enhances the sandwich hybridization. Analyst. 2012;137(14):3234–3237. doi: 10.1039/c2an16154k. [DOI] [PubMed] [Google Scholar]
  4. Bartel D.P. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116(2):281–297. doi: 10.1016/s0092-8674(04)00045-5. [DOI] [PubMed] [Google Scholar]
  5. Deng M.J., Cao Y.B., Zhao Z.L., Yang L., Zhang Y.F., Dong Y.P., Fan G.Q. Discovery of MicroRNAs and their target genes related to drought in paulownia “Yuza 1” by high-throughput sequencing. Int J Genom. 2017 doi: 10.1155/2017/3674682. Artn 3674682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Ge A.J., Shangguan L., Zhang X., Dong Q.H., Han J., Liu H. Deep sequencing discovery of novel and conserved microRNAs in strawberry (Fragariaxananassa) Physiol. Plantarum. 2013;148(3):387–396. doi: 10.1111/j.1399-3054.2012.01713.x. [DOI] [PubMed] [Google Scholar]
  7. He D.L., Wang Q., Wang K., Yang P.F. Genome-Wide dissection of the MicroRNA expression profile in rice embryo during early stages of seed germination. PLoS One. 2015;10(12) doi: 10.1371/journal.pone.0145424. ARTN e0145424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Islam M.T., Ferdous A.S., Najnin R.A., Sarker S.K., Khan H. High-throughput sequencing reveals diverse sets of conserved, nonconserved, and species-specific miRNAs in jute. Int J Genom. 2015 doi: 10.1155/2015/125048. Artn 125048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Kozomara A., Griffiths-Jones S. miRBase: annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res. 2014;42(D1):D68–D73. doi: 10.1093/nar/gkt1181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Lang Q.L., Jin C.Z., Lai L.Y., Feng J.L., Chen S.N., Chen J.S. Tobacco microRNAs prediction and their expression infected with Cucumber mosaic virus and Potato virus X. Mol. Biol. Rep. 2011;38(3):1523–1531. doi: 10.1007/s11033-010-0260-6. [DOI] [PubMed] [Google Scholar]
  11. Li J.L., Qi Y.X. Ginsenoside Rg3 inhibits cell growth, migration and invasion in Caco-2 cells by downregulation of lncRNA CCAT1. Exp. Mol. Pathol. 2019;106:131–138. doi: 10.1016/j.yexmp.2019.01.003. [DOI] [PubMed] [Google Scholar]
  12. Liang C.W., Zhang X.W., Zou J., Xu D., Su F., Ye N.H. Identification of miRNA from porphyra yezoensis by high-throughput sequencing and bioinformatics analysis. PLoS One. 2010;5(5) doi: 10.1371/journal.pone.0010698. ARTN e10698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Ludwig N., Becker M., Schumann T., Speer T., Fehlmann T., Keller A., Meese E. Bias in recent miRBase annotations potentially associated with RNA quality issues. Sci. Rep. 2017;7 doi: 10.1038/s41598-017-05070-0. Artn 5162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ning C.Q., Gao X.G., Wang C.Y., Huo X.K., Liu Z.H., Sun H.J. Protective effects of ginsenoside Rg1 against lipopolysaccharide/D-galactosamine-induced acute liver injury in mice through inhibiting toll-like receptor 4 signaling pathway. Int. Immunopharmacol. 2018;61:266–276. doi: 10.1016/j.intimp.2018.06.008. [DOI] [PubMed] [Google Scholar]
  15. Rajabian A., Rameshrad M., Hosseinzadeh H. Therapeutic potential of Panax ginseng and its constituents, ginsenosides and gintonin, in neurological and neurodegenerative disorders: a patent review. Expert Opin. Ther. Pat. 2019;29(1):55–72. doi: 10.1080/13543776.2019.1556258. [DOI] [PubMed] [Google Scholar]
  16. Riaz M., Rahman N.U., Zia-Ul-Haq M., Jaffar H.Z.E., Manea R. Ginseng: a dietary supplement as immune-modulator in various diseases. Trends Food Sci. Technol. 2019;83:12–30. [Google Scholar]
  17. Roberts B.S., Hardigan A.A., Kirby M.K., Fitz-Gerald M.B., Wilcox C.M., Kimberly R.P., Myers R.M. Blocking of targeted microRNAs from next-generation sequencing libraries. Nucleic Acids Res. 2015;43(21) doi: 10.1093/nar/gkv724. ARTN e145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Schwab R., Palatnik J.F., Riester M., Schommer C., Schmid M., Weigel D. Specific effects of MicroRNAs on the plant transcriptome. Dev. Cell. 2005;8(4):517–527. doi: 10.1016/j.devcel.2005.01.018. [DOI] [PubMed] [Google Scholar]
  19. Shao Hong-wei, He Mian, Chen Jia-si, Chen Hui, Xiang Jing, Huang Shu-lin. Extraction of miRNA from Glycyrrhiza uralensis decoction and its effect on immune cells. Zhong yao cai Zhongyaocai J. Chin. Med. Mater. 2015;38(7):1449–1453. [PubMed] [Google Scholar]
  20. Sun H.Y., Yan Y.J., Li Y.H., Lv L. Reversing effects of ginsenosides on LPS-induced hepatic CYP3A11/3A4 dysfunction through the pregnane X receptor. J. Ethnopharmacol. 2019;229:246–255. doi: 10.1016/j.jep.2018.09.041. [DOI] [PubMed] [Google Scholar]
  21. Tsai C.C., Chiang Y.C., Weng I.S., Lin Y.S., Chou C.H. Evidence of purifying selection and Co-evolution at the fold-back arm of the novel precursor MicroRNA159 gene in phalaenopsis species (orchidaceae) PLoS One. 2014;9(12) doi: 10.1371/journal.pone.0114493. ARTN e114493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Wan L.C., Wang F., Guo X.Q., Lu S.F., Qiu Z.B., Zhao Y.Y. Identification and characterization of small non-coding RNAs from Chinese fir by high throughput sequencing. BMC Plant Biol. 2012;12 doi: 10.1186/1471-2229-12-146. Artn 146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Wan L.C., Zhang H.Y., Lu S.F., Zhang L., Qiu Z.B., Zhao Y.Y. Transcriptome-wide identification and characterization of miRNAs from Pinus densata. BMC Genomics. 2012;13 doi: 10.1186/1471-2164-13-132. Artn 132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Wang Wenjuan. Master) School of Guangdong Pharmaceutical University; 2018. miRNA sequencing of Changbai mountain Ginseng decoctionand its effect on partial target genes in rats with Ql deficiency. Available from Cnki. [Google Scholar]
  25. Wu B., Wang M.Z., Ma Y.M., Yuan L.C., Lu S.F. High-throughput sequencing and characterization of the small RNA transcriptome reveal features of novel and conserved MicroRNAs in Panax ginseng. PLoS One. 2012;7(9) doi: 10.1371/journal.pone.0044385. ARTN e44385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Xu L.N., Ling Y.H., Wang Y.Q., Wang Z.Y., Hu B.J., Zhou Z.Y. Identification of differentially expressed microRNAs between Bacillus thuringiensis Cry1Ab-resistant and -susceptible strains of Ostrinia furnacalis. Sci. Rep. 2015;5 doi: 10.1038/srep15461. Artn 15461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Yan T., Yoo D., Berardini T.Z., Mueller L.A., Weems D.C., Weng S. PatMatch: a program for finding patterns in peptide and nucleotide sequences. Nucleic Acids Res. 2005;33:W262–W266. doi: 10.1093/nar/gki368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Yang Y.H., Chen X.J., Chen J.Y., Xu H.X., Zhang Z.Y. Differential miRNA expression in Rehmannia glutinosa plants subjected to continuous cropping. BMC Plant Biol. 2011;11 doi: 10.1186/1471-2229-11-53. Artn 53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Yin Z.J., Li C.H., Han M.L., Shen F.F. Identification of conserved microRNAs and their target genes in tomato (Lycopersicon esculentum) Gene. 2008;414(1-2):60–66. doi: 10.1016/j.gene.2008.02.007. [DOI] [PubMed] [Google Scholar]
  30. Zhang L., Hou D.X., Chen X., Li D.H., Zhu L.Y., Zhang Y.J. Exogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence of cross-kingdom regulation by microRNA. Cell Res. 2012;22(1):107–126. doi: 10.1038/cr.2011.158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Zhou S.S., Xu J., Zhu H., Wu J., Xu J.D., Yan R. Gut microbiota-involved mechanisms in enhancing systemic exposure of ginsenosides by coexisting polysaccharides in ginseng decoction. Sci. Rep. 2016;6 doi: 10.1038/srep22474. Artn 22474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Zhou Z., Li X.H., Liu J.X., Dong L., Chen Q., Liu J.L. Honeysuckle-encoded atypical microRNA2911 directly targets influenza A viruses. Cell Res. 2015;25(1):39–49. doi: 10.1038/cr.2014.130. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Heliyon are provided here courtesy of Elsevier

RESOURCES