Skip to main content
NCBI home page
mSphere logoLink to mSphere
. 2019 Apr 3;4(2):e00040-19. doi: 10.1128/mSphere.00040-19

In Silico Identification of Three Types of Integrative and Conjugative Elements in Elizabethkingia anophelis Strains Isolated from around the World

Jiannong Xu a,✉, Dong Pei a,*, Ainsley Nicholson b, Yuhao Lan a, Qing Xia a
Editor: Michael Koomeyc
PMCID: PMC6449604  PMID: 30944210

Elizabethkingia anophelis is an opportunistic human pathogen, and the genetic diversity between strains from around the world becomes apparent as more genomes are sequenced. Genome comparison identified three types of putative ICEs in 31 of 36 strains. The diversity of ICEs suggests that they had different origins. One of the ICEs was discovered previously from a large E. anophelis outbreak in Wisconsin in the United States; this ICE has integrated into the mutY gene of the outbreak strain, creating a mutator phenotype. Similar to ICEs found in many bacterial species, ICEs in E. anophelis carry various cargo genes that enable recipients to resist antibiotics and adapt to various ecological niches. The adaptive immune CRISPR-Cas system is present in nine of 36 strains. An ICE-derived spacer was found in the CRISPR locus in a strain that has no ICE, suggesting a past encounter and effective defense against ICE.

KEYWORDS: CRISPR-Cas, Elizabethkingia anophelis, comparative genomics, genome epidemiology, integrative and conjugative element

ABSTRACT

Elizabethkingia anophelis is an emerging global multidrug-resistant opportunistic pathogen. We assessed the diversity among 13 complete genomes and 23 draft genomes of E. anophelis strains derived from various environmental settings and human infections from different geographic regions around the world from 1950s to the present. Putative integrative and conjugative elements (ICEs) were identified in 31/36 (86.1%) strains in the study. A total of 52 putative ICEs (including eight degenerated elements lacking integrases) were identified and categorized into three types based on the architecture of the conjugation module and the phylogeny of the relaxase, coupling protein, TraG, and TraJ protein sequences. The type II and III ICEs were found to integrate adjacent to tRNA genes, while type I ICEs integrate into intergenic regions or into a gene. The ICEs carry various cargo genes, including transcription regulator genes and genes conferring antibiotic resistance. The adaptive immune CRISPR-Cas system was found in nine strains, including five strains in which CRISPR-Cas machinery and ICEs coexist at different locations on the same chromosome. One ICE-derived spacer was present in the CRISPR locus in one strain. ICE distribution in the strains showed no geographic or temporal patterns. The ICEs in E. anophelis differ in architecture and sequence from CTnDOT, a well-studied ICE prevalent in Bacteroides spp. The categorization of ICEs will facilitate further investigations of the impact of ICE on virulence, genome epidemiology, and adaptive genomics of E. anophelis.

IMPORTANCE Elizabethkingia anophelis is an opportunistic human pathogen, and the genetic diversity between strains from around the world becomes apparent as more genomes are sequenced. Genome comparison identified three types of putative ICEs in 31 of 36 strains. The diversity of ICEs suggests that they had different origins. One of the ICEs was discovered previously from a large E. anophelis outbreak in Wisconsin in the United States; this ICE has integrated into the mutY gene of the outbreak strain, creating a mutator phenotype. Similar to ICEs found in many bacterial species, ICEs in E. anophelis carry various cargo genes that enable recipients to resist antibiotics and adapt to various ecological niches. The adaptive immune CRISPR-Cas system is present in nine of 36 strains. An ICE-derived spacer was found in the CRISPR locus in a strain that has no ICE, suggesting a past encounter and effective defense against ICE.

INTRODUCTION

The genus Elizabethkingia belongs to the family Flavobacteriaceae in the phylum Bacteroidetes. It was separated from the genus Chryseobacterium in 2005 (1). The two member species initially recognized were Elizabethkingia meningoseptica, named based on its initial isolation as the causative agent for neonatal meningitis (2), and Elizabethkingia miricola, an isolate obtained from condensation water from Space Station Mir (3). A third species, Elizabethkingia anophelis, was proposed in 2011 (4) based on the description of the type strain R26T that was originally isolated from the midgut of Anopheles gambiae mosquitoes maintained in Stockholm University in Sweden (5). In 2015, a new species, Elizabethkingia endophytica was proposed (6), but whole-genome sequence (WGS)-based genome comparison revealed it to be a homotypic synonym of E. anophelis (7, 8). Additional species have since been added to the genus (8).

In 2011, the first human infection attributed to E. anophelis was documented in Central Africa Republic, neonatal meningitis caused by the bacterium (9). Later, an E. anophelis outbreak in an intensive-care unit in Singapore in 2012 was reported (10), followed by the worrying account of E. anophelis transmission from a mother to her infant in Hong Kong (11). In 2016, a large E. anophelis outbreak occurring in Wisconsin in the United States was unusual in that a substantial proportion of patients were not already hospitalized and were instead admitted directly from their homes. No indication of human-to-human transmission was found (12–14). Human infection cases of E. anophelis have been reported with increasing frequency around the world (13, 15–17), aided in part by improved identification methods. Several strains previously described as E. meningoseptica were determined to actually belong to the E. anophelis species (18). In addition to human-derived strains, multiple strains of the species have been isolated from its namesake, the mosquito, and their genomes have been sequenced (19–21).

Genome comparison of pathogenic bacteria in general has greatly increased our understanding of the evolution, pathogenesis, and epidemiology in many pathogen outbreak investigations (22–26). Genome analysis of E. anophelis strains has revealed substantial genetic diversity (11, 16, 27–31), much of it mediated by mobile genetic elements (MGEs). Horizontal transfer of MGEs between bacterial strains occurs frequently and is a major source of genetic variation in bacteria (32). Therefore, an improved understanding of the MGEs in E. anophelis should facilitate the genomic epidemiological studies of pathogenic strains of E. anophelis in the future.

One type of modular mobile genetic elements, known as integrative and conjugative elements (ICEs), is capable of transferring between bacteria horizontally via conjugation. ICEs integrate into the host chromosome and replicate along with the genome, and they can excise, form a plasmid, and relocate to another site in the genome or transfer to another bacterial cell many generations later (33). The cargo genes that are brought in by ICEs may endow the recipient bacteria with new phenotypes (32–35). For example, in Pseudomonas syringae pv. actinidiae, the resistance to copper, arsenic, and cadmium was attributed to the resistant genes that were carried in ICEs (36). In Helicobacter pylori, ICE tfs4 has been identified in certain strains mediating gastric disease. The presence of the tfs4 ICE has been associated with virulence, although mechanisms behind the virulence phenotype remain unknown (37). Several ICEs have been identified in taxa of Bacteroides, including CTnDOT (38, 39), CTnERL (40, 41), and CTnGERM1 (42). In E. anophelis, an ICE named ICEEa1 has been identified in the strains associated with the outbreak in Wisconsin and in unrelated strains from the outbreak in Singapore (43).

In this study, we searched for ICEs in 13 complete genomes and 23 draft genomes of E. anophelis strains around the world. Based on the architecture of conjugation modules and associated signature genes, three types of ICEs were recognized. As E. anophelis is recognized as an environmental bacterium, the high prevalence and diversity of ICEs as well as the mosaic integration pattern in different strains suggest that ICEs play a significant role in shaping its genome to adapt to different environmental niches.

RESULTS

Origin and geographic distribution of the strains.

In this study, 13 complete genomes and 23 draft genomes of E. anophelis were compared. These strains were collected from mosquitoes, human patients, and environment globally across Asia, Europe, Africa, and North America between 1950s to the present (Table 1 and Fig. 1).

TABLE 1.

Elizabethkingia anophelis strains used in this study

WGS
accession no.		 Level Cluster Strain Source Region Collection
time		 ICE type(s)
(n)a 		CRISPR
(n)b
ERS1197909c Draft II AmMS250/CIP104057 Human patient US 1994 II (1) No
CP023010.1 Complete II FDAARGOS-198 Human patient Sweden Unknown I (2) No
MAHA01 Draft II CSID 3000516074 Human patient Illinois, US 2016 I (1) No
CP016373.1 Complete II 3375 Human patient South Carolina, US 1957 I (1) No
MAHS01 Complete II E6809 Human patient California, US 1979 II (1) No
CP014340.1 Complete II F3543 Human patient Florida, US 1982 II (1) No
CP016370.1 Complete II 0422 Human patient Florida, US 1950 II (1), III (1) No
FTQY00000000.1 Draft II CIP60.58 Unknown Unknown Unknown II (1), III (1) No
CBYD000000000.1 Draft II PW2806 Human patient Hong Kong 2012 I (1) No
CBYE000000000.1 Draft II PW2809 Human patient Hong Kong 2012 I (1) No
ERS605480c Draft II NCTC10588 Human patient US 1959 I (1), II (1) No
FTQZ00000000.1 Draft II CIP111067 Unknown Unknown Unknown No ICE Yes (37)
CP014805.2 Complete III CSID 3015183678 Human patient Wisconsin, US 2016 I (1) No
ERS1197911c Draft III 37-75/CIP79.29 Human patient St. Nazaire, France 1979 I (1) No
CP023401.1 Complete III R26 Mosquito
A. gambiae 		Stockholm, Sweden 2005 III (2) No
CP023402.1 Complete III Ag1 Mosquito
A. gambiae 		New Mexico, US 2012 III (2) No
CP023404.1 Complete III AR4-6 Mosquito
A. sinensis 		Sichuan, China 2015 III (2) No
CP023403.1 Complete III AR6-8 Mosquito
A. sinensis 		Sichuan, China 2015 III (2) No
LFKT01 Draft III As1 Mosquito
A. stephensi 		Pennsylvania, US 2015 III (2) No
CP007547.1 Complete I NUHP1 Human patient Singapore 2012 I (1), II (1), III (4) No
ASYJ01 Draft I NUH6 Human patient Singapore 2012 I (1), III (3) No
ASYK01 Draft I NUH11 Human patient Singapore 2012 I (1), II (1), III (1) No
CCAC01 Draft I Po0527107 Human patient Central African
Republic		 2006 III (1) Yes (21)
CCAB000000000.1 Draft I V0378064 Human patient Central African
Republic		 2011 III (1) Yes (23)
FTPG00000000.1 Draft I LDVH-AR107 Common carp
Cyprinus carpio 		Montpellier, France 2004 III (1) Yes (42)
CP006576.1 Complete I FMS-007 Human patient Xiaoshan, China 2015 II (1) Yes (15)
LWDS00000000.1 Draft I EM361-97 Human patient Taiwan 2000s III (1) No
AVCQ00000000.1 Draft I 502 Human patient Birmingham, UK 2012 II (1) No
CP016374.1 Complete I F3201 Human patient Kuwait 1982 II (1) No
CP016372.1 Complete I JM-87 Corn Zea mays Alabama, US 2011 II (1), III (1) No
ERS1197907c Draft I 8707/CIP78.9 Human patient New York, US 1962 No ICE Yes
JNCG00000000.1 Draft I B2D Human patient Malaysia 2013 No ICE No
FTRB00000000.1 Draft I CIP111046 Human patient Unknown Unknown II (1) Yes (6)
CBYF000000000.1 Draft I PW2010 Human patient Hong Kong 2012 No ICE Yes (27)
DRS013860 Draft I GTC_10754 Unknown Japan 2014 No ICE Yes (32)
LPXG00000000.1 Draft I 12012-2 PRCM Human patient Fujian, China 2009 II (1), III (1) No
Open in a new tab
a

n is the number of ICEs in the type.

b

n is the number of spacers in the CRISPR locus.

c

There are no assemblies in the NCBI database for these four strains. We assembled the genomes from Illumina reads directly.

FIG 1.

FIG 1

Open in a new tab

Evolutionary relationship and geographic locations of the strains. (A) The phylogenetic tree was derived from the core genome SNP comparison. The type of ICE is shown in red brackets after the strain name. The five circles labeled (a) to (e) in red demonstrate the protein identity between the genomes in the corresponding clades. The color bar represents the percent identity when a genome was compared to the reference genome. (B) Geographic distribution of the strains. Clusters were color coded, and the strain name, collection time, and clade were specified in the map. The letters correspond to the clades in panel A. Strain information was presented in Table 1.

Core genome-based phylogeny of the strains.

The pan-genome of a bacterial species is comprised of a core genome and an accessory genome. The core genome is a set of genes that are conserved and shared by all strains, while the accessory gene set is shared by only some strains (44, 45). Because the core genome contains essential genes and their inheritance is necessitated, they carry more reliable evolutionary information than accessory genes do for inferring phylogenetic relationships. Hence, core genome-based single nucleotide polymorphism (SNP) typing has become a recognized method for accurate evolutionary reconstructions (46, 47). The phylogenetic relationship of the core genome from these strains was reconstructed using Parsnp from the Harvest suite (47). Across the 36 genomes, Parsnp recognized 37,781 anchors and 985 maximal unique matches (MUMs) that anchored the genome alignment. The genome alignment revealed that 68% of the genome regions were shared by all 36 genomes, so these regions were set as core genome. A phylogenetic tree was constructed using the SNPs in the core genome. The tree topology appeared similar regardless of which complete genome—R26T, 0422, CSID3015183678, or NUHP1—was used as the reference for core genome alignment (data not shown). Based on the tree topology, the strains were sorted into three clusters (Fig. 1 and Table 1). Cluster I contained 14 strains with the genome of strain 12012-2 PRCM at the basal position. Cluster II consisted of two clades, with six strains in each clade. The strains in this cluster were globally distributed and collected over decades starting in 1950s. Cluster III had two clades as well. One clade contained all five mosquito-derived strains, while the other clade contained strain 37-75 obtained from a human infection in France in 1979 and strain CSID3015183678, which was a representative of the strains associated with the Wisconsin outbreak in 2016 (43).

There was no clear indication of geography-based clustering. Figure 1B presents the distribution of strains with their cluster/clade designation and collection date. Among the 14 strains in cluster I, nine strains were collected in Asia, two in Europe, and three in Africa. Among nine strains in cluster II, seven were collected in North America, one in Europe, and one in Asia (Fig. 1 and Table 1). Closely related species that formed the clades a, b, c, d, and e were scattered in different geographic locations (Fig. 1). The clustering of these strains was corroborated by the higher percent identity in the protein sequences between the genomes. Overall, it appears that closely related strains can be widely separated both temporally and spatially.

Identification of ICEs in the genomes.

A genome region was considered a putative ICE if it harbored genes encoding an integrase, a relaxase (which nicks the DNA strand at the origin of transfer oriT), a coupling protein VirD4 ATPase, T4CP, (which couples the relaxosome to the type IV secretion system [T4SS]), and several Tra proteins in the T4SS. These components are involved in integration, excision, and/or conjugation process, which have been used as markers for identifying putative ICEs in genomes (48, 49). So far, only one plasmid has been isolated and sequenced (GenBank accession number CP016375) which is associated with strain F3201. There are no conjugation genes annotated in the complete plasmid sequence, so the plasmid is not a conjugative plasmid. Therefore, the ICE signature genes identified are a part of the genome in these ICE-containing genomes. Cargo genes are carried in the unit, many are flanking the region with the signature genes. Insertion sites of putative ICE loci were recognized and mapped in genomes based on pairwise comparison with closely related genomes lacking the putative ICE. Among the 36 strains, 31 strains contained at least one putative ICE, and a total of 52 putative ICEs were detected. There were eight ICEs in which no integrase was found in the element. Since integrase is necessary for integration and excision, the unit lacking integrase could not conduct integration or excision. The integrase could have been lost after integration into the genome. These elements were defined as degenerated ICEs (Table 2). According to the architecture of the modular genes, these putative ICEs were classified into three types (Fig. 2). For the ease of readability, we omit “putative” before ICE in the remaining text.

TABLE 2.

Types of ICEs identified in the strains

Element Strain(s) Integration site Integrase(s)a (n) Size (nt)b ICE TPA
GenBank
accession no.
ICEEaI(1) 3375 Siroheme synthase and HP Tyr (1) 63,549 BK010586
ICEEaI(1) CSID3015183678 Inside mutY Tyr (1) 62,894 BK010587
ICEEaI(1) FDAARGOS-198 EngB and ElaA Tyr (1) 62,860 BK010588
ICEEaI(1) NUHP1 SlyD and HP Tyr (1) 62,960 BK010589
ICEEaI(2) FDAARGOS-198 TonB receptor and HP Tyr (3) 69,029 BK010590
ICEEaI(3) 37-75 Inside Ahp Tyr (1) 65,419 Not availablec
ICEEaI(4) CSID3000516074 HP and LuxR TF Tyr (1), DDE(1) 97,160 BK010591
ICEEaI(5) NCTC10588 Macrolide-efflux protein and LytR/AlgR TR Tyr (1) 81,809 Not availablec
ICEEaI(6) PW2806, PW2809 Efflux protein and peptidase Tyr (1) 79,842 BK010592
ICEEaI(7) NUH6 TomB receptor and HP Tyr (1) 59,635 BK010593
ICEEaI(8) NUH11 tRNA-Asp-GTCa Tyr (2) 95,803 BK010594
ICEEaII(1) 0422 tRNA-Leu-CAA No Int 63,840 BK010595
ICEEaII(1) CIP60.58 tRNA-Leu-CAA No Int 63,840 BK010596
ICEEaII(2) 502 tRNA-Leu-CAA IS481 (2) 38,146 BK010597
ICEEaII(3) 12012-2 PRCM tRNA-Leu-CAA No Int >56,734 BK010598
ICEEaII(4) AmMS250 tRNA-Leu-CAA No Int >64,773 Not availablec
ICEEaII(5) CIP111046 tRNA-Leu-CAA No Int 87,438 BK010599
ICEEaII(6) F3201 tRNA-Leu-CAA No Int 91,608 BK010600
ICEEaII(7) F3543 tRNA-Leu-CAA No Int 104,603 BK010601
ICEEaII(8) FMS-007 tRNA-Leu-CAA DDE (1) 73,167 BK010602
ICEEaII(9) NCTC10588 tRNA-Leu-CAA Ser (2) 67,087 Not availablec
ICEEaII(10) JM-87 tRNA-Leu-CAA Ser (1), IS481 (1) 36,967 BK010603
ICEEaII(11) NUH11 tRNA-Leu-CAA No Int 94,112 BK010604
ICEEaII(12) NUHP1 tRNA-Ser-GGA Tyr (1) 71,591 BK010605
ICEEaIII(1) R26, Ag1, Ar4-6, AR6-8 tRNA-Ser-TGA Tyr (4), DDE (1) 101,692 BK010606
ICEEaIII(2) R26, Ag1, Ar4-6, AR6-8 tRNA-Arg-ACG Tyr (1), DDE (1) 77,358 BK010607
ICEEaIII(3) As1 tRNA-Arg-ACG Tyr (1), Ser (1), DDE (1) >44,888 BK010608
ICEEaIII(4) As1 tRNA-Ser-TGA DDE (1) >31,354 BK010609
ICEEaIII(5) NUHP1 tRNA-Glu-TTC Tyr (4) 60,900 BK010610
ICEEaIII(6) NUHP1 tRNA-Glu-TTC Tyr (1) 74,499 BK010611
ICEEaIII(7) NUHP1 tRNA-Asp-GTC Tyr (1) 116,331 BK010625
ICEEaIII(8) NUHP1 tRNA-Asp-GTC Tyr (3) 109,040 BK010626
ICEEaIII(9) NUH6 tRNA-Gln-TTG Tyr (1) >30,166 BK010612
ICEEaIII(10) NUH6 tRNA-Glu-TTC Tyr (1) >33,929 BK010623
ICEEaIII(11) NUH6 tRNA-Asp-GTC Tyr (1) >98,049 BK010613
ICEEaIII(12) NUH11 Beta-lactamased Tyr (2)d 84,534 BK010614
ICEEaIII(13) 0422 tRNA-Gln-TTG Tyr (2), DDE (4) 67,662 BK010615
ICEEaIII(13) CIP60.58 tRNA-Gln-TTG Tyr (2), DDE (4) 66,636 BK010616
ICEEaIII(14) Po0527107 tRNA-Glu-TTC Tyr (1) >31,721 BK010617
ICEEaIII(14) V0378064 tRNA-Glu-TTC Tyr (1) >37,189 BK010618
ICEEaIII(15) JM-87 tRNA-Ser-TGA Tyr (1) 73,828 BK010624
ICEEaIII(16) 12012-2 PRCM tRNA-Glu-TTC Tyr (1) >31,732 BK010619
ICEEaIII(17) LDVH-AR107 tRNA-Asp-GTC Tyr (2) >84,845 BK010620
ICEEaIII(18) EM361-97 tRNA-Arg-ACG Tyr (1), DDE (2) 69,393 BK010621
ICEEaIII(19) EM361-97 tRNA-Glu-TTC DDE (1) >28,887 BK010622
Open in a new tab
a

Tyr, tyrosine type; Ser, serine type; DDE, DDE transposase; IS481, IS481 family of transposases; Int, integrase.

b

Size (in nucleotides [nt]) is shown. >, elements were partially assembled.

c

There are no assemblies in the NCBI database for these four strains, so we did not submit third party annotation (TPA) for these genomes to GenBank.

d

Two elements, ICEEaI(8) and ICEEaIII(12) in strain NUH11 combined and integrated between tRNA-Asp-GTC and beta-lactamase. These two elements may share the same integrase.

FIG 2.

FIG 2

Open in a new tab

Schematic view of the architecture of conjugation modular genes in the three types of ICEs.

Type I ICEs were featured by 13 tra genes (traABBDEGIJKMNOQ) in addition to genes coding for T4CP, relaxase, and integrase. In most cases, the T4CP and relaxase genes were located tandemly upstream of the tra gene cassette, and the integrase gene was located downstream of the tra gene cassette (Fig. 2). The two traB genes in tandem were independent from each other, both with complete CDS. Such traB genes in tandem were predicted in a few genomes in E. meningoseptica and Chryseobacterium gleum as well. A total of eight type I elements were found in 11 strains (Table 2). ICEEaI(1) was described previously and named ICEEa1 in strain CSID3015183678 (Wisconsin, US, 2016). It inserted into and disrupted the gene encoding MutY, which is an adenine DNA glycosylase that is required for repairing G-A mispairs, causing the strain to be more prone to mutation (43). ICEEaI(1) was found between genes in three additional strains, NUPH1 (Singapore, 2012), 3375 (South Carolina, US, 1957), and FDAARGOS-198 (Sweden, collection time unknown). Each of the four ICEEaI(1) elements has a distinct insertion site in the respective genome (Fig. 3). Other type I ICEs inserted into intergenic regions, except for the one in strain 37-75, which inserted into the gene encoding an alkyl hydroperoxide reductase (Ahp) between codons K207 and I208. This protein is a primary scavenger of H2O2 in Escherichia coli (50), so its disruption by this ICE may result in a loss of function and make the strain vulnerable to oxidative stress. Integration sites of these elements were listed in Table 2 and marked in Fig. 3.

FIG 3.

FIG 3

Open in a new tab

Integration sites of ICEs in different strains. (A) Locations of the ICEEaI integration sites. (B) Locations of the tRNA genes where ICEEaII and ICEEaIII integrated. The ICE types were color coded. Refer to Table 2 for strain and ICE information.

Twelve type II ICEs were identified in 13 strains (Table 2). Unlike type I ICEs, the T4CP and relaxase genes in type II ICEs were separated by one or more predicted CDS. The cassette of tra genes consisted of traABDEFGIJKMNOQ. There was a gene located between traD and traE, encoding a RadC domain-containing protein (Fig. 2). All ICEEaII ICEs integrated next to a tRNA gene. In 12 strains, the elements resided at the 3′ end of the tRNA-Leu-CAA. Only ICEEaII(12) in strain NUHP1 was located after the tRNA-Ser-GGA (Table 2 and Fig. 3). Integrases were found in four of the 12 elements (see below). Integrases are required for integration and excision, so the absence of an integrase in the elements suggests that these elements may have degenerated and may not be mobilizable. These eight elements were defined as degenerated ICEs.

Type III ICEs were recognized in 16 strains. The structure was quite different from that in type I and II ICEs, with the presence of only seven tra genes, traAEGJKMN. The relaxase and T4CP genes flanked the tra genes. In 11 of 16 elements, a gene was present after the traN, encoding a large protein (791 to 1,177 amino acids [aa]) with a RadC domain (Fig. 2). The type III ICEs integrated after a tRNA gene. Five tRNA genes, tRNA-Arg-ACG, tRNA-Gln-TTG, tRNA-Asp-TGA, tRNA-Ser-TGA, and tRNA-Glu-TTC, were targeted by ICEEaIIIs (Fig. 3). In strain NUHP1, two type III elements, ICEEaIII(7) and ICEEaII(8), were colocated tandemly between two tRNA-Asp-GTC and separated by a tRNA-Asp-GTC. In strain NUH11, ICEEaI(8) and ICEEaIII(12) combined as one segment, which was localized between the tRNA-Asp-GTC and the gene encoding a beta-lactamase. In most type III elements, at least one integrase gene was present.

In sum, eight type I ICEs, 12 type II ICEs (including eight degenerated elements), and 19 type III ICEs were identified, and 15 elements in 11 draft genomes were partially assembled (Table 2). The size of ICEs was up to 116.3 kb in complete genomes. Annotated ICEs were listed in Table S1 in the supplemental material, which included predicted CDS and gene functions. In 36 genomes examined, 17 carried one ICE and 14 harbored more than one ICE. No ICEs were found in these five strains: PW2810, B2D, 8707, CIP11067, and GTC_10754 (Tables 1 and 2).

TABLE S1

Annotated ICEs in the strains. Download Table S1, XLSX file, 1.4 MB (1.4MB, xlsx) .

This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.

Phylogenetic relationship of the ICEs.

To track the evolutionary history of these ICEs, the nucleotide sequences of the genes encoding relaxase, T4CP, TraG, and TraJ from each ICE were compared. As shown in Fig. 4, the type I and II elements were more closely related, forming a clade distinct from the type III clade. This pattern was consistent with the type classification based on the structure of the conjugation module (Fig. 2). The sequences of type I and II relaxase and TraJ genes had less resolution than the T4CP and TraG genes to separate type I from type II elements. The conservative nature of the relaxase and TraJ genes suggests that both may have been under functional constraint with limitation for changes during evolution. The relaxase gene of ICEEaI(2) in strain FDAARGOS-198 was an outlier in the type I elements. In Fig. 1, the ICE type of each strain was marked in red brackets on the SNP core genome tree. There was no clear association pattern between ICE types and core genome clusters, and no geographic or temporal patterns were observed in the distribution of the ICE types.

FIG 4.

FIG 4

Open in a new tab

Phylogenetic relationship of the T4CP, relaxase, TraG, and TraJ genes associated with ICEs. The nucleotide sequences from different ICEs were aligned, and the evolutionary history was inferred using the neighbor-joining method. The evolutionary distances were computed using different models to reconstruct the phylogenetic trees with the bootstrap test using 1,000 replicates, which generated similar tree topology. The consensus trees generated using the Kimura two-parameter model were presented. The bootstrap values are shown on the nodes.

Integrases.

Integrases are required for ICE integration and excision. A total of 43 tyrosine recombinases (TRs) were found in 8/8 type I ICEs, 1/12 type II ICEs, and 18/19 type III ICEs. One ICE may carry up to four tyrosine type recombinases (Table 2). A phylogenetic tree of tyrosine recombinases was constructed using protein sequences from the E. anophelis ICEs as well as several Bacteroides transposons. As shown in Fig. 5, TRs in type I ICEs form a clade with IntDOT at the basal position, and two TRs of type III ICEs are included in the clade. The clade has strong bootstrap support. However, the protein sequence identity between the TRs in type I ICEs and IntDOT is only about 41%. The ICEEaI(2)FDAARGOS-198_2 is an outlier. The TRs in type III ICEs show greater sequence divergence and split into several clades, with most clades receiving strong bootstrap support. One of these clades contained IntN1 which is associated with NBU1, a mobilizable transposon, in Bacteroides (51). DDE transposases were identified in 8/19 type III ICEs and one type I ICE. In type II ICEs, tyrosine recombinase was found only in one type II ICE, ICEEaII(12) NUHP1 (Fig. 5 and Table 2). Serine recombinases were found in ICEEaII(10) JM-87 and ICEEaII(9) NCTC10588. In addition, transposases in the IS481 family (52) are present in ICEEaII(2) 502 and ICEEaII(10) JM-87 (Table 2). So, in 12 type II CIEs, only four carry an integrase. No integrases were identified in the remaining eight elements. These elements may have degenerated and become functionally deficient.

FIG 5.

FIG 5

Open in a new tab

Phylogenetic relationship of the tyrosine recombinase proteins associated with ICEs. The protein sequences of tyrosine recombinases were aligned, and the evolutionary history was inferred using the neighbor-joining method. The evolutionary distances were computed using different models to reconstruct the phylogenetic trees with the bootstrap test using 1,000 replicates, which generated similar tree topology. The consensus tree generated using the JTT model was presented. The bootstrap values are shown on the nodes.

Cargo genes.

In addition to the module genes that define an ICE, there are a diverse cargo of genes that are carried in ICEs. The cargo genes in each ICE are presented in Table S1. Restriction-modification (R-M) system components such as DNA modification methylases, type I R-M systems, and type II restriction enzymes were prevalent in the ICEs of all three types. In addition, the anti-restriction protein ArdA was detected in three type II ICEs and one type III ICE. A beta-lactamase gene was found in two ICEs in two strains. The component genes of tripartite nodulation-division RND complex multidrug efflux pump system (53) were carried in the type I ICEs in six strains, one of the three type III ICEs in strain NUHP1, and the type II ICE in strain F3543 (Table S1). ABC transporters for various substrates, such as manganese, potassium, and oligopeptides, were found in all ICEs. TonB-dependent receptors for siderophore import or carbohydrate uptake (SusC) were present in several ICEs. There were various transcriptional regulators in the ICEs, such as AraC family, ArsR family, MarR family, HxlR family, and TetR family. The AraC family transcriptional regulators (AFTRs) were very prevalent; a total of 36 of these were found in the ICEs in 19 strains. In addition, a two-component regulatory system is present in the type I ICEs in three strains. Some ICEs also carried DNA topoisomerases, helicases, primases, and polymerases, presumably for independent replication while in plasmid form.

CRISPR-Cas loci.

A type II-C CRISPR-Cas system (54) containing a CRISPR array and the genes encoding Cas9, Cas1, and Cas2 proteins was detected in nine strains (Table 1) with a prevalence of 25% (9/36). The unit is located downstream of the gene encoding a cobalt-zinc-cadmium resistance protein CzcD. The number of spacers varies between 6 in strain CIP111046 to 47 in strain CIP111067. LDVH-AR107 was isolated from the internal organ of a common carp Cyprinus carpio collected in 2004 in Montpellier, France. It has two CRISPR loci, each with 21 spacers. Interestingly, strains LDVH-AR107, Po0527107, and V0378064 share 12 spacers, despite the difference of geographic origins and sampling time (Table 1), suggesting that these CRISPR loci may have been derived from a common ancestor. The CRISPR locus of strain GTC_10754 carried 32 spacers, and the spacer at the far end of the CRISPR array might be derived from the gene encoding a hypothetical protein located in the region between TraG and Tra J in a type III ICE. The predicted spacer (CTTATTTAAATATTATGCTAACAGAGATAA) was 30 nt long, the 2 to 30 nucleotides of the spacer, TTATTTAAATATTATGCTAACAGAGATAA, had a perfect match with the target sequence, or corresponding protospacer, in five type III ICEs, ICEEaIII(1), -(3), -(6), -(9), and -(15), and the same spacer had one mismatch with the protospacer in four other elements, ICEEaIII(2), -(4), -(13), and -(18). These protospacer carrying ICEs are present in five strains derived from mosquitoes (R26T, Ag1, As1, AR4-6, and AR6-8), three strains derived from human infection (0422, CIP60.85, and EM361-97), and one strain derived from corn (JM-87). It is conceivable that the spacer might have been acquired from previous encounters with the type III ICEs and inserted into the CRISPR locus. Theoretically, strain GTC_10754 can target the ICEs with the protospacer. In fact, no ICEs are present in strain GTC_10754 (Table 1). The CRISPR loci in the other eight strains do not contain any spacers derived from the ICEs in this study.

DISCUSSION

Many genomes have been sequenced for E. anophelis strains derived from different sources, including mosquitoes, human infections, hospital environments, fish, and corn stems. This genome availability enabled a comparative genomics approach to investigate the genetic architecture and repertoire of the E. anophelis population.

Core genome-based phylogeny.

The core genome is shared by all strains and consists of essential genes that are vertically transmitted, while genes in the accessory genome are present only in a subset of strains. The sum of the core and accessory genomes in all strains constitutes a pan-genome for the species (45, 55, 56). Due to its inheritability, the core genome is intrinsically suitable for inferring phylogenetic relationships (47). In the present study, the core genome SNP analysis separated the E. anophelis strains into three clusters (Table 1 and Fig. 1); however, no correlation patterns were found between genetic relatedness and spatial distribution. The E. anophelis outbreak in Singapore in 2012 was caused by isolates derived from the hospital environment (10, 27). The Wisconsin outbreak in 2016 showed a different pattern; many patients were likely infected separately before they were hospitalized (12). Recently, an epidemiological genomic survey using core genome comparison was reported on the transmission pattern of global spread of aggressive nontuberculous Mycobacterium abscessus (57). Originally, human infections were caused by M. abscessus isolates acquired from the environment. However, the dominant circulating strains within the global M. abscessus patient community may be mediated by nosocomial fomite spread (57). Some cases may result from hospital-based cross-infection (58). The core genome data from the present study suggest that E. anophelis infections have been caused by diverse strains acquired from the environment. The mosquito-derived strains from three mosquito species were clustered together and distinct from the strains derived from human infections (Fig. 1). Association of E. anophelis has been documented in several different mosquito species, including Anopheles gambiae (59), Culex quinquefasicatus (60), and Aedes aegypti (61), and a role for the bacteria in larval development has been hypothesized. The core genome phylogeny suggests that mosquito-associated strains and strains derived from human infections were not epidemiologically linked.

Diverse types of ICEs in the strains.

Genome diversification promotes bacterial adaptation and evolution. ICE, a type of mobile genetic element, contributes significantly to the pan-genome reservoir with potentially adaptive genes (33, 48). Several ICEs have been found in the taxa of Bacteroides (42, 49, 62–64), which belong to the family Bacteroidaceae in the phylum Bacteroidetes. Of these elements, CTnDOT in Bacteroides thetaiotaomicron has been studied extensively (39, 65–67). The ICEs identified in E. anophelis are structurally distinct from CTnDOT. Conserved features of relaxase, coupling protein, and conjugative elements have been used for identifying ICEs in a wide variety of genomes (48, 49). Using this approach, we categorized the ICEs in E. anophelis strains into three types based on the architecture of the elements and the phylogeny of sequences from four genes in the elements (Fig. 2 and 4). Type I elements are closer to type II elements. Diverse integrases were associated with ICEs. Tyrosine recombinases are present in all type I and III ICEs. Serine recombinase, tyrosine recombinase, or transposase was found in 4/12 type II ICEs, and the remaining eight elements lack an integrase. In that integrase is essential for integration and excision of an ICE, the absence of integrase in the ICEs suggests that these elements had degenerated and were no longer mobile. Type II and III ICEs tended to integrate adjacent to a tRNA gene, while the type I ICEs used a non-tRNA gene region for integration (Fig. 3). Integration into a gene could result in a loss of function. For example, all strains attributed to the 2015 Wisconsin E. anophelis outbreak, including strain CSID3015183678, contained an ICE disrupting the mutY gene, which is required for excision of G-A mismatch (68, 69) and consequently demonstrated a high rate of nonsynonymous to synonymous substitutions compared to strains with an intact mismatch repair system (43). The presence of various element-associated integrases leads to diverse integration loci (including tRNA gene and non-tRNA loci) which in turn increases the ability of ICEs to contribute their diverse and dynamic genetic repertoire to E. anophelis pan-genome (48, 64).

Among the cargo genes carried by the ICEs for which a function could be identified, most are involved with host defense, nutrient acquisition, or transcription regulation. Innate immune mechanisms like restriction-modification systems provide host defense by protecting against invading DNA (70, 71). RND type multidrug efflux pumps enable the cell to defend against environmental toxins by recognizing and expelling various structurally diverse compounds (72), including antibiotics, as shown previously in strain R26T (29) and in the strains associated with the outbreak in Singapore (27, 28). Regarding nutrient acquisition, a variety of ABC transporters and TonB-dependent receptors are present in the ICEs, potentially improving the host’s ability to satisfy its nutrient needs in a nutrient-limited environment. The ICEs also equip the host with a variety of transcriptional regulators, with those in the AraC family being particularly prevalent (see Table S1 in the supplemental material). Transcription regulators of this sort can sense various chemical signals involved in carbon metabolism, quorum-sensing signaling, virulence, and stress response, modifying expression of a global gene repertoire (73–76). Thus, the genetic flexibility conferred by ICEs enables the host to quickly adapt to eco-niche changes, which may contribute to establishment of an infection in humans as well.

CRISPR loci.

The CRISPR-Cas system is an adaptive immune mechanism against invading nucleic acids. In this study, the type II-C CRISPR-Cas system was identified in nine strains of E. anophelis (Table 1). Interestingly, three strains that were collected separately share 12 identical spacers in their CRISPR loci, suggesting a common origin of the CRISPR. Besides, one of the 32 spacers in the CRISPR array of strain GTC_10754 might have been derived from a gene present in nine of the type III ICEs. The presence of this spacer suggests that the CRISPR-Cas system may have encountered and eliminated a type III ICE in the past. The defense is target specific. In fact, no ICE is present in strain GTC_10754. It has been demonstrated that a type II-C CRISPR-Cas system from Riemerella anatipestifer was able to acquire spacers from a transformed exogenous plasmid and target the plasmid (77). Similarly, the CRISPR-Cas system in Enterococcus faecalis functions as immune barriers to the acquisition of a conjugative plasmid (78). On the other hand, five CRISPR-carrying strains harbored ICEs as well (Table 1). However, the CRISPR loci in the strains do not contain any spacers derived from the ICEs in this study, so the CRISPR-Cas systems in these strains are not able to recognize and target these ICEs. The coexistence of mobile elements and CRISPR defense system demonstrate an evolutionary balance between the stability and plasticity of the genome (79, 80). A well-characterized example of genome stability mediated by the CRISPR-Cas systems can be found in Flavobacterium columnare, where they were shown to play a role in host-phage interactions, driving long-term genome coevolution through arms race-like mechanisms between the host and phages (81). Conversely, the CRISPR-Cas machinery appeared not to play a role as a resistance mechanism against phage for the fish pathogen Flavobacterium psychrophilum, which suggests we still have much to learn about the dynamics of CRISPR-Cas systems. Availability of the E. anophelis strains that possess CRISPR-Cas with and without ICEs enables further studies on coevolution of mobile elements and host defense systems in the bacteria.

Conclusion.

In this study, we identified ICEs in the genomes of 31 of 36 E. anophelis strains isolated from a wide array of hosts, collected at diverse geographic locations over several decades. The ICEs can be categorized into three types based on the distinctive architecture of the conjugation module and integration sites. The identification of the ICEs warrants further studies on the genetic diversity of the pan-genome and its impact on the virulence and pathogenesis of this global opportunistic pathogen.

MATERIALS AND METHODS

Bacterial strains.

In this study, the complete genomes from 13 strains and draft genomes from 23 strains were analyzed (Table 1). Mosquito-derived strains were isolated from Anopheles gambiae (R26T and Ag1), Anopheles stephensi (As1), and Anopheles sinensis (AR4-6 and AR6-8). Strain CSID3015183678 was one of the strains associated with the 2015–2016 Wisconsin outbreak, which has been characterized previously (43), and strains NUHP1, NUH6, and NUH11 were representative strains isolated from the Singapore outbreak; the genomes of these strains have been described (27). Strain LDVH-AR107 was derived from a common carp Cyprinus carpio. Strain JM-87 was isolated from maize Zea mays and was originally described as “E. endophytica” until genome comparison identified it as belonging to the species E. anophelis (7). The other strains were all derived from human patients or hospital environments, collected from 1950 to 2016. The draft genomes of strains LDVH-AR107, 8707, NCTC10588, AmMS250, and 37-75 were reassembled using Illumina reads downloaded from the SRA database. The reads were de novo assembled by CLC genomics workbench v 10.1.1. The 36 genomes were annotated using the SEED and Rapid Annotations using Subsystems Technology (RAST) at the RAST server (82).

Phylogenetic relationship of the strains based on core genome comparison.

The Parsnp module in the Harvest suite (47) was used for estimating the phylogenomic relationships of the strains. The core genome that is shared by all 36 strains was identified by multiple genome alignment, and SNPs in the core genome were typed to infer phylogenetic relationships; the process was implemented by using Parsnp. Four complete genomes from strains R26T, 0422, CSID3015183678, and NUHP1, were used as reference for the process, respectively. Each complete genome was used iteratively as the reference for tree construction, and tree topology of all four core genome trees was unaffected by choice of reference genome. The tree with R26T as the reference was depicted in Fig. 1.

Identification of ICEs.

To identify an ICE, the RAST annotation of each genome was searched for clusters of genes coding for an integrase, relaxase, coupling protein (T4CP), and transfer (Tra) proteins, including a VirB4 ATPase (TraG) in the conjugation module. These proteins are the key components of an ICE (48, 83). In type II ICEs, eight elements lack any type of integrases; these elements were defined as degenerated elements. The boundary of an element was delimited as between the two open reading frames (ORFs) that flank the ICE. The genome of the type strain R26T was used as a reference to mark the integration sites. Each ICE was categorized into one of the three types based on its gene structure (Fig. 2). The ICEs were named based mainly on the nomenclature proposed by Burrus et al. (34): the acronym ICE was followed by the initials of the name of the bacterium (Ea), a Roman numeral as type, a strain name and a ordinal number in brackets to identify the same sequence if it is encountered in a different strain. For example, the type I ICE found in both NUHP1 and CSID3015183678 strains would be named ICEEaI(1)_CSID3015183678 and ICEEaI(1)_NUHP1, respectively. Each type has its set of numbers; for example, the four type III ICEs in strain NUHP1 are designated ICEEaIII(1)_NUHP1 through ICEEaIII(4)_NUHP1.

Inference of phylogenetic relationships of selected genes.

The phylogenetic relationships of the relaxase, T4CP, TraG, and TraJ genes were inferred using nucleotide sequences. For tyrosine type recombinases, protein sequences were used for inference. The sequences were aligned using ClustalW, and the sequence alignments were used to infer evolutionary history using the neighbor-joining method. The evolutionary distance was computed using different models, which resulted in similar tree topology. The trees using Kimura two-parameter model for nucleotide sequences were presented in Fig. 4, and the tree using the Jones-Taylor-Thornton (JTT) model for protein sequences was presented in Fig. 5 A bootstrap test with 1,000 replicates was implemented to determine the percentage of clustering of associated taxa. The phylogenetic analyses were conducted in MEGA7 (84). IntDOT and IntN1 were included in the analysis of tyrosine recombinases. The GenBank accession numbers of IntDOT and IntN1 follow: InDOT-Bt, CAC47921; IntN1_NBU1, AF238307.1.

Identification of CRISPR sequences.

Genome sequences were searched for CRISPR using CRISPRfinder (85). The spacers located were then used as query to search against ICEs to identify protospacer sequences.

Accession number(s).

The genome assemblies of 31 strains were used for ICE identification and annotation. The GenBank accession numbers are listed in Table 1. The draft genomes of strains LDVH-AR107, 8707, NCTC10588, AmMS250, and 37-75 were reassembled using Illumina reads downloaded from the SRA database. The SRA accession numbers are listed in Table 1. ICEs were reannotated in the respective genomes. The nucleotide sequence data reported are available in the Third Party Annotation Section of the DDBJ/ENA/GenBank databases under the ICE TPA accession numbers BK010586 to BK010626, which are listed in Table 2.

Ethics statement.

The work was conducted following the policy of New Mexico State University Institutional Biosafety Committee.

ACKNOWLEDGMENTS

This work was supported by the National Institutes of Health (SC1AI112786 to J.X.), National Science Foundation (1633330 to J.X.), and CDC program funds designated for the study of emerging infectious agents. Funding for the open-access charge was provided by the National Institutes of Health (SC1AI112786).

The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health, National Science Foundation, and Centers for Disease Control and Prevention. Mention of company names or products does not constitute endorsement.

J.X. conceived of and designed the study. J.X., D.P., Y.L., and Q.X. collected genome data and performed data analysis. J.X. and A.N. wrote the manuscript.

We declare that we have no conflicts of interest.

REFERENCES

  • 1.Kim KK, Kim MK, Lim JH, Park HY, Lee ST. 2005. Transfer of Chryseobacterium meningosepticum and Chryseobacterium miricola to Elizabethkingia gen. nov. as Elizabethkingia meningoseptica comb. nov. and Elizabethkingia miricola comb. nov. Int J Syst Evol Microbiol 55:1287–1293. doi: 10.1099/ijs.0.63541-0. [DOI] [PubMed] [Google Scholar]
  • 2.King EO. 1959. Studies on a group of previously unclassified bacteria associated with meningitis in infants. Am J Clin Pathol 31:241–247. doi: 10.1093/ajcp/31.3.241. [DOI] [PubMed] [Google Scholar]
  • 3.Li Y, Kawamura Y, Fujiwara N, Naka T, Liu H, Huang X, Kobayashi K, Ezaki T. 2003. Chryseobacterium miricola sp. nov., a novel species isolated from condensation water of space station Mir. Syst Appl Microbiol 26:523–528. doi: 10.1078/072320203770865828. [DOI] [PubMed] [Google Scholar]
  • 4.Kampfer P, Matthews H, Glaeser SP, Martin K, Lodders N, Faye I. 2011. Elizabethkingia anophelis sp. nov., isolated from the midgut of the mosquito Anopheles gambiae. Int J Syst Evol Microbiol 61:2670–2675. doi: 10.1099/ijs.0.026393-0. [DOI] [PubMed] [Google Scholar]
  • 5.Lindh JM, Borg-Karlson AK, Faye I. 2008. Transstadial and horizontal transfer of bacteria within a colony of Anopheles gambiae (Diptera: Culicidae) and oviposition response to bacteria-containing water. Acta Trop 107:242–250. doi: 10.1016/j.actatropica.2008.06.008. [DOI] [PubMed] [Google Scholar]
  • 6.Kampfer P, Busse HJ, McInroy JA, Glaeser SP. 2015. Elizabethkingia endophytica sp. nov., isolated from Zea mays and emended description of Elizabethkingia anophelis Kampfer et al. 2011. Int J Syst Evol Microbiol 65:2187–2193. doi: 10.1099/ijs.0.000236. [DOI] [PubMed] [Google Scholar]
  • 7.Doijad S, Ghosh H, Glaeser S, Kampfer P, Chakraborty T. 2016. Taxonomic reassessment of the genus Elizabethkingia using whole-genome sequencing: Elizabethkingia endophytica Kampfer et al. 2015 is a later subjective synonym of Elizabethkingia anophelis Kampfer et al. 2011. Int J Syst Evol Microbiol 66:4555–4559. doi: 10.1099/ijsem.0.001390. [DOI] [PubMed] [Google Scholar]
  • 8.Nicholson AC, Gulvik CA, Whitney AM, Humrighouse BW, Graziano J, Emery B, Bell M, Loparev V, Juieng P, Gartin J, Bizet C, Clermont D, Criscuolo A, Brisse S, McQuiston JR. 2018. Revisiting the taxonomy of the genus Elizabethkingia using whole-genome sequencing, optical mapping, and MALDI-TOF, along with proposal of three novel Elizabethkingia species: Elizabethkingia bruuniana sp. nov., Elizabethkingia ursingii sp. nov., and Elizabethkingia occulta sp. nov. Antonie Van Leeuwenhoek 111:55–72. doi: 10.1007/s10482-017-0926-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Frank T, Gody JC, Nguyen LBL, Berthet N, Le Fleche-Mateos A, Bata P, Rafaï C, Kazanji M, Breurec S. 2013. First case of Elizabethkingia anophelis meningitis in the Central African Republic. Lancet 381:1876. doi: 10.1016/S0140-6736(13)60318-9. [DOI] [PubMed] [Google Scholar]
  • 10.Teo J, Tan SY, Tay M, Ding Y, Kjelleberg S, Givskov M, Lin RT, Yang L. 2013. First case of E anophelis outbreak in an intensive-care unit. Lancet 382:855–856. doi: 10.1016/S0140-6736(13)61858-9. [DOI] [PubMed] [Google Scholar]
  • 11.Lau SK, Wu AK, Teng JL, Tse H, Curreem SO, Tsui SK, Huang Y, Chen JH, Lee RA, Yuen KY, Woo PC. 2015. Evidence for Elizabethkingia anophelis transmission from mother to infant, Hong Kong. Emerg Infect Dis 21:232–241. doi: 10.3201/eid2102.140623. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Figueroa Castro CE, Johnson C, Williams M, VanDerSlik A, Graham MB, Letzer D, Ledeboer N, Buchan BW, Block T, Borlaug G, Munoz-Price LS. 2017. Elizabethkingia anophelis: clinical experience of an academic health system in southeastern Wisconsin. Open Forum Infect Dis 4:ofx251. doi: 10.1093/ofid/ofx251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Navon L, Clegg WJ, Morgan J, Austin C, McQuiston JR, Blaney DD, Walters MS, Moulton-Meissner H, Nicholson A. 2016. Notes from the field: investigation of Elizabethkingia anophelis cluster – Illinois, 2014-2016. MMWR Morb Mortal Wkly Rep 65:1380–1381. doi: 10.15585/mmwr.mm6548a6. [DOI] [PubMed] [Google Scholar]
  • 14.Nicholson AC, Whitney AM, Emery BD, Bell ME, Gartin JT, Humrighouse BW, Loparev VN, Batra D, Sheth M, Rowe LA, Juieng P, Knipe K, Gulvik C, McQuiston JR. 2016. Complete genome sequences of four strains from the 2015-2016 Elizabethkingia anophelis outbreak. Genome Announc 4:e00563-16. doi: 10.1128/genomeA.00563-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Hu S, Jiang T, Zhang X, Zhou Y, Yi Z, Wang Y, Zhao S, Wang M, Ming D, Chen S. 2017. Elizabethkingia anophelis isolated from patients with multiple organ dysfunction syndrome and lower respiratory tract infection: report of two cases and literature review. Front Microbiol 8:382. doi: 10.3389/fmicb.2017.00382. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lin JN, Lai CH, Yang CH, Huang YH, Lin HH. 2017. Genomic features, phylogenetic relationships, and comparative genomics of Elizabethkingia anophelis strain EM361-97 isolated in Taiwan. Sci Rep 7:14317. doi: 10.1038/s41598-017-14841-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lau SK, Chow WN, Foo CH, Curreem SO, Lo GC, Teng JL, Chen JH, Ng RH, Wu AK, Cheung IY, Chau SK, Lung DC, Lee RA, Tse CW, Fung KS, Que TL, Woo PC. 2016. Elizabethkingia anophelis bacteremia is associated with clinically significant infections and high mortality. Sci Rep 6:26045. doi: 10.1038/srep26045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Janda JM, Lopez DL. 2017. Mini review: new pathogen profiles: Elizabethkingia anophelis. Diagn Microbiol Infect Dis 88:201–205. doi: 10.1016/j.diagmicrobio.2017.03.007. [DOI] [PubMed] [Google Scholar]
  • 19.Kukutla P, Lindberg BG, Pei D, Rayl M, Yu W, Steritz M, Faye I, Xu J. 2013. Draft genome sequences of Elizabethkingia anophelis strains R26T and Ag1 from the midgut of the malaria mosquito Anopheles gambiae. Genome Announc 1:e01030-13. doi: 10.1128/genomeA.01030-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Pei D, Nicholson AC, Jiang J, Chen H, Whitney AM, Villarma A, Bell M, Humrighouse B, Rowe LA, Sheth M, Batra D, Juieng P, Loparev VN, McQuiston JR, Lan Y, Ma Y, Xu J. 2017. Complete circularized genome sequences of four strains of Elizabethkingia anophelis, including two novel strains isolated from wild-caught Anopheles sinensis. Genome Announc 5:e01359-17. doi: 10.1128/genomeA.01359-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Raygoza Garay JA, Hughes GL, Koundal V, Rasgon JL, Mwangi MM. 2016. Genome sequence of Elizabethkingia anophelis strain EaAs1, isolated from the Asian malaria mosquito Anopheles stephensi. Genome Announc 4:e00084-16. doi: 10.1128/genomeA.00084-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Georgiades K. 2012. Genomics of epidemic pathogens. Clin Microbiol Infect 18:213–217. doi: 10.1111/j.1469-0691.2012.03781.x. [DOI] [PubMed] [Google Scholar]
  • 23.Raskin DM, Seshadri R, Pukatzki SU, Mekalanos JJ. 2006. Bacterial genomics and pathogen evolution. Cell 124:703–714. doi: 10.1016/j.cell.2006.02.002. [DOI] [PubMed] [Google Scholar]
  • 24.Worby CJ, Lipsitch M, Hanage WP. 2017. Shared genomic variants: identification of transmission routes using pathogen deep-sequence data. Am J Epidemiol 186:1209–1216. doi: 10.1093/aje/kwx182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hu R, Yuan J, Meng Y, Wang Z, Gu Z. 2017. Pathogenic Elizabethkingia miricola infection in cultured black-spotted frogs, China, 2016. Emerg Infect Dis 23:2055–2059. doi: 10.3201/eid2312.170942. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Peter S, Oberhettinger P, Schuele L, Dinkelacker A, Vogel W, Dorfel D, Bezdan D, Ossowski S, Marschal M, Liese J, Willmann M. 2017. Genomic characterisation of clinical and environmental Pseudomonas putida group strains and determination of their role in the transfer of antimicrobial resistance genes to Pseudomonas aeruginosa. BMC Genomics 18:859. doi: 10.1186/s12864-017-4216-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Teo J, Tan SY, Liu Y, Tay M, Ding Y, Li Y, Kjelleberg S, Givskov M, Lin RT, Yang L. 2014. Comparative genomic analysis of malaria mosquito vector-associated novel pathogen Elizabethkingia anophelis. Genome Biol Evol 6:1158–1165. doi: 10.1093/gbe/evu094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Li Y, Liu Y, Chew SC, Tay M, Salido MM, Teo J, Lauro FM, Givskov M, Yang L. 2015. Complete genome sequence and transcriptomic analysis of the novel pathogen Elizabethkingia anophelis in response to oxidative stress. Genome Biol Evol 7:1676–1685. doi: 10.1093/gbe/evv101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kukutla P, Lindberg BG, Pei D, Rayl M, Yu W, Steritz M, Faye I, Xu J. 2014. Insights from the genome annotation of Elizabethkingia anophelis from the malaria vector Anopheles gambiae. PLoS One 9:e97715. doi: 10.1371/journal.pone.0097715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Chew KL, Cheng B, Lin RTP, Teo JWP. 2018. Elizabethkingia anophelis is the dominant Elizabethkingia species found in blood cultures in Singapore. J Clin Microbiol 56:e01445-17. doi: 10.1128/JCM.01445-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Breurec S, Criscuolo A, Diancourt L, Rendueles O, Vandenbogaert M, Passet V, Caro V, Rocha EP, Touchon M, Brisse S. 2016. Genomic epidemiology and global diversity of the emerging bacterial pathogen Elizabethkingia anophelis. Sci Rep 6:30379. doi: 10.1038/srep30379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Bellanger X, Payot S, Leblond-Bourget N, Guédon G. 2014. Conjugative and mobilizable genomic islands in bacteria: evolution and diversity. FEMS Microbiol Rev 38:720–760. doi: 10.1111/1574-6976.12058. [DOI] [PubMed] [Google Scholar]
  • 33.Wozniak RA, Waldor MK. 2010. Integrative and conjugative elements: mosaic mobile genetic elements enabling dynamic lateral gene flow. Nat Rev Microbiol 8:552–563. doi: 10.1038/nrmicro2382. [DOI] [PubMed] [Google Scholar]
  • 34.Burrus V, Pavlovic G, Decaris B, Guedon G. 2002. Conjugative transposons: the tip of the iceberg. Mol Microbiol 46:601–610. doi: 10.1046/j.1365-2958.2002.03191.x. [DOI] [PubMed] [Google Scholar]
  • 35.Johnson CM, Grossman AD. 2015. Integrative and conjugative elements (ICEs): what they do and how they work. Annu Rev Genet 49:577–601. doi: 10.1146/annurev-genet-112414-055018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Colombi E, Straub C, Kunzel S, Templeton MD, McCann HC, Rainey PB. 2017. Evolution of copper resistance in the kiwifruit pathogen Pseudomonas syringae pv. actinidiae through acquisition of integrative conjugative elements and plasmids. Environ Microbiol 19:819–832. doi: 10.1111/1462-2920.13662. [DOI] [PubMed] [Google Scholar]
  • 37.Sugimoto M, Watada M, Jung SW, Graham DY, Yamaoka Y. 2012. Role of Helicobacter pylori plasticity region genes in development of gastroduodenal diseases. J Clin Microbiol 50:441–448. doi: 10.1128/JCM.00906-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Cheng Q, Paszkiet BJ, Shoemaker NB, Gardner JF, Salyers AA. 2000. Integration and excision of a Bacteroides conjugative transposon, CTnDOT. J Bacteriol 182:4035–4043. doi: 10.1128/JB.182.14.4035-4043.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Wood MM, Gardner JF. 2015. The integration and excision of CTnDOT. Microbiol Spectr 3:MDNA3. doi: 10.1128/microbiolspec.MDNA3-0020-2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Li LY, Shoemaker NB, Salyers AA. 1995. Location and characteristics of the transfer region of a Bacteroides conjugative transposon and regulation of transfer genes. J Bacteriol 177:4992–4999. doi: 10.1128/jb.177.17.4992-4999.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Whittle G, Hamburger N, Shoemaker NB, Salyers AA. 2006. A Bacteroides conjugative transposon, CTnERL, can transfer a portion of itself by conjugation without excising from the chromosome. J Bacteriol 188:1169–1174. doi: 10.1128/JB.188.3.1169-1174.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Wang Y, Wang GR, Shelby A, Shoemaker NB, Salyers AA. 2003. A newly discovered Bacteroides conjugative transposon, CTnGERM1, contains genes also found in gram-positive bacteria. Appl Environ Microbiol 69:4595–4603. doi: 10.1128/AEM.69.8.4595-4603.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Perrin A, Larsonneur E, Nicholson AC, Edwards DJ, Gundlach KM, Whitney AM, Gulvik CA, Bell ME, Rendueles O, Cury J, Hugon P, Clermont D, Enouf V, Loparev V, Juieng P, Monson T, Warshauer D, Elbadawi LI, Walters MS, Crist MB, Noble-Wang J, Borlaug G, Rocha EPC, Criscuolo A, Touchon M, Davis JP, Holt KE, McQuiston JR, Brisse S. 2017. Evolutionary dynamics and genomic features of the Elizabethkingia anophelis 2015 to 2016 Wisconsin outbreak strain. Nat Commun 8:15483. doi: 10.1038/ncomms15483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Medini D, Donati C, Tettelin H, Masignani V, Rappuoli R. 2005. The microbial pan-genome. Curr Opin Genet Dev 15:589–594. doi: 10.1016/j.gde.2005.09.006. [DOI] [PubMed] [Google Scholar]
  • 45.Tettelin H, Masignani V, Cieslewicz MJ, Donati C, Medini D, Ward NL, Angiuoli SV, Crabtree J, Jones AL, Durkin AS, Deboy RT, Davidsen TM, Mora M, Scarselli M, Margarit y Ros I, Peterson JD, Hauser CR, Sundaram JP, Nelson WC, Madupu R, Brinkac LM, Dodson RJ, Rosovitz MJ, Sullivan SA, Daugherty SC, Haft DH, Selengut J, Gwinn ML, Zhou L, Zafar N, Khouri H, Radune D, Dimitrov G, Watkins K, O'Connor KJ, Smith S, Utterback TR, White O, Rubens CE, Grandi G, Madoff LC, Kasper DL, Telford JL, Wessels MR, Rappuoli R, Fraser CM. 2005. Genome analysis of multiple pathogenic isolates of Streptococcus agalactiae: implications for the microbial “pan-genome”. Proc Natl Acad Sci U S A 102:13950–13955. doi: 10.1073/pnas.0506758102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Leekitcharoenphon P, Kaas RS, Thomsen MC, Friis C, Rasmussen S, Aarestrup FM. 2012. snpTree–a web-server to identify and construct SNP trees from whole genome sequence data. BMC Genomics 13(Suppl 7):S6. doi: 10.1186/1471-2164-13-S7-S6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Treangen TJ, Ondov BD, Koren S, Phillippy AM. 2014. The Harvest suite for rapid core-genome alignment and visualization of thousands of intraspecific microbial genomes. Genome Biol 15:524. doi: 10.1186/s13059-014-0524-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Cury J, Touchon M, Rocha E. 2017. Integrative and conjugative elements and their hosts: composition, distribution and organization. Nucleic Acids Res 45:8943–8956. doi: 10.1093/nar/gkx607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Guglielmini J, Quintais L, Garcillan-Barcia MP, de la Cruz F, Rocha EP. 2011. The repertoire of ICE in prokaryotes underscores the unity, diversity, and ubiquity of conjugation. PLoS Genet 7:e1002222. doi: 10.1371/journal.pgen.1002222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Seaver LC, Imlay JA. 2001. Alkyl hydroperoxide reductase is the primary scavenger of endogenous hydrogen peroxide in Escherichia coli. J Bacteriol 183:7173–7181. doi: 10.1128/JB.183.24.7173-7181.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Rajeev L, Salyers AA, Gardner JF. 2006. Characterization of the integrase of NBU1, a Bacteroides mobilizable transposon. Mol Microbiol 61:978–990. doi: 10.1111/j.1365-2958.2006.05282.x. [DOI] [PubMed] [Google Scholar]
  • 52.Register KB, Sanden GN. 2006. Prevalence and sequence variants of IS481 in Bordetella bronchiseptica: implications for IS481-based detection of Bordetella pertussis. J Clin Microbiol 44:4577–4583. doi: 10.1128/JCM.01295-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Venter H, Mowla R, Ohene-Agyei T, Ma S. 2015. RND-type drug efflux pumps from Gram-negative bacteria: molecular mechanism and inhibition. Front Microbiol 6:377. doi: 10.3389/fmicb.2015.00377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Mir A, Edraki A, Lee J, Sontheimer EJ. 2018. Type II-C CRISPR-Cas9 biology, mechanism, and application. ACS Chem Biol 13:357–365. doi: 10.1021/acschembio.7b00855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Bentley SD, Parkhill J. 2015. Genomic perspectives on the evolution and spread of bacterial pathogens. Proc Biol Sci 282:20150488. doi: 10.1098/rspb.2015.0488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Mira A, Martín-Cuadrado AB, D'Auria G, Rodríguez-Valera F. 2010. The bacterial pan-genome: a new paradigm in microbiology. Int Microbiol 13:45–57. doi: 10.2436/20.1501.01.110. [DOI] [PubMed] [Google Scholar]
  • 57.Bryant JM, Grogono DM, Rodriguez-Rincon D, Everall I, Brown KP, Moreno P, Verma D, Hill E, Drijkoningen J, Gilligan P, Esther CR, Noone PG, Giddings O, Bell SC, Thomson R, Wainwright CE, Coulter C, Pandey S, Wood ME, Stockwell RE, Ramsay KA, Sherrard LJ, Kidd TJ, Jabbour N, Johnson GR, Knibbs LD, Morawska L, Sly PD, Jones A, Bilton D, Laurenson I, Ruddy M, Bourke S, Bowler IC, Chapman SJ, Clayton A, Cullen M, Daniels T, Dempsey O, Denton M, Desai M, Drew RJ, Edenborough F, Evans J, Folb J, Humphrey H, Isalska B, Jensen-Fangel S, Jönsson B, Jones AM, Katzenstein TL, et al. 2016. Emergence and spread of a human-transmissible multidrug-resistant nontuberculous mycobacterium. Science 354:751–757. doi: 10.1126/science.aaf8156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Bryant JM, Grogono DM, Greaves D, Foweraker J, Roddick I, Inns T, Reacher M, Haworth CS, Curran MD, Harris SR, Peacock SJ, Parkhill J, Floto RA. 2013. Whole-genome sequencing to identify transmission of Mycobacterium abscessus between patients with cystic fibrosis: a retrospective cohort study. Lancet 381:1551–1560. doi: 10.1016/S0140-6736(13)60632-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Wang Y, Gilbreath TM III, Kukutla P, Yan G, Xu J. 2011. Dynamic gut microbiome across life history of the malaria mosquito Anopheles gambiae in Kenya. PLoS One 6:e24767. doi: 10.1371/journal.pone.0024767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Telang A, Skinner J, Nemitz RZ, McClure AM. 2018. Metagenome and culture-based methods reveal candidate bacterial mutualists in the Southern house mosquito (Diptera: Culicidae). J Med Entomol 55:1170–1181. doi: 10.1093/jme/tjy056. [DOI] [PubMed] [Google Scholar]
  • 61.Terenius O, Lindh JM, Eriksson-Gonzales K, Bussiere L, Laugen AT, Bergquist H, Titanji K, Faye I. 2012. Midgut bacterial dynamics in Aedes aegypti. FEMS Microbiol Ecol 80:556–565. doi: 10.1111/j.1574-6941.2012.01317.x. [DOI] [PubMed] [Google Scholar]
  • 62.Burrus V, Waldor MK. 2004. Shaping bacterial genomes with integrative and conjugative elements. Res Microbiol 155:376–386. doi: 10.1016/j.resmic.2004.01.012. [DOI] [PubMed] [Google Scholar]
  • 63.Malanowska K, Salyers AA, Gardner JF. 2006. Characterization of a conjugative transposon integrase, IntDOT. Mol Microbiol 60:1228–1240. doi: 10.1111/j.1365-2958.2006.05164.x. [DOI] [PubMed] [Google Scholar]
  • 64.Nguyen M, Vedantam G. 2011. Mobile genetic elements in the genus Bacteroides, and their mechanism(s) of dissemination. Mob Genet Elements 1:187–196. doi: 10.4161/mge.1.3.18448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Laprise J, Yoneji S, Gardner JF. 2013. IntDOT interactions with core sites during integrative recombination. J Bacteriol 195:1883–1891. doi: 10.1128/JB.01540-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Whittle G, Shoemaker NB, Salyers AA. 2002. Characterization of genes involved in modulation of conjugal transfer of the Bacteroides conjugative transposon CTnDOT. J Bacteriol 184:3839–3847. doi: 10.1128/JB.184.14.3839-3847.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Waters JL, Salyers AA. 2013. Regulation of CTnDOT conjugative transfer is a complex and highly coordinated series of events. mBio 4:e00569-13. doi: 10.1128/mBio.00569-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Au KG, Clark S, Miller JH, Modrich P. 1989. Escherichia coli mutY gene encodes an adenine glycosylase active on G-A mispairs. Proc Natl Acad Sci U S A 86:8877–8881. doi: 10.1073/pnas.86.22.8877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Michaels ML, Pham L, Nghiem Y, Cruz C, Miller JH. 1990. MutY, an adenine glycosylase active on G-A mispairs, has homology to endonuclease III. Nucleic Acids Res 18:3841–3845. doi: 10.1093/nar/18.13.3841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Murray NE. 2000. Type I restriction systems: sophisticated molecular machines (a legacy of Bertani and Weigle). Microbiol Mol Biol Rev 64:412–434. doi: 10.1128/MMBR.64.2.412-434.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Oliveira PH, Touchon M, Rocha EP. 2014. The interplay of restriction-modification systems with mobile genetic elements and their prokaryotic hosts. Nucleic Acids Res 42:10618–10631. doi: 10.1093/nar/gku734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Nikaido H, Pages JM. 2012. Broad-specificity efflux pumps and their role in multidrug resistance of Gram-negative bacteria. FEMS Microbiol Rev 36:340–363. doi: 10.1111/j.1574-6976.2011.00290.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Gallegos MT, Schleif R, Bairoch A, Hofmann K, Ramos JL. 1997. AraC/XylS family of transcriptional regulators. Microbiol Mol Biol Rev 61:393–410. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Yang J, Tauschek M, Robins-Browne RM. 2011. Control of bacterial virulence by AraC-like regulators that respond to chemical signals. Trends Microbiol 19:128–135. doi: 10.1016/j.tim.2010.12.001. [DOI] [PubMed] [Google Scholar]
  • 75.Tan A, Petty NK, Hocking D, Bennett-Wood V, Wakefield M, Praszkier J, Tauschek M, Yang J, Robins-Browne R. 2015. Evolutionary adaptation of an AraC-like regulatory protein in Citrobacter rodentium and Escherichia species. Infect Immun 83:1384–1395. doi: 10.1128/IAI.02697-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Tobes R, Ramos JL. 2002. AraC-XylS database: a family of positive transcriptional regulators in bacteria. Nucleic Acids Res 30:318–321. doi: 10.1093/nar/30.1.318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.He Y, Wang M, Liu M, Huang L, Liu C, Zhang X, Yi H, Cheng A, Zhu D, Yang Q, Wu Y, Zhao X, Chen S, Jia R, Zhang S, Liu Y, Yu Y, Zhang L. 2018. Cas1 and Cas2 from the type II-C CRISPR-Cas system of Riemerella anatipestifer are required for spacer acquisition. Front Cell Infect Microbiol 8:195. doi: 10.3389/fcimb.2018.00195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Price VJ, Huo W, Sharifi A, Palmer KL. 2016. CRISPR-Cas and restriction-modification act additively against conjugative antibiotic resistance plasmid transfer in Enterococcus faecalis. mSphere 1:e00064-16. doi: 10.1128/mSphere.00064-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Koonin EV, Makarova KS. 2017. Mobile genetic elements and evolution of CRISPR-Cas systems: all the way there and back. Genome Biol Evol 9:2812–2825. doi: 10.1093/gbe/evx192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Varahan S, Hancock LE. 2016. To defend or not to defend: that’s the question. mSphere 1:e00127-16. doi: 10.1128/mSphere.00127-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Laanto E, Hoikkala V, Ravantti J, Sundberg LR. 2017. Long-term genomic coevolution of host-parasite interaction in the natural environment. Nat Commun 8:111. doi: 10.1038/s41467-017-00158-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Overbeek R, Olson R, Pusch GD, Olsen GJ, Davis JJ, Disz T, Edwards RA, Gerdes S, Parrello B, Shukla M, Vonstein V, Wattam AR, Xia F, Stevens R. 2014. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res 42:D206–D214. doi: 10.1093/nar/gkt1226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Guglielmini J, Neron B, Abby SS, Garcillan-Barcia MP, de la Cruz F, Rocha EP. 2014. Key components of the eight classes of type IV secretion systems involved in bacterial conjugation or protein secretion. Nucleic Acids Res 42:5715–5727. doi: 10.1093/nar/gku194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol Biol Evol 33:1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Grissa I, Vergnaud G, Pourcel C. 2007. CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res 35:W52–W57. doi: 10.1093/nar/gkm360. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

TABLE S1

Annotated ICEs in the strains. Download Table S1, XLSX file, 1.4 MB (1.4MB, xlsx) .

This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.

Articles from mSphere are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES