Abstract
During CD8+ T cell response, Notch signaling controls short-lived-effector-cell (SLEC) generation, but the exact mechanisms by which it does so remains unclear. The Notch signaling pathway can act as a key regulator of Akt signaling via direct transcriptional induction of Hes1, which will then repress the transcription of Pten, an inhibitor of Akt signaling. As both Notch and Akt signaling can promote effector CD8+ T cell differentiation, we asked whether Notch signaling influences SLEC differentiation via the HES1-PTEN axis. Here, we demonstrate that HES1 deficiency in murine CD8+ T cells did not impact SLEC differentiation. Moreover, we show that Pten transcriptional repression in effector CD8+ T cells is not mediated by Notch signaling although Akt activation requires Notch signaling. Therefore, HES1 is not an effector of Notch signaling during CD8+ T cell response.
Introduction
CD8+ T cells are essential for the successful elimination of several infectious agents and are endowed with the ability to control tumor growth. We, and others, have recently discovered that Notch signaling is central to the proper differentiation of CD8+ effector cells [1,2]. Notch deficiency severely impairs the generation of short-lived effector T cells (SLECs) during acute response to infection and vaccination [1,2]. Following ligand engagement, the intracellular domain of Notch (NICD) translocates to the nucleus where it associates with RBPJk to induce the transcription of common (e.g. Hes1) and tissue-specific target genes. The relative contribution of the common versus tissue-specific Notch target genes to effector CD8+ T cell differentiation is still unknown. However, the requirement for Notch-mediated HES1 induction during T-lineage commitment and thymocyte β-selection raises the possibility that Notch signaling controls effector CD8+ T cell differentiation via Hes1 transcriptional induction [3,4].
One key event controlling effector and SLEC differentiation is the activation of the Akt-mTOR pathway, which mediates the metabolic switch from catabolism to anabolism necessary for differentiation [5–10]. Furthermore, sustained and strong Akt activation in CD8+ T cells enhances effector function and promotes SLEC differentiation [6,8]. Interestingly, Notch signaling controls the activation of Akt and mTOR in thymocytes and T lymphoblastic leukemias (T-ALL) [4,11,12]. The activation of Akt can be mediated by transcriptional induction of the common Notch target gene Hes1 [4]. One mechanism that has been described proceeds via HES1 mediated transcriptional repression of Pten, an inhibitor of Akt activation [4]. The need for proper activation of the Akt-mTOR and Notch signaling pathways for SLEC differentiation raises the possibility that Notch signaling promotes SLEC differentiation via the induction of the common effector HES1, which then represses Pten transcription allowing for proper activation of the Akt signaling pathway. Using mice lacking expression of HES1 in mature CD8+ T cells, we show that HES1 induction by Notch is not necessary for effector CD8+ T cell differentiation. Furthermore, we show that unlike in thymocytes and T-ALL, the Notch signaling pathway does not repress Pten transcription. However, even if Pten transcription is repressed efficiently in absence of Notch and HES1, the Akt-mTOR pathway is not properly activated during CD8+ T cell response in the absence of Notch signaling while HES1 deficiency has no effect.
Materials and methods
Mice
Notch1fl/fl/Notch2fl/fl OT-1 Rag1-/- and E8I-cre+/- Notch1fl/flNotch2fl/fl OT-1 Rag1-/- mice were previously described [1]. Hes1fl/fl mice were a kind gift from Dr. Ryoichiro Kageyama [13]. Hes1fl/fl were backcrossed for at least 10 generations to C57BL/6 mice and were bred with E8I-cre mice [14] to obtain E8I-Cre+/-Hes1fl/fl (Δ/Δ; lacking HES1 expression only in mature CD8+ T cells) and Hes1fl/fl (Hes1-sufficient, fl/fl). E8I-cre+/-Hes1fl/fl mice were also bred to OT-I Rag1-/- mice [15]. B6.SJL mice were bred in house. All mice were bred and housed in a pathogen-free environment under conventional conditions at room temperature of 22–25°C with acidified water ad libitum. Mice were feed Teklad global 18% protein diet (Envigo), given environmental enrichment (Nestlets, tunnels and igloos) and treated in accordance to the Canadian Council on Animal Care guidelines. Following infection, mice were monitored daily for weight loss, dehydration and lethargy. Our animal protocol (number: 2017AV010) was approved by the Hospital Maisonneuve-Rosemont Council on Animal Care.
Analysis of OVA-specific CD8+ T cell response
For analysis of T cell response, mice were injected i.v. with a sublethal dose of 2 X 103 CFU Listeria monocytogenes expressing OVA (Lm-OVA) as previously described [16]. B6.SJL bone marrow derived dendritic cells were matured with LPS (1 μg/ml), and loaded with the ovalbumin peptide (SIINFEKL; OVA257–264 2 μg/ml; Midwest biotech) (DC-OVA) as previously described [17]. 1.25 x 106 DC-OVA were injected i.v for immunization. Ex vivo primary endogenous CD8+ T cell response analysis was performed on spleen at day 7 post-infection or vaccination. In experiments using adoptive transfer of OT-I T cells of different genotypes, 106 cells were transferred into B6.SJL recipient mice followed by Lm-OVA infection. OT-I T cell response was analyzed in the spleen at day 3 post-infection.
Abs, flow cytometry and cell sorting
Anti-CD8 (53–6.7), anti-CD44 (IM7), anti-KLRG1 (2F1), anti-CD127 (A7R34) and anti-CD45.2 (104) Abs were from Biolegend; anti-IFN-γ (XMG1.2) Ab was from Life Technologies; anti-TNF-α, anti-p-S6 (CUPK43K) and anti-p-AKTS473 (SDRNR) Abs were from eBioscience; anti-p-AktT308 (13038) was from Cell Signaling Technology. Cell surface, intracellular and tetramer stainings were performed as previously described [17–19]. For analysis of p-AktS473, and p-S6, splenocytes were rested in RPMI 1% FCS and then stimulated for 1h with the OVA peptide followed by fixation, permeabilization and staining using the BD cytofix/cytoperm reagent. For analysis of p-AktT308, splenocytes were rested in RPMI 1% FCS and the stimulated for 1h with the OVA peptide (2 μg/mL) followed by fixation, permeabilization and staining using the eBioscience Foxp3 staining kit. A second step staining was performed with polyclonal goat anti-rabbit IgG (H+L) highly cross-adsorbed secondary antibody Alexa Fluor Plus 647 from ThermoFischer (#A32733) to reveal p-AktT308 staining. In some experiments, the level of p-Akt and p-S6 was measured directly ex vivo. Naïve CD8+ T cells (CD8+CD44low), day 7 OVA-specific CD8+ effector T cells (CD8+CD44highTet-OVA+) and day 3 OT-I effector CD8+ T cells (CD8+CD45.2+CD44high) were sorted with a BD FACSARIA III.
RT-qPCR
Quantification of Hes1 and Pten mRNAs from sorted OT-I CD8+ T cells was performed as previously described [19,20]. Sequences of primers used were as follows: Hes1, 5’- ATAGCTCCCGGCATTCCAAG -3’ and 5’-GCGCGGTATTTCCCCAACA-3’; Pten, 5’-GAGTATCTTGTACTCACCCTAAC-3’ and 5’-GGATTTGATGGCTCCTCTAC-3’.
Statistical analysis
Statistical analyses for differences between the fl/fl and Δ/Δ groups were done using Student’s T test. Welch’s correction was applied for unequal variances when required. ANOVA was used when comparing more than two experimental groups. Tukey’s correction was applied for unequal variances when required. Data are presented as mean +/- standard error of the mean (SEM). Only significant statistical differences are indicated on the figures.
Results and discussion
Notch-dependent induction of Hes1 transcription in antigen-specific CD8+ T cells
Following ligand engagement, Notch receptors are cleaved to generate the NICD that will then migrate to the nucleus to induce gene transcription. Among the induced genes are classical effector of the Notch signaling pathway such as Hes1 and Dtx1. As Hes1 transcriptional induction by the NICD was shown to control critical aspects of thymic T cell differentiation [3,4], we evaluated whether Hes1 transcription is induced following in vivo Notch signaling in Ag-specific CD8+ T cells. We adoptively transferred 106 wild-type or Notch1/2-deficient OT-I TCR transgenic CD8+ T cells [1], specific for the ovalbumin (OVA) peptide in the context of Kb, into congenic B6.SJL recipients followed by infection with a recombinant strain of Listeria monocytogenes encoding OVA (Lm-OVA). Three days later, WT and Notch1/2 deficient OT-I CD8+ T cells were sorted to measure Hes1 transcription. As shown in Fig 1A and S1A Fig, Hes1 transcription was induced in WT but not in Notch1/2-deficient OT-I T cells. This induction of Hes1 transcription is less than what has been described by the Immunological Genome Project Consortium (immgen.org) [21] in thymocytes receiving Notch signal (8-fold higher in DN2/3 thymocytes compared to DP or SP thymocytes) but suggests that Hes1 transcriptional induction may contribute to CD8+ T cell differentiation.
Fig 1. HES1 is dispensable for effector CD8+ T cell differentiation following infection with Listeria monocytogenes.
(A) 106 WT or Notch1/2-deficient OT-I CD8+ T cells were adoptively transferred in congenic B6.SJL mice followed by infection with Lm-OVA. At day 3 post-infection, OT-I CD44high T cells were sorted to analyze Hes1 transcription by RT-qPCR. (B-D) HES1-sufficient (fl/fl) and -deficient (Δ/Δ) mice were infected with Lm-OVA and CD8+ T cell response was analyzed at day 7 in the spleen. (B) OVA-specific CD8+ T cell response was identified using tetramer (Kb-OVA; Tet-OVA) and anti-CD44 antibody stainings. The percentage of OVA-specific CD8+ T cells is indicated on each profile (gated on CD8+ T cells). The compilation of the percentage of OVA-specific CD8+ T cells is shown next to the FACS profiles. (C) FACS profiles and compilation of SLECs (KLRG1+CD127-) and MPECs (KLRG1-CD127+) among OVA-specific CD8+ T cells (Tet-OVA+CD44+). (D) Cytokine production by OVA-specific CD8+ effectors after a short (5h) in vitro restimulation with the OVA peptide. Data are representative of two (A) or five (B-D) independent experiments with 2–3 mice per group. Statistical significance was determined using ANOVA (A) and Student’s t test (B-D). *p<0.05.
CD8+ T cell response to Listeria infection is not affected by HES1-deficiency
Considering that the Notch signaling pathway controls SLEC differentiation [1,2], we asked whether this occurs via the Notch target gene Hes1. We crossed Hes1-floxed mice with E8I-cre mice to generate mice in which the Hes1 gene is specifically deleted in mature peripheral CD8+ T cells (referred as Hes1Δ/Δ) [13,14]. Mice were then infected with Lm-OVA and the OVA-specific CD8+ T cell response was analyzed at day 7 post-infection. HES1-deficiency in CD8+ T cells did not affect T cell expansion (Fig 1B) and had no effect on the SLEC/MPEC differentiation choice (Fig 1C). The lack of effect on SLEC differentiation was not due to overgrowth of non-deleted cells (S1B Fig). Furthermore, the HES1-deficient effectors generated are functional as shown by their ability to produce IFN-γ and TNF-α (Fig 1D). Therefore, HES1 induction by Notch signaling is not involved in SLEC differentiation and acquisition of effector functions following Listeria infection.
HES1-deficient CD8+ T cells respond normally to DC vaccination
We have previously demonstrated that Notch signaling plays a context dependent role. Following infection, which induces a high level of inflammation, Notch signaling was dispensable for the acquisition of effector functions while it was critical in the low inflammation setting of dendritic cell (DC) vaccination [1]. Furthermore, SLEC generation was more severely affected following DC vaccination than infection [1,2]. Therefore, we evaluated whether the induction of HES1 was important for the differentiation of CD8+ T cells following DC vaccination. Even in the context of low inflammation, Hes1 transcriptional induction was not required for the differentiation of SLECs and acquisition of effector functions (Fig 2). The lack of requirement for HES1 during SLEC differentiation during in vivo CD8+ T cell activation even if Hes1 is transcriptionally induced by Notch signaling is similar to what has been observed during the differentiation of marginal zone B cells [3]. Furthermore, it illustrates that Notch signaling relies on the induction of different direct target gene(s) depending on the differentiation context.
Fig 2. HES1 deficiency does not affect effector CD8+ T cell differentiation following dendritic cell vaccination.
Hes1fl/fl and Hes1Δ/Δ mice were vaccinated with DC-OVA and CD8+ T cell response was analyzed at day 7 in the spleen. (A) OVA-specific CD8+ T cell response was identified using tetramer (Kb-OVA; Tet-OVA) and anti-CD44 antibody stainings. The percentage of OVA-specific CD8+ T cells is indicated on each FACS profiles (gated on CD8+ T cells). The compilation of the percentage of OVA-specific CD8+ T cells is shown next to the FACS profiles. (B) FACS profiles and compilation of SLECs (KLRG1+CD127-) and MPECs (KLRG1-CD127+) among OVA-specific CD8+ T cells (Tet-OVA+CD44+). (C) Cytokine production by OVA-specific CD8+ effectors after a short (5h) in vitro restimulation with the OVA peptide. Data are representative of three independent experiments with 2–3 mice per group. Statistical significance was determined using Student’s t test.
The Notch signaling pathway does not influence Pten transcription in effector CD8+ T cells
The induction of Hes1 transcription has been shown to be essential for the repression of Pten transcription in thymocytes to promote their survival, differentiation and proliferation at the β-selection checkpoint [4]. This repression of Pten transcription is necessary to permit the activation of the Akt signaling pathway [4]. As the activation of Akt is also an essential event for the differentiation of SLECs [5–9], it was surprising that HES1 expression was not necessary for SLEC differentiation. Therefore, we tested whether Pten transcriptional repression occurs during in vivo CD8+ T cell activation and if this was regulated by Notch signaling. We sorted WT, Notch1/2-deficient and Hes1Δ/Δ OT-I naïve and day 3 effectors. Pten transcription was lower in day 3 effectors than in naïve OT-I T cells and was similarly reduced in absence of Notch signaling and HES1 (Fig 3A). Altogether, these results indicate that the repression of Pten transcription occurs independently of the Notch signaling pathway in mature peripheral CD8+ T cells. This is similar to what has been observed in absence of Notch signaling in T cells during graft versus host disease [22].
Fig 3. The Notch signaling pathway does not control Pten transcription in effector CD8+ T cells.
(A) 106 WT, Notch1/2-deficient or HES1-deficient OT-I CD8+ T cells were adoptively transferred in congenic B6.SJL mice followed by infection with Lm-OVA. At day 3 post-infection, OT-I CD44high T cells (CD8+CD45.2+) were sorted to analyze Pten transcription by RT-qPCR. Naïve OT-I T cells were sorted before the adoptive transfer. (B-C) WT and HES1-deficient OT-I CD8+ T cells were adoptively transferred in B6.SJL mice followed by infection with Lm-OVA. At day 3 post-infection, cells were briefly (1h) restimulated with OVA peptide (2 μg/mL) before intracellular staining to detect phospho-Akt (B) and phospho-S6 (C) in OVA-specific OT-I effectors (CD8+CD45.2+). Endogenous CD8+ T cells from the same recipient mice (CD8+CD45.2-) were used as a staining control. The bar graphs show the ratio of the MFI of OVA-specific CD8+ T cells over the endogenous CD8+ T cells. Two independent experiments with 5 mice per group. Statistical significance was determined using ANOVA (A) and Student’s t test (B-C). *p<0.05, **p<0.01 and ***p<0.001.
Although Pten transcription was repressed as efficiently in WT and Notch1/2-deficient effectors, it was reported by the group of Amsen that Notch-deficiency in Ag-specific CD8+ T cells led to reduced activation of the Akt signaling pathway [2]. We also observed reduced phosphorylation of Akt in Notch-deficient CD8+ T cells (S1C Fig). However, HES1 induction was not required for proper phosphoralytion of S6 and Akt (threonine 308 and serine 473) in day 3 effector CD8+ T cells after a short (1h) in vitro stimulation with the OVA peptide (Fig 3B and 3C). Similar results were obtained when the phosphorylation of Akt and S6 was measured directly ex vivo (S2 Fig). As the activation of the Akt-mTOR axis was not affected in HES1-deficient day 3 effector CD8+ T cells, we further validated the lack of Hes1 transcription in Hes1Δ/Δ effector CD8+ T cells (S1A Fig). Our results suggest that the Notch signaling pathway influences the expression of other genes than Hes1 and Pten to promote proper activation of the Akt signaling pathway and effector CD8+ T cell differentiation. Alternatively, Notch signaling may regulate Akt activation via a non-canonical pathway as shown in other experimental systems [23,24]. The identification of the direct Notch target genes in mature CD8+ T cells should help to understand how Notch signaling influences activation of the Akt-mTOR pathway during SLEC differentiation.
Supporting information
(A) Hes1Δ/Δ effector CD8+ T cells do not transcribe Hes1. Hes1fl/fl and Hes1Δ/Δ OT-I T cells were adoptively transferred into congenic B6.SJL recipients (CD45.1+). One day later mice were infected with Lm-OVA. At day 3 post-infection with Lm-OVA, effector T cells (CD8+CD45.2+) were sorted to measure Hes1 transcription using RT-qPCR. Naïve OT-I T cells were used as a positive control. (B) Efficient deletion of the Hes1 gene in effector CD8+ T cells. Hes1fl/fl and Hes1Δ/Δ mice were infected with Lm-OVA, 7 days later OVA-specific effector CD8+ T cells (CD8+Tet-OVA+CD44hi), naïve endogenous CD8+ T cells (CD8+CD44lo) and CD4+ T cells were sorted for DNA extraction. Quantitative qPCR was performed to measure the extent of Hes1 gene deletion using CD4+ T cells as a reference. (C) Reduction of Akt phosphorylation in absence of Notch signalling. N1N2fl/fl and N1N2Δ/Δ OT-I T cells (CD45.2+) were adoptively transferred into congenic B6.SJL recipients (CD45.1+). One day later mice were infected with Lm-OVA. At day 3 post-infection, splenocytes were rested in media for one hour before stimulation with the OVA peptide for one hour. Cells were fixed, permeabilized and stained to measure the phosphorylation of Akt in OVA-specific CD8+ T cells (CD8+CD45.2+). Endogenous (Endo; CD8+CD45.2-) cells were used as staining control. The bar graphs show the ratio of the MFI of OVA-specific CD8+ T cells over the endogenous CD8+ T cells. Statistical significance was determined using ANOVA (A) and Student’s t test (C).
(PDF)
WT and HES1-deficient OT-I CD8+ T cells were adoptively transferred in B6.SJL mice followed by infection with Lm-OVA. At day 3 post-infection, cells were stained intracellularly to detect phospho-Akt (A) and phospho-S6 (B) in OVA-specific OT-I effectors (CD8+CD45.2+). Endogenous CD8+ T cells from the same recipient mice (CD8+CD45.2-) were used as a staining control. The bar graphs show the ratio of the MFI of OVA-specific CD8+ T cells over the endogenous CD8+ T cells. Two independent experiments with 5 mice per group. Statistical significance was determined using Student’s t test.
(PDF)
Individual data, mean, SD, SE and statistical tests for each experiment described in the manuscript.
(XLSX)
Acknowledgments
We thank laboratory members for helpful discussion, Martine Dupuis for cell sorting, Dr. Ryoichiro Kageyama for the Hes1-floxed mice and animal care technicians for mice husbandry. This works was funded by grants from the Canadian Institutes of Health Research (PJT-14903 and PJT-152988).
Data Availability
All relevant data are within the manuscript and its Supporting Information files.
Funding Statement
NL : This work was funded by grants from the Canadian Institutes of Health Research (PJT-14903 and PJT-152988) (http://www.cihr-irsc.gc.ca/e/193.html). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Mathieu M, Duval F, Daudelin J-F, Labrecque N. The Notch Signaling Pathway Controls Short-Lived Effector CD8+ T Cell Differentiation but Is Dispensable for Memory Generation. J Immunol. 2015;194: 5654–5662. 10.4049/jimmunol.1402837 [DOI] [PubMed] [Google Scholar]
- 2.Backer RA, Helbig C, Gentek R, Kent A, Laidlaw BJ, Dominguez CX, et al. A central role for Notch in effector CD8+ T cell differentiation. Nat Immunol. 2014;15: 1143–1151. 10.1038/ni.3027 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Wendorff AA, Koch U, Wunderlich FT, Wirth S, Dubey C, Brüning JC, et al. Hes1 Is a Critical but Context-Dependent Mediator of Canonical Notch Signaling in Lymphocyte Development and Transformation. Immunity. 2010;33: 671–684. 10.1016/j.immuni.2010.11.014 [DOI] [PubMed] [Google Scholar]
- 4.Wong GW, Knowles GC, Mak TW, Ferrando AA, Zúñiga-Pflücker JC. HES1 opposes a PTEN-dependent check on survival, differentiation, and proliferation of TCRβ-selected mouse thymocytes. Blood. 2012;120: 1439–1448. 10.1182/blood-2011-12-395319 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Kaech SM, Cui W. Transcriptional control of effector and memory CD8+ T cell differentiation. Nat Rev Immunol. 2012;12: 749–761. 10.1038/nri3307 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Kim EH, Sullivan JA, Plisch EH, Tejera MM, Jatzek A, Choi KY, et al. Signal integration by Akt regulates CD8 T cell effector and memory differentiation. J Immunol. 2012;188: 4305–4314. 10.4049/jimmunol.1103568 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Rao RR, Li Q, Odunsi K, Shrikant PA. The mTOR Kinase Determines Effector versus Memory CD8+ T Cell Fate by Regulating the Expression of Transcription Factors T-bet and Eomesodermin. Immunity. 2010;32: 67–78. 10.1016/j.immuni.2009.10.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Macintyre AN, Finlay D, Preston G, Sinclair LV, Waugh CM, Tamas P, et al. Protein Kinase B Controls Transcriptional Programs that Direct Cytotoxic T Cell Fate but Is Dispensable for T Cell Metabolism. Immunity. 2011;34: 224–236. 10.1016/j.immuni.2011.01.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Zhang L, Tschumi BO, Lopez-Mejia IC, Oberle SG, Meyer M, Samson G, et al. Mammalian Target of Rapamycin Complex 2 Controls CD8 T Cell Memory Differentiation in a Foxo1-Dependent Manner. Cell Rep. 2016;14: 1206–1217. 10.1016/j.celrep.2015.12.095 [DOI] [PubMed] [Google Scholar]
- 10.Araki K, Turner AP, Shaffer VO, Gangappa S, Keller SA, Bachmann MF, et al. mTOR regulates memory CD8 T-cell differentiation. Nature. 2009;460: 108–112. 10.1038/nature08155 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Ciofani M, Zúñiga-Pflücker JC. Notch promotes survival of pre–T cells at the β-selection checkpoint by regulating cellular metabolism. Nat Immunol. 2005;6: 881–888. 10.1038/ni1234 [DOI] [PubMed] [Google Scholar]
- 12.Chan SM, Weng AP, Tibshirani R, Aster JC, Utz PJ. Notch signals positively regulate activity of the mTOR pathway in T-cell acute lymphoblastic leukemia. Blood. 2007;110: 278–286. 10.1182/blood-2006-08-039883 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Imayoshi I, Shimogori T, Ohtsuka T, Kageyama R. Hes genes and neurogenin regulate non-neural versus neural fate specification in the dorsal telencephalic midline. Development. 2008;135: 2531–2541. 10.1242/dev.021535 [DOI] [PubMed] [Google Scholar]
- 14.Maekawa Y, Minato Y, Ishifune C, Kurihara T, Kitamura A, Kojima H, et al. Notch2 integrates signaling by the transcription factors RBP-J and CREB1 to promote T cell cytotoxicity. Nat Immunol. 2008;9: 1140–1147. 10.1038/ni.1649 [DOI] [PubMed] [Google Scholar]
- 15.Hogquist KA, Jameson SC, Heath WR, Howard JL, Bevan MJ, Carbone FR. T cell receptor antagonist peptides induce positive selection. Cell. 1994;76: 17–27. 10.1016/0092-8674(94)90169-4 [DOI] [PubMed] [Google Scholar]
- 16.Bahjat KS, Liu W, Lemmens EE, Schoenberger SP, Portnoy DA, Dubensky TW, et al. Cytosolic Entry Controls CD8+-T-Cell Potency during Bacterial Infection. Inf Imm. 2006;74: 6387–6397. 10.1128/IAI.01088-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Lacombe M-H, Hardy M-P, Rooney J, Labrecque N. IL-7 receptor expression levels do not identify CD8+ memory T lymphocyte precursors following peptide immunization. J Immunol. 2005;175: 4400–4407. [DOI] [PubMed] [Google Scholar]
- 18.Ostiguy V, Allard E-L, Marquis M, Leignadier J, Labrecque N. IL-21 promotes T lymphocyte survival by activating the phosphatidylinositol-3 kinase signaling cascade. J Leukoc Biol. 2007;82: 645–656. 10.1189/jlb.0806494 [DOI] [PubMed] [Google Scholar]
- 19.Mathieu M, Cotta-Grand N, Daudelin J-F, Boulet S, Lapointe R, Labrecque N. CD40-activated B cells can efficiently prime antigen-specific naïve CD8+ T cells to generate effector but not memory T cells. PLoS ONE. 2012;7: e30139 10.1371/journal.pone.0030139 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Boulet S, Daudelin JF, Labrecque N. IL-2 Induction of Blimp-1 Is a Key In Vivo Signal for CD8+ Short-Lived Effector T Cell Differentiation. J Immunol. 2014;193: 1847–1854. 10.4049/jimmunol.1302365 [DOI] [PubMed] [Google Scholar]
- 21.Heng TSP, Painter MW, The Immunological Genome Project Consortium. The Immunological Genome Project:networks of gene expression in immune cells. Nat Immunol. 2008; 9: 1091–1094. 10.1038/ni1008-1091 [DOI] [PubMed] [Google Scholar]
- 22.Chung J, Ebens CL, Perkey E, Radojcic V, Koch U, Scarpellino L, et al. Fibroblastic niches prime T cell alloimmunity through Delta-like Notch ligands. J Clin Invest. 2017;127: 1574–1588. 10.1172/JCI89535 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Perumalsamy LR, Nagala M, Banerjee P, Sarin A. A hierarchical cascade activated by non-canonical Notch signaling and the mTOR-Rictor complex regulates neglect-induced death in mammalian cells. Cell Death Differ 2009;16: 879–889. 10.1038/cdd.2009.20 [DOI] [PubMed] [Google Scholar]
- 24.Charbonnier L-M, Wang S, Georgiev P, Sefik E, Chatila TA. Control of peripheral tolerance by regulatory T cell–intrinsic Notch signaling. Nat Immunol. 2015;16: 1162–1173. 10.1038/ni.3288 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(A) Hes1Δ/Δ effector CD8+ T cells do not transcribe Hes1. Hes1fl/fl and Hes1Δ/Δ OT-I T cells were adoptively transferred into congenic B6.SJL recipients (CD45.1+). One day later mice were infected with Lm-OVA. At day 3 post-infection with Lm-OVA, effector T cells (CD8+CD45.2+) were sorted to measure Hes1 transcription using RT-qPCR. Naïve OT-I T cells were used as a positive control. (B) Efficient deletion of the Hes1 gene in effector CD8+ T cells. Hes1fl/fl and Hes1Δ/Δ mice were infected with Lm-OVA, 7 days later OVA-specific effector CD8+ T cells (CD8+Tet-OVA+CD44hi), naïve endogenous CD8+ T cells (CD8+CD44lo) and CD4+ T cells were sorted for DNA extraction. Quantitative qPCR was performed to measure the extent of Hes1 gene deletion using CD4+ T cells as a reference. (C) Reduction of Akt phosphorylation in absence of Notch signalling. N1N2fl/fl and N1N2Δ/Δ OT-I T cells (CD45.2+) were adoptively transferred into congenic B6.SJL recipients (CD45.1+). One day later mice were infected with Lm-OVA. At day 3 post-infection, splenocytes were rested in media for one hour before stimulation with the OVA peptide for one hour. Cells were fixed, permeabilized and stained to measure the phosphorylation of Akt in OVA-specific CD8+ T cells (CD8+CD45.2+). Endogenous (Endo; CD8+CD45.2-) cells were used as staining control. The bar graphs show the ratio of the MFI of OVA-specific CD8+ T cells over the endogenous CD8+ T cells. Statistical significance was determined using ANOVA (A) and Student’s t test (C).
(PDF)
WT and HES1-deficient OT-I CD8+ T cells were adoptively transferred in B6.SJL mice followed by infection with Lm-OVA. At day 3 post-infection, cells were stained intracellularly to detect phospho-Akt (A) and phospho-S6 (B) in OVA-specific OT-I effectors (CD8+CD45.2+). Endogenous CD8+ T cells from the same recipient mice (CD8+CD45.2-) were used as a staining control. The bar graphs show the ratio of the MFI of OVA-specific CD8+ T cells over the endogenous CD8+ T cells. Two independent experiments with 5 mice per group. Statistical significance was determined using Student’s t test.
(PDF)
Individual data, mean, SD, SE and statistical tests for each experiment described in the manuscript.
(XLSX)
Data Availability Statement
All relevant data are within the manuscript and its Supporting Information files.



