Abstract
The present study was conducted to investigate the effect of Artemisia argyi on the production performance and intestinal barrier of rabbits. Weaned Hyla rabbits (30 d, n = 160) of similar body weight were divided into 4 groups (40 rabbits per treatment), and they were fed a control diet or fed an experimental diet supplemented with 3%, 6%, or 9% A. argyi. The results showed that the dietary supplementation with A. argyi did not affect the rabbits’ food intake and body weight gain regardless of the inclusion level but decreased the diarrhea rate and diarrhea index (P < 0.05). Dietary addition of A. argyi increased the small intestine length and villus height/crypt depth, regardless of the inclusion level (P < 0.05). Compared with the control, the A. argyi supplementation increased the gene expression of zonula occludens 1 (ZO-1) and claudin 1 in all segments of the small intestine and regardless of the level of A. argyi (P < 0.05). In the duodenum, a dietary supplementation with 6% and 9% A. argyi increased the immunoglobulins A (IgA) content (P < 0.05). In the jejunum, the A. argyi supplementation decreased interleukin 2 (IL2) and IL6 content regardless of the inclusion level (P < 0.05). In the ileum, a 3% A. argyi addition decreased IL2 content, whereas a 6% A. argyi addition decreased IL6 content (P < 0.05). Furthermore, 6%–9% A. argyi supplementation increased the IgA content in the ileum (P < 0.05). In conclusion, dietary addition of A. argyi reduces diarrhea and modulates the gut immune function without affecting growth performances of rabbits.
Keywords: Artemisia argyi, diarrhea, intestinal health, rabbit weaning
INTRODUCTION
Infectious diseases of the digestive system currently account for 70% of all rabbit diseases (Carabaño et al., 2008). The percentage has increased further due to epizootic rabbit enteropathy, which can cause up to 60% mortality, especially for the weaned rabbits (Fann et al., 2001; Carabaño et al., 2008). Rabbit diarrhea may be mainly caused by pathogens (e.g., enteropathogenic Escherichia coli and pasteurella) and stress caused by the weaning process, feed replacement, or changes in climate. Antibiotics have been widely used to control mortality but the corresponding veterinary treatments have increased by 2.5 fold, reducing the benefit margin for many farms. For this reason, some antibiotic substitutes (e.g., herbs and plant extracts) have been found and studied by many researchers. Artemisia argyi, the Chinese mugwort, is an aromatic plant in the genus Artemisia, which is native China, Japan, and far-eastern Siberia. This plant contains many potentially bioactive compounds such as coumarins, flavonoids, glycosides, polyacetylenes, sterols, monoterpenes, triterpenes, essential oils, and sesquiterpene lactones (Zhang et al., 2013). Some compounds have presented many bioactivities such as antiulcer (Yoon et al., 2011), antidiabetic (Adams et al., 2012), anti-inflammatory (Cai, 2001), and anticancer (Adams et al., 2006) activities in humans or mice. It has been used as a traditional herbal medicine for the treatment of microbial infections, inflammatory diseases, hepatitis, diarrhea, cancer, malaria, and circulatory system and metabolism disorders (Adams et al., 2006; Bao et al., 2013; Khan et al., 2012). The A. argyi leaf polysaccharides were capable of enhancing the Concanavallin A-induced T cell proliferation (Lan et al., 2010). A water-soluble polysaccharide, isolated from A. argyi, significantly inhibited the growth of the sarcoma 180 transplanted tumors and prolonged the survival time of the tumor-bearing mice (Bao et al., 2013). Artemisia argyi or its extracts have been used as a feedstuff or additive to enhance the body metabolism and improve production performance in broilers and pigs (Kim et al., 2009; Chu et al., 2016). However, there is little available information about its use as feedstuff in rabbit production and its effect on the intestinal barrier. Based on the previous research, we hypothesized that A. argyi could improve the intestinal health of weaned rabbits. The present experiment was conducted to investigate the function of A. argyi on the production performance and gut immune function of rabbits and to identify the effect of A. argyi as a feed resource in rabbit production.
MATERIALS AND METHODS
Experimental Protocol and Sample Collection
At 35 d of age, 160 weaned rabbits (Hyla, male-female ratio of 1:1) with similar body weight (1,388 ± 8.5 g) were divided into 4 treatments (40 rabbits per treatment), and they were fed a control diet or fed an experimental diet supplemented with 3%, 6%, or 9% A. argyi (cultivated in Hubei Province, purchased from Anguo Herbal Market, China) powder (the doses of A. argyi refer to dry matter basis). The experiment lasted for 37 d. Rabbits were individually housed in homemade plastic cages (60 × 40 × 40 cm). Temperature and lighting were maintained according to commercial conditions (20 to 23 °C, 12 light/12 dark). The diets were formulated according to the recommendation of de Blas and Mateos (1998), and the feed was made into 4-mm pellets by using steam. The ingredients and chemical composition of the diet are listed in Table 1. All rabbits had free access to feed and water during the rearing period. All study procedures were approved by the Shandong Agricultural University Animal Care and Use Committee (SDAUA-2016-132) and were in accordance with the Guidelines for Experimental Animals established by the Ministry of Science and Technology (Beijing, China). At the end of the trial, 32 rabbits (72 d of age, 8 rabbits per treatment, male-female ratio of 1:1) were electrically stunned and slaughtered by exsanguination. The whole intestine from the pylorus to the ileocecal junction was carefully removed from each rabbit, and the length of the small intestine was recorded. Then, 2- and 4-cm segments were from the distal duodenum (between the U-bending location and treitz lig), mid-jejunum (between the treitz lig and Meckel’s diverticulum), and mid-ileum (between the Meckel’s diverticulum and ileocecal junction). The 2-cm intestinal segments were flushed gently with ice-cold phosphate-buffered saline (PBS, pH 7.4) and then placed in 10% fresh, chilled formalin solution for histological and immunohistochemical measurements. The 4-cm intestinal segments were opened longitudinally, and the contents were flushed with ice-cold PBS. Mucosa was collected by scraping using a sterile glass microscope slide, and then rapidly frozen in liquid nitrogen and stored at −80 °C until analysis.
Table 1.
Ingredients and chemical composition of the experimental diet on DM basis
| Experimental group | ||||
|---|---|---|---|---|
| Ingredients, % | Control | 3% | 6% | 9% |
| Bean pulp | 13 | 13 | 13 | 13 |
| Corn | 14 | 14 | 14 | 14 |
| Corn germ dregs | 10 | 10 | 10 | 10 |
| Alfalfa meal | 22 | 22 | 22 | 22 |
| Premix1 | 4 | 4 | 4 | 4 |
| Peanut vine | 22 | 21 | 19 | 18 |
| Wheat bran | 15 | 13 | 12 | 10 |
| Artemisia argyi powder2 | 0 | 3 | 6 | 9 |
| Measured chemical composition | ||||
| Digestible energy, MJ/kg | 8.37 | 8.19 | 7.88 | 7.90 |
| Crude protein, % | 16.60 | 16.56 | 16.60 | 16.59 |
| Crude fiber, % | 16.89 | 17.07 | 17.13 | 16.90 |
| Crude fat, % | 2.74 | 2.74 | 2.58 | 2.62 |
| Dry matter, % | 91.30 | 91.08 | 91.08 | 91.22 |
| Acid detergent fiber, % | 18.35 | 18.14 | 18.21 | 18.24 |
| Neutral detergent fiber, % | 37.06 | 36.58 | 36.18 | 36.19 |
| Acid detergent lignin, % | 3.16 | 3.47 | 3.34 | 3.36 |
| Calcium, % | 1.43 | 1.42 | 1.46 | 1.49 |
| Phosphorus, % | 0.65 | 0.65 | 0.63 | 0.64 |
1The following premix ingredients were added to each kg of diet: vitamin A, 8 000 IU; vitamin D3, 1 000 IU; vitamin E, 50 mg; vitamin K3, 2.3 mg; thiamine, 1.75 mg; riboflavin, 6.9 mg; niacin, 28.45 mg; pantothenic acid, 6.7 mg; biotin, 2.75 mg; folic acid, 0.6 mg; vitamin B12, 2.2 mg; choline, 420 mg, lysine, 1.5 g; methionine, 1.5 g; copper, 50 mg; iron, 100 mg; manganese, 30 mg; magnesium, 150 mg; iodine, 0.1 mg.
2The composition of A. argyi powder: energy value 17.62 MJ/Kg; crude protein, 15.70%; crude fiber, 7.29%; crude fiber, 16.64%.
Growth Performance and Diarrhea
Body weight and feed consumption of individual rabbits were recorded daily at 8:00 am. Average daily gain (ADG), average daily feed intake (ADFI), and feed conversion ratio (FCR) were calculated for all rabbits (n = 40). The number of rabbits with diarrhea was recorded daily throughout the study. Fecal consistency scores (0 normal; 1 soft feces stools; 2 soft/liquid stools; 3 liquid stools) were determined by 2 trained people with no prior knowledge of the dietary treatment allocation (Isolauri et al., 1990). The incidence of diarrhea was calculated as (the total number of rabbits with diarrhea/the total number of all experimental rabbits) × 100%. The diarrhea index was calculated as the total score of diarrhea/total number of rabbits. The incidence and index of diarrhea were calculated daily. The final incidence and index were obtained by repeated measures analysis in whole experimental period (n = 37).
Histological Examination
The mucosa samples were processed, embedded, and stained according to the procedures of Hu et al. (2013). In brief, samples were fixed and embedded in paraffin, sectioned at a thickness of 5 μm and stained with haematoxylin and eosin. The villus height (the distance from the villus tip to crypt mouth) and the associated crypt depth (the distance from the crypt mouth to base) were measured in 5 slides for each sample. In each slide, 10 well-oriented villus and crypts were analyzed at a low magnification (40×) with a light microscope (using IMAGEJ 1.43d software; Research Services Branch, National Institute of Mental Health, Bethesda, MD).
Cytokine and Immunoglobulin Levels
Mucosa samples were disrupt and homogenized in PBS buffer (1-g samples: 9 mL PBS). After centrifuging at a speed of 5,000 × g for 10 min, the supernatant was isolated. The immunoglobulins A (IgA) and immunoglobulins G (IgG) concentrations were measured with an immunoturbidimetry using the commercial diagnostic kits (Name: IgA Assay Kit and IgG Assay Kit, Jiancheng Bioengineering Institute, Nanjing, P.R. China). Immunoglobulins in the supernatant combined, respectively, the IgA or IgG antibody, antigen-antibody complex produced turbidity. Turbidity was monitored spectrophotometrically at 415 nm with an automated reader (BioTek, Winooski, VT). The levels of interleukins (interleukin 2 [IL2], IL-6, IL-8, and IL-10) and IFNγ were determined in supernatant using double-antibody sandwich Enzyme-Linked Immunosorbent Assay (Jiancheng Bioengineering Institute, Nanjing, P.R. China). Optical density value at 450 nm was measured by a Bio-Rad ELISA reader (Bio-Rad, Richmond, CA). Duplicate assays were performed for both sample and standard testing. The sensitivities for IL-2, IL-6, IL-8, IL-10, and IFNγ were 2, 0.25, 7.5, 10, and 8 ng/L respectively.
RNA Isolation and Analysis
Total RNA extraction and quantitative reverse transcription-PCR (qRT-PCR) of mucosa samples were performed as described previously (Liu et al., 2014; Wang et al., 2017). Total RNA was isolated by the guanidinium isothiocyanate method with Trizol Reagent (Invitrogen, San Diego, CA). The quality of RNA after DNase treatment was tested by electrophoresis on an agarose gel and the quantity of RNA was determined using a biophotometer (Eppendorf, Germany). Reverse transcription was performed as the direction of TaKaRa cDNA systhesis kit described previously (TaKaRa Biotechnology, Co., Ltd. Dalian, P. R. China). RT reaction system (10 μL) containing 500 ng total RNA, 5 mmol/L MgCl2, 1 μL RT buffer, 1 mmol/L dNTP, 2.5 U avian myeloblastosis virus, 0.7 nmol/L oligo d(T), and 10 U Ribonuclease inhibitor were performed at 65 °C for 2 min, 42 °C for 30 min, and 70 °C for 15 min. RT-PCR analysis was conducted using the Applied Biosystems 7500 RT-PCR System (Applied Biosystems, Foster, CA). Each RT-reaction served as a template in a 20-μL PCR reaction containing 0.2 μmol/L of each primer and SYBR green master mix (Takara Biotechnology, Co., Ltd. Dalian, P. R. China). All the genes sequences were from NCBI, and primer-set sequences are described in Table 2. RT-PCR reactions were performed at 95 °C for 10 s, followed by 40 cycles at 95 °C for 5 s and 60 °C for 40 s. A standard curve of pooled samples was plotted to calculate the efficiency of the RT-PCR primers. The relative amount of mRNA of a gene was calculated according to the 2 delta delta CT method (Livak and Schmittgen, 2001) using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as normalizing gene and the control group as calibrator group. On the basis of the CT values, GAPDH mRNA expression was stable across the treatments (P > 0.1).
Table 2.
Gene-specific primers used for the analysis of rabbit gene expression
| Gene | Genebank | Primer sequences (5′–3′） | Product size (bp) |
|---|---|---|---|
| claudin1 | NM_001089316 | F: GTCTTCGACTCTTTGCTGAATCT | 169 |
| R: CAATGACAGCCATCCGCATC | |||
| occludin | XM_008262318 | F: CTTGCCTGGGACAGAACCTA | 121 |
| R: AGCCATAACCGTAGCCGTAA | |||
| ZO-1 | XM_008269782 | F: GACTGATGCGAAGACGTTGA | 117 |
| R: GCAGAATGGATGCTGTCAGA | |||
| GAPDH | NM_001082253 | F: TGCCACCCACTCCTCTACCTTCG | 163 |
| R: CCGGTGGTTTGAGGGCTCTTACT |
ZO-1 = zonula occludens 1; GAPDH = glyceraldehyde 3-phosphate dehydrogenase.
Statistical Analysis
All date were analyzed using general statistical linear mode (GLM) procedure of SAS. Differences among treatments were examined using Duncan’s multiple range test and were considered to be significant at P < 0.05.
RESULTS
Effects of A. argyi Supplementation on Production Performance in Rabbits
Compared with the control, a dietary supplementation with the A. argyi did not affect the ADG, ADFI, or FCR (Table 3), but it decreased the diarrhea rate and diarrhea index (P < 0.05). Besides, addition of 6% A. argyi decreased further the diarrhea rate and diarrhea index compared with the 3% A. argyi addition group (P < 0.05). There was no significant difference between 6% A. argyi addition group and 9% A. argyi addition group. The rabbits fed A. argyi had a greater small intestine length than control (P < 0.05).
Table 3.
Effects of A. argyi powder supplementation on growth performance and feed intake in rabbits
| Experimental group | RMSE | P | ||||
|---|---|---|---|---|---|---|
| Control | 3% | 6% | 9% | |||
| Average daily feed intake, g/d | 168.6 | 167.6 | 169.6 | 168.6 | 4.94 | 0.3966 |
| Average daily gain, g/d | 46.96 | 46.25 | 46.25 | 47.01 | 5.20 | 0.8706 |
| Feed conversion ratio | 3.63 | 3.63 | 3.68 | 3.60 | 0.34 | 0.8521 |
| Diarrhea rate, % | 23.50a | 11.14b | 6.78c | 6.56c | 1.89 | 0.0005 |
| Diarrhea index | 0.39a | 0.21b | 0.13c | 0.13c | 0.37 | 0.0007 |
| Small intestine length, cm | 351.1b | 398.5a | 405.8a | 391.1a | 13.32 | 0.0021 |
For average daily feed intake, average gain, and feed conversion ratio, n = 40; for diarrhea rate and diarrhea index, n = 37; for small intestine length, n = 8.
Effects of A. argyi Supplementation on Intestinal Morphology in Rabbits
The A. argyi supplementation in the diet did not alter the villus height in all segments of the small intestine (Table 4). Compared with the control, the 6% A. argyi supplementation decreased the crypt depth in the duodenum and ileum (P < 0.05). In the duodenum and the ileum, no difference was observed for the 3% and 9% A. argyi addition groups. The dietary A. argyi supplementation decreased the crypt depth in the jejunum for all A. argyi incorporation levels (P < 0.05) but increased the villus height/crypt depth in all intestinal segments (P < 0.05).
Table 4.
Effects of A. argyi powder supplementation on intestinal morphology of rabbits (n = 8)
| Intestinal sites | Experimental group | RMSE | P | ||||
|---|---|---|---|---|---|---|---|
| Control | 3% | 6% | 9% | ||||
| Duodenum | Villus height, μm | 675.3 | 768.9 | 717.8 | 746.1 | 143.2 | 0.5693 |
| Crypt depth, μm | 129.2a | 127.3a | 104.9b | 124.1a | 16.33 | 0.0193 | |
| Villus height/crypt depth | 5.26c | 6.62ab | 7.06a | 6.44b | 1.04 | 0.0279 | |
| Jejunum | Villus height, μm | 682.2 | 700.7 | 694.3 | 769.3 | 107.0 | 0.3947 |
| Crypt depth, μm | 138.1a | 103.6b | 100.3b | 110.1b | 18.89 | 0.0037 | |
| Villus height/crypt depth | 5.07b | 7.22a | 7.20a | 7.25a | 1.09 | 0.0015 | |
| Ileum | Villus height, μm | 486.2 | 542.7 | 536.3 | 579.9 | 94.5 | 0.2632 |
| Crypt depth, μm | 109.9a | 97.4ab | 89.3b | 102.9ab | 15.50 | 0.0746 | |
| Villus height/crypt depth | 4.57b | 5.79a | 6.13a | 5.95a | 0.76 | 0.0012 |
Effects of A. argyi Supplementation on Gene Expression of Physical Barrier in Rabbits
Compared with the control, the A. argyi supplementation increased the expression of zonula occludens 1 (ZO-1) and claudin 1 gene (Table 5, P < 0.05) while did not change the gene expression of occludin in any segment of the small intestine and regardless of the level of A. argyi.
Table 5.
Effects of A. argyi powder supplementation on related gene expression of physical barrier in intestinal tract (n = 8)
| Intestinal sites | Experimental group | RMSE | P | ||||
|---|---|---|---|---|---|---|---|
| Control | 3% | 6% | 9% | ||||
| Duodenum | ZO-1 | 1.00c | 1.69a | 1.63ab | 2.07a | 0.66 | <0.001 |
| Occludin | 1.00 | 1.52 | 1.34 | 1.49 | 0.47 | 0.2373 | |
| Claudin1 | 1.00c | 1.35b | 1.36b | 1.79a | 0.74 | 0.0432 | |
| Jejunum | ZO-1 | 1.00b | 2.20a | 2.20a | 2.03a | 0.53 | 0.0043 |
| Occludin | 1.00 | 1.27 | 1.39 | 1.38 | 0.44 | 0.4435 | |
| Claudin1 | 1.00b | 2.55a | 2.63a | 3.25a | 0.93 | 0.0186 | |
| Ileum | ZO-1 | 1.00c | 1.33ab | 1.51a | 1.52a | 0.45 | 0.0269 |
| Occludin | 1.00 | 1.14 | 1.21 | 1.35 | 0.51 | 0.6911 | |
| Claudin1 | 1.00c | 1.57ab | 1.42b | 1.89a | 0.87 | 0.0315 |
ZO-1 = zonula occludens 1.
Effects of A. argyi Supplementation on Cytokine and Immunoglobulin Levels in Rabbits
As shown in Table 6, IgA content significantly increased in the group with 6% and 9% A. argyi supplementation in the duodenum (Table 6, P < 0.05), but not in the group with 3% A. argyi supplementation. The A. argyi treatment did not affect the IL2, IL6, IL8, IL10, IgG, and IFNγ content regardless of the inclusion level. In the jejunum, the dietary A. argyi supplementation decreased the IL2 and IL6 content (P < 0.05) but did not alter the IL8, IL10, IgA, IgG, and IFNγ content regardless of the inclusion level. In the ileum, IL2 levels were decreased in the 3% group compared with the control group, whereas no significant differences were observed for other inclusion levels (P < 0.05). IL6 levels were decreased in the 6% group compared with all other experimental groups (P < 0.05). Compared with the control, the 6% to 9% A. argyi addition in diet increased the IgA content (P < 0.05). Regardless of the level of A. argyi, the levels of IL8, IL10, IgG, and IFNγ in ileum were not changed.
Table 6.
Effects of A. argyi supplementation on cytokine and immunoglobulin levels in intestinal tract (n = 8; units: ng/L for IL2, IL6, IL10, and IFNγ; μg/L for IgA and IgG)
| Intestinal sites | Experimental group | RMSE | P | ||||
|---|---|---|---|---|---|---|---|
| Control | 3% | 6% | 9% | ||||
| Duodenum | IL2 | 19.72 | 21.41 | 16.67 | 20.23 | 3.44 | 0.4832 |
| IL6 | 159.1 | 56.8 | 123.5 | 147.3 | 83.39 | 0.4001 | |
| IL8 | 69.07 | 60.46 | 47.43 | 69.50 | 39.57 | 0.7882 | |
| IL10 | 97.30 | 113.5 | 123.7 | 144.3 | 57.55 | 0.7297 | |
| IgA | 22.31b | 20.30b | 92.29a | 89.60a | 43.65 | 0.0396 | |
| IgG | 2.53 | 3.50 | 3.28 | 7.86 | 3.97 | 0.1865 | |
| IFNγ | 118.6 | 97.35 | 62.29 | 108.2 | 66.64 | 0.6388 | |
| Jejunum | IL2 | 45.40a | 30.08b | 28.93b | 31.23b | 6.32 | 0.0329 |
| IL6 | 180.3a | 108.5b | 76.35b | 105.5b | 38.90 | 0.0050 | |
| IL8 | 106.6 | 86.85 | 68.6 | 101.0 | 32.61 | 0.4332 | |
| IL10 | 187.6 | 156.1 | 119.5 | 103.7 | 93.46 | 0.4339 | |
| IgA | 18.84 | 16.53 | 15.98 | 23.99 | 7.34 | 0.3584 | |
| IgG | 7.87 | 7.32 | 6.23 | 7.44 | 2.79 | 0.8066 | |
| IFNγ | 108.06 | 103.07 | 72.20 | 86.07 | 57.27 | 0.7398 | |
| Ileum | IL2 | 44.39a | 16.08b | 35.51ab | 35.11ab | 10.85 | 0.0019 |
| IL6 | 158.6a | 149.2a | 81.17b | 147.5a | 49.72 | 0.0022 | |
| IL8 | 133.9 | 98.48 | 77.08 | 116.70 | 36.09 | 0.1137 | |
| IL10 | 197.3 | 142.7 | 94.24 | 146.3 | 61.43 | 0.1417 | |
| IgA | 18.84c | 23.61bc | 43.53a | 37.46ab | 14.44 | 0.0248 | |
| IgG | 9.31 | 8.13 | 8.22 | 9.73 | 2.13 | 0.4211 | |
| IFNγ | 138.7 | 128.6 | 95.43 | 107.7 | 65.35 | 0.7431 |
IL = interleukin; IgA = immunoglobulins A; IgG = immunoglobulins G; IFN-γ = interferon-γ.
DISCUSSION
Effects of A. argyi on Performance and Intestine Development in Rabbits
This experiment indicated that dietary supplementation with A. argyi instead of peanut vine and wheat bran did not change the ADG, ADFI, and FCR in rabbits, which is similar to the results reported by Zhang et al. (2017) in broilers. Zhang et al. (2017) showed that the dietary supplementation with 1000 mg/kg A. argyi aqueous extract attenuated the decline of ADG and ADFI of broilers caused by a lipopolysaccharide (LPS) challenge but had no effect on the growth performance of broilers without a LPS challenge. These results suggested that A. argyi could be largely used as feedstuff in rabbit production without changing their production performance.
Keepers pursue high growth rate and shortened feeding period by increasing dietary digestible energy and protein levels. This may cause serious intestinal problems, especially for the postweaned rabbits. The rate of diarrhea in postweaned rabbits could be up to 50%, which induces a high death rate (Li and Gu, 2003). In our study, the diarrhea rate in rabbits of the control group was 22.5%, but the dietary A. argyi addition significantly decreased the diarrhea rate and diarrhea index. The result was in agreement with a previous study in mice (Bao et al., 2013). These results suggest that dietary supplementation of A. argyi could decrease diarrhea and improve intestinal health in animal. The small intestine is the primary tissue responsible for the terminal digestion and absorption of dietary nutrients (Shimizu, 1999). In the present study, the A. argyi treatment increased the ratio of villus height to crypt depth and small intestine length, indicating a critical role of A. argyi in the development of the intestine and protection against intestinal atrophy in vivo. This was in agreement with the findings in broiler chicks by Chu et al. (2016), indicating that A. argyi extract could affect the development of enterocyte of broilers and increase the villus height to crypt depth.
Effects of A. argyi on Physical Barriers in Rabbits
The intestinal epithelial cells are joined at their apical side by tight junctions. The tight junctional complexes form the narrowest distance between plasma membranes of 2 cells, thus excluding the influx of bacteria through paracellular routes (Turner, 2009). The transmembranous junctional proteins (e.g., claudins and occludin) are linked to intracellular ZO, which are bridges to cytoskeletal actin and myosin filaments (Turner, 2006; Ivanov et al., 2010). RT-PCR analysis of the small intestine mucosa showed that the A. argyi addition increased the gene expression of ZO-1 and claudin 1, indicating that there may be improvement of the intestinal barrier mechanism. The results were in line with the previous study, indicating extract from A. argyi leaf reduced the permeability in glacial acetic acid–induced abdominal blood capillary in mice (Ge et al., 2016)
Effects of A. argyi on the Intestinal Immunological Barrier in Rabbits
The small intestine is an important component of the mucosal immune system and performs important and unique immune functions. IgA is the predominant immunoglobulin isotype in the mucosal tissue and is responsible for the defense of mucosal homeostasis, influencing the development of systemic immunity (Mestecky et al., 1999). In the present study, the IgA content was increased after the 6% and 9% A. argyi treatments in duodenum and ileum, indicating a critical role of A. argyi in the maintenance of IgA production in vivo. But dietary addition A. argyi did not affect the IgA content in jejunum, which is in accordance with the study in pigs (Chu and Song, 2012). A dietary addition of Artemisia montana did not affect the IgA level in serum (Chu and Song, 2012). These results imply that the regulation of Artemisia on IgA is related to the segment of the small intestine and species.
IgG is another important immunoglobulin, which promotes immune cells to devour pathogens and neutralize bacterial toxins. Zhang et al. (2017) found that a daily addition of A. argyi aqueous extract did not affect the IgG section in the small intestine of broilers. In line with our present study, dietary addition of A. argyi did not regulate the intestinal IgG production. These results imply that A. argyi may not be involved in the regulation of intestinal IgG production. In fattening pigs, feeding A. montana Pampan increased the IgG level in serum (Chu and Song, 2012), indicating that it is different for different varieties of Artemisia in regulating IgG production.
In a previous study, A. argyi significantly attenuated the LPS-induced increase in serum IL-2 and IL-6 in broilers (Zhang et al., 2017). In our study, the dietary A. argyi supplementation significantly decreased the IL-2 and IL-6 content in the jejunum and ileum, but not in the duodenum, indicating that A. argyi could regulate the immune response, with the major regulative sites in rabbits occurring in the posterior segment of the small intestine. Additionally, IL-8, IL-10, and IFNγ in the small intestine were not significantly altered after the A. argyi treatment, indicating that IL-8, IL-10, and IFNγ may not be the key factors in A. argyi regulating the immune response.
In conclusion, dietary addition of A. argyi reduces diarrhea and modulates the gut immune function without affecting growth performances of rabbits after weaning. These results provide a basis for a new approach to preventing intestinal mucosal injury and the resulting clinical problems.
Conflict of interest statement. None declared.
Footnotes
This work was supported by the Natural Science Foundation of Shandong Province (ZR2018QC004 and ZR2018MC025), Modern Agro-industry Technology Research system (CARS-43-B-1), Funds of Shandong “Double Tops” Program, and Youth Science and Technology Innovation Fund of Shandong Agricultural University (2015–2016).
LITERATURE CITED
- Adams M., Efferth T., and Bauer R.. 2006. Activity-guided isolation of zcopoletin and isoscopoletin, the inhibitory active principles towards CCRF-CEM leukaemia cells and multi-drug resistant CEM/ADR5000 cells, from Artemisia argyi. Planta Med. 72:862–864. doi:10.1055/s-2006–947165 [DOI] [PubMed] [Google Scholar]
- Adams J. D., Garcia C., and Garg G.. 2012. Mugwort (artemisia vulgaris, artemisia douglasiana, artemisia argyi) in the treatment of menopause, premenstrual syndrome, dysmenorrhea and attention deficit hyperactivity disorder. Chinese Med. 3:116–123. [Google Scholar]
- Bao X., Yuan H., Wang C., Liu J., and Lan M.. 2013. Antitumor and immunomodulatory activities of a polysaccharide from artemisia argyi. Carbohydr. Polym. 98:1236–1243. doi:10.1016/j.carbpol.2013.07.018 [DOI] [PubMed] [Google Scholar]
- Cai P. 2001. The pharmacological action and application of artemisiae argyi. Lishizhen Med. Mat. Med. Res. 12:1137–1139. [Google Scholar]
- Carabaño R., Badiola I., Chamorro S., García J., García-Ruiz A. I., García-Rebollar P., Gómez-Conde M. S., Gutiérrez I., Nicodemus N., Villamide M. J., et al. . 2008. Review. New trends in rabbit feeding: influence of nutrition on intestinal health. Span. J. Agric. Res. 6:15–25. [Google Scholar]
- Chu W. B. 2016. Effects of artemisia argyi extract on production performance and immune function of broiler chickens [Master’s thesis]. Inner Mongolia Agr. Univ. Pre, Inner Mongolia, China. [Google Scholar]
- Chu G. M., and Song Y. M.. 2012. Effect of dietary addition of wormwood (Artemisia montana Pampan) on performance of fattening pigs and selected hematological and immunological indices. Livest. Sci. 147:188–191. doi:10.1016/j.livsci.2012.03.012 [Google Scholar]
- De blas C., and Mateos G. G.. 1998. Feed formulation. In: Nutrition of the rabbit. CAB International, Wallingford, UK: p. 222–232. [Google Scholar]
- Fann M. K., O’Rourke D., and Aclam D.. 2001. Normal bacterial flora of the rabbit gastrointestinal tract: a clinical approach. J. Exot. Pet Med. 10:45–47. doi:10.1053/saep.2001.19794 [Google Scholar]
- Ge Y. B., Wang Z. G., Xiong Y., Huang X. J., Mei Z. N., and Hong Z. G.. 2010. Anti-inflammatory and blood stasis activities of essential oil extracted from Artemisia argyi leaf in animals. J. Nat. Med. 70:531–538. doi:10.1007/s11418-016-0972-6 [DOI] [PubMed] [Google Scholar]
- Hu C. H., Qian Z. C., Song J., Luan Z. S., and Zuo A. Y.. 2013. Effects of zinc oxide-montmorillonite hybrid on growth performance, intestinal structure, and function of broiler chicken. Poult. Sci. 92:143–150. doi:10.3382/ps.2012-02250 [DOI] [PubMed] [Google Scholar]
- Isolauri E., Gotteland M., Heyman M., Pochart P., and Desjeux J. F.. 1990. Antigen absorption in rabbit bacterial diarrhea (RDEC-1). In vitro modifications in ileum and peyer’s patches. Dig. Dis. Sci. 35:360–366. [DOI] [PubMed] [Google Scholar]
- Ivanov A. I., Parkos C. A., and Nusrat A.. 2010. Cytoskeletal regulation of epithelial barrier function during inflammation. Am. J. Pathol. 177:512–524. doi:10.2353/ajpath.2010.100168 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Khan M., Yu B., Rasul A., Al Shawi A., Yi F., Yang H., and Ma T.. 2012. Jaceosidin induces apoptosis in U87 glioblastoma cells through G2/M phase arrest. Evid. Based. Complement. Alternat. Med. 2012:703034. doi:10.1155/2012/703034 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim S., Jin S. K. and Kang S. N.. 2009. Effects of feeding mugwort powder on meat composition and sensory characteristics in gilt. Korean J. Food Sci. An. 29:68–74. doi:10.5851/kosfa.2009.29.1.68 [Google Scholar]
- Lan M. B., Zhang Y. H., Zheng Y., Yuan H. H., Li H., and Gao Z. F.. 2010. Antioxidant and immunomodulatory activities of polysaccharides from moxa (Artemisia argyi) leaf. Food Sci. Biotechnol. 6:1463–1469. doi:10.1007/s10068-010-0209-5 [Google Scholar]
- Li J. and Gu Z. L., 2003. The nosogenesis of diarrhea and the regulation of bio-active substances on weanling rabbits. Chinese J. Vet. Med. 39:41–42. [Google Scholar]
- Liu L., Song Z., Jiao H., and Lin H.. 2014. Glucocorticoids increase NPY gene expression via hypothalamic AMPK signaling in broiler chicks. Endocrinology 155:2190–2198. doi:10.1210/en.2013-1632 [DOI] [PubMed] [Google Scholar]
- Livak K. J., and Schmittgen T. D.. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 25:402–408. doi:10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
- Mestecky J., Russell M. W., and Elson C. O.. 1999. Intestinal iga: novel views on its function in the defence of the largest mucosal surface. Gut 44:2–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shimizu M. 1999. Modulation of intestinal functions by food substances. Nahrung 43:154–158. doi:10.1002/(SICI)1521-3803(19990601)43:3<154::AID-FOOD154>3.0.CO;2-A [DOI] [PubMed] [Google Scholar]
- Turner J. R. 2006. Molecular basis of epithelial barrier regulation: from basic mechanisms to clinical application. Am. J. Pathol. 169:1901–1909. doi:10.2353/ajpath.2006.060681 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Turner J. R. 2009. Intestinal mucosal barrier function in health and disease. Nat. Rev. Immunol. 9:799–809. doi:10.1038/nri2653 [DOI] [PubMed] [Google Scholar]
- Wang X. J., Xu S. H., Liu L., Song Z. G., Jiao H. C., and Lin H.. 2017. Dietary fat alters the response of hypothalamic neuropeptide Y to subsequent energy intake in broiler chickens. J. Exp. Biol. 220(Pt 4):607–614. doi:10.1242/jeb.143792 [DOI] [PubMed] [Google Scholar]
- Yoon K. D., Chin Y. W., Yang M. H., and Kim J.. 2011. Separation of anti-ulcer flavonoids from artemisia extracts by high-speed countercurrent chromatography. Food Chem. 129:679–683. doi:10.1016/j.foodchem.2011.05.005 [DOI] [PubMed] [Google Scholar]
- Zhang L. B., Li J., Chen H. L., Yan X. Q. and Duanc J. A.. 2013. Chemical constituents from Artemisia argyi and their chemotaxonomic significance Author links open overlay panel. Biochem. Syst. Ecol. 50:455–458. doi:10.1016/j.bse.2013.06.010 [Google Scholar]
- Zhang P. F., Shi B. L., Su J. L., Yue Y. X., Cao Z. X., Chu W. B., Li K., and Yan S. M.. 2017. Relieving effect of Artemisia argyi aqueous extract on immune stress in broilers. J. Anim. Physiol. Anim. Nutr. (Berl). 101:251–258. doi:10.1111/jpn.12553 [DOI] [PubMed] [Google Scholar]