Skip to main content
Sage Choice logoLink to Sage Choice
. 2019 Apr 2;12:1178631019839010. doi: 10.1177/1178631019839010

De Novo Duplication in the CHD7 Gene Associated With Severe CHARGE Syndrome

Laura Pranckėnienė 1,, Eglė Preikšaitienė 1, Lucie Gueneau 2, Alexandre Reymond 2, Vaidutis Kučinskas 1
PMCID: PMC6446253  PMID: 31043788

Abstract

CHARGE syndrome is an autosomal dominant developmental disorder associated with a constellation of traits involving almost every organ and sensory system, in particular congenital anomalies, including choanal atresia and malformations of the heart, inner ear, and retina. Variants in CHD7 have been shown to cause CHARGE syndrome. Here, we report the identification of a novel de novo p.Asp2119_Pro2120ins6 duplication variant in a conserved region of CHD7 in a severely affected boy presenting with 3 and 5 of the CHARGE cardinal major and minor signs, respectively, combined with congenital umbilical hernia, congenital hernia at the linea alba, mildly hypoplastic inferior vermis, slight dilatation of the lateral ventricles, prominent metopic ridge, and hypoglycemic episodes.

Keywords: Intellectual disability, CHARGE syndrome, CHD7, de novo variant, WES

Introduction

CHARGE syndrome (MIM 214800) is a multifaceted condition affecting between 1 in 8500 and 1 in 17 000 individuals.1 The acronym CHARGE was established based on the combination of patients’ phenotypes, such as coloboma, heart defect, atresia choanae (also known as choanal atresia), retardation of growth and/or development, genital defects, ear anomalies, and/or deafness in patients. All malformations related to CHARGE syndrome occur early in the first trimester of pregnancy, while growth and developmental retardation become more obvious as the child matures. In some patients, clinical phenotype overlaps with those described for other syndromes, such as DiGeorge syndrome, velocardiofacial, oculo-auriculo-vertebral, and Kallmann syndromes.2,3 Clinical diagnosis is made with a set of criteria (Table 1) and CHARGE patients typically have all 4 major or 3 major and 3 minor features, while individuals suspected to have CHARGE syndrome may only have 1 or 2 major and several minor characteristics. Subsequent molecular confirmation enables genetic counselling concerning recurrence risk.

Table 1.

Major and minor diagnostic characteristics of CHARGE syndrome and phenotype of the proband.3

Characteristics Manifestations Frequency Proband
Major diagnostic characteristics
Ocular coloboma Coloboma of the iris, retina, choroid, disc; microphthalmia 80%–90% • Bilateral choroid coloboma involving optic nerve
Choanal atresia or stenosis Unilateral/bilateral: bony or membranous atresia/stenosis 50%–60%
Cranial nerve dysfunction or anomaly I: hyposmia or anosmia Frequent
VII: facial palsy (unilateral or bilateral) >40%
VIII: hypoplasia of auditory nerve Frequent
IX/X: swallowing problems with aspiration 70%–90% • Swallowing problems
Ear Outer ear: short, wide ear with little or no lobe, ‘snipped off’ helix, prominent antihelix that is often discontinuous with tragus, triangular concha, decreased cartilage; often protruding and usually asymmetric;
Middle ear: ossicular malformations;
Mondini defect of the cochlea;
Temporal bone abnormalities; absent or hypoplastic semicircular canals
80%–100% • Smaller and wide right ear
• Bilateral sensorineural hearing loss
Minor diagnostic characteristics
Genital hypoplasia Males: micropenis, cryptorchidism
Females: hypoplastic labia
50%–60% • Micropenis, cryptorchidism
Males and females: delayed puberty secondary to hypogonadotropic hypogonadism Frequent
Developmental delay Delayed milestones, hypotonia Almost 100% • Delayed psychomotor development
• Autism spectrum disorder
Cardiovascular malformation Including conotruncal defects (eg, tetralogy of Fallot), AV canal defects, and aortic arch anomalies 75%–85% • Small atrial septal defect
Growth deficiency Short stature, usually postnatal with or without growth hormone deficiency 70%–80% • Weight and height <3rd centile
Orofacial cleft Cleft lip and/or palate 15%–20%
Tracheoesophageal (TE) fistula TE defects of all types 15%–20%
Distinctive facial features Square face with broad prominent forehead, prominent nasal bridge and columella, flat midface 70%–80% • Prominent forehead, prominent metopic ridge
Other features • Congenital umbilical hernia and congenital hernia at the linea alba;
• Mildly hypoplastic inferior vermis and slight dilatation of the lateral ventricles;
• Hypoglycemic episodes

Abbreviation: AV, atreoventricular.

Methods

Whole exome sequencing

DNA was extracted from peripheral blood lymphocytes using the phenol-chloroform extraction method. The proband and his healthy parents were assessed by whole exome sequencing (WES). We followed the procedure we routinely and successfully used to identify the cause of Mendelian diseases.48 Briefly, exomes were captured using the Agilent SureSelect Human All Exon V5 enrichment kit and multiplex sequenced (6-plex) on an Illumina HiSeq 2500 platform to reach about 100-fold coverage on average and were mapped according to the human reference genome build 38. Variants were filtered based on allele frequency in ExAC and in the Lithuanian population, pathogenicity predictions scores (SIFT, PolyPhen, MutationTaster, CADD),913 and inheritance patterns including autosomal-recessive, X-linked, and de novo/autosomal dominant using the Varapp filtering software.14 Sanger sequencing confirmed the anticipated segregation of the potentially causative variant.

Results

The proband (3 years 7 months old; Figure 1A and B) is the firstborn male child of healthy non-consanguineous parents. Family history was unremarkable, with no undue exposure to teratogens reported. The pregnancy was complicated by imminent preterm labour at 32 weeks of gestation. The patient was born at 34 weeks of gestation with the umbilical cord wrapped around his neck and green amniotic fluid. The propositus head circumference, weight, and length at birth were 34 cm (90th centile), 2275 g (50th centile), and 49 cm (90th centile), respectively. On delivery, his Apgar scores at 1 minute and 5 minutes were 8 and 8, respectively. He was apneic at birth and was intubated for several days. He also received nasogastric tube feeding to circumvent swallowing issues. A brain magnetic resonance imaging (MRI) examination performed at 1.5 months of age showed mildly hypoplastic inferior vermis, slight dilatation of the lateral ventricles, and dilated fourth ventricle (Figure 1C and D). Brain MRI examination has not revealed anomalies of olfactory bulb, optic nerves, or pituitary gland. At 4 months of age, a gastrostomy tube was placed. Multiple congenital birth defects were observed soon after birth. An echocardiogram identified a small atrial septal defect, while a brain ultrasonographic assessment revealed inferior vermian hypoplasia. Bilateral choroid coloboma involving the optic nerves was diagnosed by an ophthalmologist at 13 months. Surgical correction was performed for a congenital umbilical hernia and a congenital hernia at the linea alba. Bilateral sensorineural hearing loss was managed with hearing aids. Hypoglycemic episodes started to manifest at approximately 9 months of age, and therapy with slow release cornstarch was initiated. Notably, there has also been clear psychomotor delay as the proband could sit without support by 15 months of age and walk independently at 37 months of age. His first teeth erupted at 14 months of age. The boy has no expressive language. At 2 years 8 months old, his psychomotor development was evaluated to be in the range of 3 (self-help) to 10 (fine motor) months according the Diagnostic Inventory for Screening Children (DISC) scale. In addition, he was diagnosed with autism spectrum disorder at 2 years 9 months of age. During his last examination, at the age of 3 years 7 months, his weight was 11.5 kg (<3rd centile) and his height was 88 cm (<3rd centile). He had a prominent metopic ridge, smaller and wide right ear, sacral dimple, clinodactyly of the 5th fingers, micropenis, and cryptorchidism. He was still suffering from laryngomalacia and severe feeding problems necessitating gastrostomy tube feeding. Frequent feeds and uncooked cornstarch every 6 hours was used to prevent hypoglycemic episodes. In summary, the proband presents with 3 major and 5 minor features of CHARGE syndrome (Table 1) combined with additional features.

Figure 1.

Figure 1.

(A) Front and (B) side views of the patient at 1 year and 9 months of age. Brain MRI at 1.5 months of age showed (C) slight dilatation of the lateral ventricles, mildly hypoplastic inferior vermis and (D) dilated fourth ventricle. (E) An electropherogram of the genomic DNA sequence of the patient showed a de novo duplication in CHD7: c.6341_6358dup (Asp2119_Pro2120ins6) A mutated sequence with duplication in red written beneath. (F) Alignment of CHD7 protein fragment for 9 different placental mammal species confirmed that the Asp2119_Pro2120ins6 non-frameshift insertion affects an evolutionary conserved region. Secondary structures of the peptide encoded by the wild type (left) and Asp2119_Pro2120ins6 mutated (right) exon 31 of CHD7 are shown as rainbow ribbons. (G) The new short alpha helix that is formed by the inserted amino acid residues is in yellow. Models of wild-type and mutated protein structure were formed using SWISS-MODEL software.15 MRI indicates magnetic resonance imaging.

As no cytogenetic alterations were identified, we assessed the genome of the proband and his parents by WES. We identified a de novo 18 nucleotides duplication in exon 31 of the CHD7 gene (c.6341_6358dup, p.Asp2119_Pro2120ins6); NM_017780; NP_060250; MIM 214800) confirmed by Sanger sequencing (Figure 1E), which affects an evolutionary constrained region (Figure 1F). Modelization of the putatively encoded mutated protein suggests that the insertion of this chain of 6 amino acid residues potentially substitutes a linear chain into a short alpha helix (Figure 1G). The other deleterious de novo variants, which contribute to the current patient phenotype, were not identified. All unique de novo variants identified for this proband are listed in Table 2.

Table 2.

List of de novo variants identified for the proband.

Chromosome Start Reference allele Alternative allele Gene symbol Aa change Impact Genotype
chr20 52557934 GGT G AC005220.3 Splice donor variant Heterozygous
chr7 150811966 G A AGAP3 G/S Missense variant Heterozygous
chr7 150811967 G A AGAP3 G/D Missense variant Heterozygous
chr11 13435092 T G BTBD10 K/Q Missense variant Heterozygous
chr11 66512290 G GGGCGGCGGCGGC C11orf80 G/GAAAA Inframe insertion Heterozygous
chr2 153476066 G GCCACCCCCCCCCCCA FMNL2 −/PPPPP Inframe insertion Heterozygous
chr6 30996720 C CAGGCTCTGAGACCACCACAGCCTCTACTGA MUC22 T/TGSETTTASTE Inframe insertion Heterozygous
chr19 2015540 GGGCGGCGGCGGC G BTBD2 AAAA/− Inframe deletion Homozygous
chr3 42251577 C CGGA TRAK1 T/TE Inframe insertion Heterozygous
chr14 73874252 G PTGR2 NA Heterozygous
chr4 87615711 AATAGTAGTGACAGCAGC DSPP Non-frameshift deletion Heterozygous
chr8 60853065 ATCACATCCTCAATGACC CHD7 −/HILNDH Non-frameshift insertion Heterozygous

De novo variant in CHD7 gene associated with CHARGE syndrome is marked in grey.

Discussion

Alterations in CHD7 have been identified in more than two-third of all children, who fulfil the clinical diagnostic criteria for CHARGE syndrome.1618 Truncating variants including nonsense, frameshift, and splice variants (89%) that typically result in haploinsufficiency are the most frequently encountered followed by missense (8%) variants.17,19,20 CHD7 encodes a chromodomain helicase DNA-binding protein, which plays a significant role in early embryonic development and controls gene expression via chromatin remodelling during the cell cycle.21

Besides the duplication described here, other variants affecting the same region in the protein have been identified, for example, the de novo missense variant c.6347T>A; p.Ile2116Asn (CM090041) that changes a hydrophobic into a polar amino acid. The associated patient presented with a milder pheno-type than our proband characterized by cleft palate, auricular dysplasia, nystagmus, bilateral perceptive deafness, and semi-circular canal hypoplasia.22 Similarly, the c.6322G>A; p.Gly2108Arg (CM080142) missense variant has been detected in 3 patients with mild CHARGE syndrome features, which include unilateral optic nerve coloboma and microphthalmia, bilateral sensorineural deafness, dysmorphic ears, hypoplastic semicircular canals, and bifid uvula.23 The association between the insertion of the HILNDH peptide and a severe phenotype is not surprising as it is predicted to form a novel alpha helix within a highly conserved region of the protein.

While additional work is necessary to understand this complex disease, this study further expands the understanding of CHARGE syndrome pathogenesis and suggests that severe CHARGE syndrome phenotypes can be caused by deletions, point mutations,17 and duplications/insertions.

Acknowledgments

We extend our sincere appreciation to the patient’s family for their support.

Footnotes

Funding:The author(s) disclosed receipt of the following financial support for the research, authorship and/or publication of this article: This study was supported by the Lithuanian-Swiss Cooperation Programme under UNIGENE project agreement no. CH-3-ŠMM-01/04 and a grant from the Swiss National Science Foundation (31003A_160203) to AR.

Declaration of conflicting interests:The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Author Contributions: LP performed data analysis. LP and EP prepared the manuscript. Sequencing of trios exomes was performed by LG. AR and VK contributed to conception and design and critically revised the manuscript.

Ethical Approval: The patient’s parents provided written informed consent to publish all clinical information, including photographs of the patient.

References

  • 1. Issekutz KA, Graham JM, Jr, Prasad C, Smith IM, Blake KD. An epidemiological analysis of CHARGE syndrome: preliminary results from a Canadian study. Am J Med Genet A. 2005;133A:309–317. [DOI] [PubMed] [Google Scholar]
  • 2. Blake K, MacCuspie J, Hartshorne TS, Roy M, Davenport SL, Corsten G. Postoperative airway events of individuals with CHARGE syndrome. Int J Pediatr Otorhinolaryngol. 2009;73:219–226. [DOI] [PubMed] [Google Scholar]
  • 3. Vuorela PE, Penttinen MT, Hietala MH, Laine JO, Huoponen KA, Kääriäinen HA. A familial CHARGE syndrome with a CHD7 nonsense mutation and new clinical features. Clin Dysmorphol. 2008;17:249–253. [DOI] [PubMed] [Google Scholar]
  • 4. Borck G, Hög F, Dentici ML, et al. BRF1 mutations alter RNA polymerase III-dependent transcription and cause neurodevelopmental anomalies. Genome Res. 2015;25:155–166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Alfaiz AA, Micale L, Mandriani B, et al. TBC1D7 mutations are associated with intellectual disability, macrocrania, patellar dislocation, and celiac disease. Hum Mutat. 2014;35:447–451. [DOI] [PubMed] [Google Scholar]
  • 6. Lodder EM, De Nittis P, Koopman CD, et al. GNB5 mutations cause an autosomal-recessive multisystem syndrome with sinus bradycardia and cognitive disability. Am J Hum Genet. 2016;99:704–710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Tumienė B, Voisin N, Preikšaitienė E, et al. Inflammatory myopathy in a patient with Aicardi-Goutières syndrome. Eur J Med Genet. 2017;60:154–158. [DOI] [PubMed] [Google Scholar]
  • 8. Gueneau L, Fish R, Shamseddin HE, et al. KIAA1109 variants are associated with a severe disorder of brain development and arthrogryposis. Am J Hum Genet. 2018;102:116–132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Petrovski S, Wang QL, Heinzen EL, Allen AS, Goldstein DB. Genic intolerance to functional variation and the interpretation of personal genomes. PLoS Genet. 2013;9:e1003709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Schwarz JM, Rödelsperger C, Schuelke M, Seelow D. MutationTaster evaluates disease-causing potential of sequence alterations. Nat Methods. 2010;7:575–576. [DOI] [PubMed] [Google Scholar]
  • 11. Ng PC, Henikoff S. Predicting deleterious amino acid substitutions. Genome Res. 2001;11:863–874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Adzhubei IA, Schmidt S, Peshkin L, et al. A method and server for predicting damaging missense mutations. Nat Methods. 2010;7:248–249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Lek M, Karczewski KJ, Minikel EV, et al. Analysis of protein-coding genetic variation in 60,706 humans. Nature. 2016;536:285–291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Delafontaine J, Masselot A, Liechti R, Kuznetsov D, Xenarios I, Pradervand S. Varapp: a reactive web-application for variants filtering [published online ahead of print June 28, 2016]. bioRxiv. doi: 10.1101/060806. [DOI]
  • 15. Biasini M, Bienert S, Waterhouse A, et al. SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information. Nucleic Acids Res. 2014;42:W252–W258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Bergman JE, Janssen N, Hoefsloot LH, Jongmans MC, Hofstra RM, van Ravenswaaij-Arts CM. CHD7 mutations and CHARGE syndrome: the clinical implications of an expanding phenotype. J Med Genet. 2011;48:334–342. [DOI] [PubMed] [Google Scholar]
  • 17. Katoh-Fukui Y, Yatsuga S, Shima H, et al. An unclassified variant of CHD7 activates a cryptic splice site in a patient with CHARGE syndrome. Hum Genome Var. 2018;5:18006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Martin DM. Epigenetic developmental disorders: CHARGE syndrome, a case study. Curr Genet Med Rep. 2015;3:1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Vissers LE, van Ravenswaaij CM, Admiraal R, et al. Mutations in a new member of the chromodomain gene family cause CHARGE syndrome. Nat Genet. 2004;36:955–957. [DOI] [PubMed] [Google Scholar]
  • 20. Zentner GE, Layman WS, Martin DM, Scacheri PC. Molecular and phenotypic aspects of CHD7 mutation in CHARGE syndrome. Am J Med Genet A. 2010;152A:674–686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Sanlaville D, Etchevers HC, Gonzales M, et al. Phenotypic spectrum of CHARGE syndrome in fetuses with CHD7 truncating mutations correlates with expression during human development. J Med Genet. 2006;43:211–217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Jongmans MC, van Ravenswaaij-Arts CM, Pitteloud N, et al. CHD7 mutations in patients initially diagnosed with Kallmann syndrome – the clinical overlap with CHARGE syndrome. Clin Genet. 2009;75:65–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Jongmans MC, Hoefsloot LH, van der Donk KP, et al. Familial CHARGE syndrome and the CHD7 gene: a recurrent missense mutation, intrafamilial recurrence and variability. Am J Med Genet A. 2008;146A:43–50. [DOI] [PubMed] [Google Scholar]

Articles from Genomics Insights are provided here courtesy of SAGE Publications

RESOURCES