Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Salmonella enterica) |
DB7136 (Salmonella
enterica serovar Typhimurium; used to purify phages) |
PMID: 15743953 | Host for phages P22 and L |
|
| Strain, strain background (Escherichia coli) |
BL21/DE3/pLysS (Escherichia
coli; used for protein purification) |
Invitrogen | Protein expression system | |
| Strain, strain background (Phage P22) |
Phage P22 (P22 5-am N114) | PMID: 4773026 | Phage, clear plaque mutant | |
| Strain, strain background (Phage L) |
Phage L | PMID: 15743953 | Phage, clear plaque mutant | |
| Recombinant DNA reagent |
pMS11 (plasmid-coat protein; used in binding assays) |
PMID: 24126914 | Plasmid for coat protein complementation |
|
| Recombinant DNA reagent |
pDec (plasmid-Dec protein; used in binding assays) |
PMID: 22575828 | Plasmid for Dec protein purification-C-terminal his tag |
|
| Recombinant DNA reagent |
pDec-NMR (plasmid- Dec protein; used in NMR experiments) |
PMID: 30109462 | ||
| Sequence- based reagent |
Primers-coat protein mutants: E81R (gtaaacatgggaccgccggataacgacttcttccagttgcg); P82S (gcggtaaacatgggagagtccgataacgacttcttccagttgcg); R299E (gcgactttctccgtagtcgaagttgttgacggtactcatgttg); P322S (gatgtttccctgtcttccgagcagcgtgcctacgccaacgtt); E323R (gatgtttccctgtctccgcgccagcgtgcctacgccaacgtt) |
IDT | ||
| Sequence- based reagent |
Primers-Dec protein mutants: K30D (gtgtctgcgcttccgattaaagctatcgagtacgctaatgacgg); Y31A (tgtctgcgcttccgattaaagctatcaaagccgctaatgacgga); Y49E (ggcccgtatgctgaccaggagatgtcagcgcaaacagtagcc); Y71A (ggatatctgttccggagccaggccggcgagctgctctatatgagc); E73R (ggatatctgttccggagccagtacggcaggctgctctatatgagc) |
IDT | ||
| Commercial assay or kit |
Quikchange | Agilent | ||
| Commercial assay or kit |
Mini prep kits | Qiagen | ||
| Compound, chemical or drug |
Isopropyl β-D-1-thiogalactopyranoside |
GoldBio | Protein expression | |
| Compound, chemical or drug |
Ampicillin | Amresco | Selection media | |
| Other | LB (broth and agar) | Invitrogen | Media | |
| Other | 15N- Ammonium Chloride | Cambridge Isotope Laboratories |
Isotopic labeling | |
| Other | Deuterium Oxide (99.8%) | Sigma Aldrich | Isotopic labeling | |
| Other | 13C6 Glucose | Cambridge Isotope Laboratories |
Isotopic labeling | |
| Other | D-Glucose-13C6,1,2,3,4,5,6,6-d7 | Cambridge Isotope Laboratories |
Isotopic labeling | |
| Other | Quantifoil R2/2 | Ted Pella | Cryo-EM support film | |
| Software, algorithm | Leginon | PMID: 11121305 | RRID:SCR_016731 | Cryo-EM data collection |
| Software, algorithm | SerialEM | PMID: 16182563 | Cryo-EM data collection | |
| Software, algorithm | auto3dem | PMID: 17029842 | Cryo-EM 3D reconstruction |
|
| Software, algorithm | RobEM | Timothy S Baker's lab, UCSD | Cryo-EM 3D reconstruction |
|
| Software, algorithm | Phenix | PMID: 29872004 | RRID:SCR_014224 | Cryo-EM map fitting and analysis |
| Software, algorithm | UCSF Chimera | PMID: 15264254 | RRID:SCR_004097 | cryo-EM image visualization |
| Software, algorithm | NAMD | PMID: 16222654 | RRID:SCR_014894 | Homology modeling |
| Software, algorithm | CHARMM | PMID: 19444816 | RRID:SCR_014892 | Homology modeling |
| Software, algorithm | MMTSB Tool Set | PMID: 15099834 | Homology modeling | |
| Software, algorithm | ccpNmr analysis | PMID: 15815974 | RRID:SCR_016983 | NMR data analysis |
| Software, algorithm | Aria | PMID: 17121777 | NMR data analysis | |
| Software, algorithm | CS-ROSETTA | PMID: 19034676 | RRID:SCR_015701 | NMR data analysis |
| Software, algorithm | TALOS-N | PMID: 23728592 | NMR data analysis | |
| Software, algorithm | Tensor-2 | PMID: 10718609 | NMR data analysis | |
| Software, algorithm | Dali | PMID: 20457744 | RRID:SCR_013433 | NMR data analysis |
| Software, algorithm | NMRbox | PMID: 28445744 | RRID:SCR_014827 | NMR data analysis |