Age-Related Expression of Human AT1R Variants and Associated Renal Dysfunction in Transgenic Mice

Abstract

BACKGROUND

The contribution of single nucleotide polymorphisms in transcriptional regulation of the human angiotensin receptor type I (hAT1R) gene in age-related chronic pathologies such as hypertension and associated renal disorders is not well known. The hAT1R gene has single nucleotide polymorphisms in its promoter that forms 2 haplotypes (Hap), Hap-I and Hap-II. Hap-I of AT1R gene is associated with hypertension in Caucasians. We have hypothesized here that age will alter the transcriptional environment of the cell and will regulate the expression of hAT1R gene in a haplotype-dependent manner. This could likely make subjects with Hap-I increasingly susceptible to age-associated, AT1R-mediated complications.

METHOD

We generated transgenic (TG) mice with Hap-I and Hap-II. Adults (10–12 weeks) and aged (20–24 months) TG male mice containing either Hap-I or Hap-II were divided into 4 groups to study (i) the age-associated and haplotype-specific transcriptional regulation of hAT1R gene and (ii) their physiological relevance.

RESULTS

In aged animals, TG mice with Hap-I show increased expression of hAT1R and higher blood pressure (BP); suppression of antioxidant defenses (hemoxygenase, superoxide dismutase) and antiaging molecules (ATRAP, Klotho, Sirt3); increased expression of pro-inflammatory markers (IL-6, TNFα, CRP, NOX1); and increased insulin resistance. In vivo ChIP assay shows stronger binding of transcription factor USF2 to the chromatin of Hap-I mice.

CONCLUSION

Our results suggest that in aged animals, as compared with Hap-II, the TG mice with Hap-I overexpress hAT1R gene due to the stronger transcriptional activity, thus resulting in an increase in their BP and associated renal disorders.

The rennin–angiotensin system (RAS) plays a central role in the etiology of hypertension and the pathophysiology of renal diseases. The major biological actions of the RAS are mediated by angiotensin-II (Ang II), the dominant effector molecule which mainly acts through angiotensin receptor subtype 1 (AT1R), a typical member of the G protein–coupled receptor family. Various studies indicate that increased expression of AT1 receptor contributes to the onset of hypertension and associated renovascular abnormalities. An increase in blood pressure (BP) was observed in female transgenic (TG) mice that overexpress AT1aR.^1,2 Whereas, in heterozygous AT1R knockout mice, a 50% reduction in AT1aR expression accompanied by significantly reduced systolic BP was observed.²

Changes in the activity or responsiveness of the RAS occur with aging that contributes to the progressive functional deterioration and structural changes in the kidney.^3,4 On a molecular level, aging is regulated by a dual process: attenuation of inhibitory genes including ATRAP, Sirt1, Sirt3, Klotho and potentiation of augmenting factors, i.e., reactive oxygen species and inflammatory cytokines.^5–8 The augmenting factors have been shown to be associated with metabolic imbalance and an overactive RAS (reviewed by Kalupahana and Moustaid).^9,10 This association is anticipated as RAS promotes an inflammatory and oxidative environment that leads to metabolic disorders.^9,11 Inflammatory cytokines including IL-6, TNF-α, CRP, and reactive oxygen species increase insulin resistance and play a vital role in triggering vascular endothelial dysfunction and atherosclerosis. This may result in renovascular damage in age-associated renal disorders. By promoting pro-oxidative and pro-inflammatory milieu, AngII is intricately linked to the development and progression of chronic kidney disease. However, an overt association between aging and AngII-signaling, especially among various AT1R haplotype-subtypes, has not been well studied. Although it has been shown by other investigators that AT1R expression goes up in metabolic disorders, how age-related chronic renal diseases could regulate human angiotensin receptor type I (hAT1R) expression remains inconclusive.

In this respect, our previous studies have identified 2 distinct hAT1R gene haplotypes, based on linkage disequilibrium of single nucleotide polymorphisms (SNPs) in its promoter.¹² Polymorphisms in human AT1R gene promoter at -810T (rs275651), -713T (rs275652), -214A (rs422858), and -153A (rs275653) always occur together forming haplotype-I or Hap-I (SNPs TTAA). Similarly, single nucleotide variants -810A, -713G, -214C, and -153G always occur together forming haplotype-II or Hap-II (SNPs AGCG). Previously, we have shown that Hap-I of the hAT1R gene is associated with hypertension in Caucasians.¹² Therefore, we have generated TG mice containing either Hap-I or Hap-II of the hAT1R gene: (i) to understand the role of these haplotypes in transcriptional regulation of the hAT1R gene and (ii) to examine their role in BP regulation. We have shown that as compared with Hap-II, TG mice containing Hap-I have increased hAT1R expression, due to increased binding of transcription factors (TFs) and elevated BP. ¹²

Since age-related changes in the RAS are much observed in the kidney, we have hypothesized that age will alter the cellular transcriptional environment and increase hAT1R gene expression in a haplotype-dependent manner. This will result in an AT1R-mediated feed-forward loop promoting inflammation, oxidative stress, and hypertension in Hap-I TG mice. Thus, in this study, we tried to examine the contributions of age-induced overexpression of hAT1R and its role in associated renal complications. We show here that increase in age is associated with—an increase in hAT1R expression via increased binding of USF2 and Pol II to the hAT1R promoter; significantly increases BP; and elevated renal complications in our TG mice. Importantly, all of these effects are significantly more pronounced in Hap-I-TG mice of the hAT1R gene, as compared with the Hap-II. We have shown for the first time that age-induced regulation of the hAT1R gene is haplotype-dependent.

MATERIALS AND METHODS

TG animals

All animal experiments were performed according to the National Institute of Health Guide for the care and use of laboratory animals and approved by the institutional IACUC committee at the New York Medical College. The Hap-I and Hap-II of TG mice utilized in this study were generated in our laboratory as described previously.^2,12 Genotyping analysis of the tail snips, followed by sequencing, was performed to confirm the genetic lineage of these TG mice. For experimental purpose, these TG mice were housed individually. Adults (10–12 weeks old) and aged (20–24 months old) TG male mice containing Hap-I and Hap-II each were divided into 4 groups (n = 4). Animals were maintained in a 22 °C room with a 12-hour light/dark cycles and received water, standard chow ad libitum.

Quantitative real-time PCR

Freshly harvested kidneys from the adult and aged TG animals were snap frozen in liquid nitrogen. RNA was isolated using RNeasy Plus mini kit (Qiagen). RNA was reverse transcribed into cDNA using Revert Aid First Strand cDNA Synthesis Kit (Fermentas), as described in the manufacturer’s protocol. QRT-PCR was performed using primers for genes of interest including mouse and hAT1R; TFs including USF2, STAT3, CEBPβ, and GR; inflammatory mediators including IL6, TNFα, CRP; mediators of oxidative stress including NOX1; antiaging molecules ATRAP, Klotho, and Sirt3; marker for kidney fibrosis Collagen 3; and markers for antioxidant pathways including hemoxygenase, superoxide dismutase. Primers were obtained from Integrated DNA Technologies (IDT, Iowa). Gene expression was examined using Power SYBR green master mix on ABI 7500 Fast Real-Time PCR system (Life Technologies). Threshold cycles for 3 replicate reactions were used to calculate relative enriched DNA abundance following normalization with Input DNA.

In vivo ChIP analysis

The chromatin immunoprecipitation (ChIP) assay was performed using the EZ-ChIP assay kit (EMD Millipore, MA) as described previously.¹³ In brief, freshly perfused kidneys were fixed with formaldehyde; the DNA was fragmented by sonication followed by addition of USF2, Pol2 or rabbit IgG antibody, and overnight incubation at 4 °C. The antibody complexes were then captured with the protein A-agarose beads; the chromatin fraction was extracted with SDS buffer and reverse cross-linked at 65 °C for 4–6 hours. The DNA was then immunoprecipitated and subjected to qRT-PCR using (i) -213for TCCGCAGGAAATGATACTCC as a forward and -213rev ACGAGGCTCTGTTTTGCATT as a reverse primer when USF2 antibody was used for immunoprecipitation; this amplified 217 bp amplicon spanning the USF2-binding site located around -213 region of the human AT1R gene promoter (ii) -119for TGATAGTTGACACGGGACGA as a forward primer and -119rev TTTATAGTGAGGGGCGTTGC as a reverse primer when and RNA pol II antibody was used. This spanned 178 bp amplicon containing RNA pol II-binding region of the human AT1R gene promoter. The fraction enriched by rabbit IgG was used as a negative control for nonspecific binding. Threshold cycles for 4 replicate reactions were determined and relative enriched DNA abundance calculated following normalization with Input DNA.

BP measurement in TG mice

BP was measured in the conscious state by radio telemetry as described previously.^12,14 Systolic blood pressure (SBP) was continuously acquired by implantation of telemetric probe PA-C20 into the aorta via the left carotid artery. After 1 week of recovery from the surgical procedure, BP readings were recorded every 10 minutes using Data-Dataquest ART software purchased from Data Science International instrument as described previously.^15,16

Enzyme-linked immunosorbent assay

Plasma creatinine and aldosterone levels were determined by ELISA assay kits from Cayman Chemical (cat#700460) and Kamiya Biomedical Company (cat#KT-57554), respectively. The creatinine and aldosterone concentrations in the samples were determined directly from the standard curve as described in the manufacturer’s protocol.

Insulin resistance quantification

We measured plasma glucose and insulin by ELISA (Glucose colorimetric assay kit, Cayman; Mouse insulin ELISA kit, EMD Millipore) to calculate homeostatic model assessment (HOMA2)-insulin resistance score (www.dtu.ox.ac.uk/homacalculator/) in our TG lines.

Statistical analyses

All experiments were conducted in quadruplicate (n = 4). Data are expressed as the means ± SE. Statistical significance was assessed using 2-way analysis of variance with a Tukey Kramer post hoc analysis. The significance level was set at P < 0.05.

RESULTS

Expression of hAT1R increases in Hap-I TG mice

Transcriptional effects of the increased hAT1R were examined by gene expression analysis. Kidney is the major target for the hAT1R expression and its physiological actions. Renal extracts show increased (P < 0.05) baseline hAT1R mRNA level in the Hap-I TG mice (Figure 1a). Importantly, aged animals with Hap-I show a significantly higher level of hAT1R transcription (2.74 folds vs. Hap-II, P < 0.046) (Figure 1a). Endogenous mAT1R mRNA is also upregulated in both TG lines. Importantly, however, this upregulation is not different in the 2 TG haplotypes (Figure 1b). It is worth noting that the mAT1R gene is similar in the 2 haplotypes as they are both on the same genetic background, i.e., C57BL6.

Figure 1.

Expression of mouse and human AT1R in the kidney of adult or aged TG mice by quantitative RT-PCR analysis: (a) hAT1R mRNA and (b) mATR mRNA. Results are mean ± SE (n = 4); *P < 0.05 compared with Hap-II. ^ϮP < 0.05 compared with their respective adult groups. Abbreviations: AD, adults; AG, aged; AT1R, angiotensin receptor type I; hAT1R, human angiotensin receptor type I; RT-PCR, real-time polymerase chain reaction; TG, transgenic.

Aged TG mice show a greater binding of TFs to the chromatin of Hap-I

Increase in age is reported to promote chronic inflammation and oxidative profile. These in turn may alter the cellular transcriptional environment by altering levels of various TFs including STAT3, CEBPβ, GR, and USF2. Nucleotide sequence of the hAT1R gene promoter contains binding sites for these TFs. Also, the nucleotide sequence in -214 regions of Hap-I promoter has stronger homology to the USF2 TF.¹² This may alter the binding of USF2 and other coactivating TFs to the promoter region and may differentially regulate hAT1R gene expression. Therefore, we examined the age-related chronic effect on expression of these TFs and also on their binding to the hAT1R promoter. Our Q-PCR results show that TFs USF2, STAT3, CEBPβ, and GR were significantly upregulated (P < 0.01) in the kidney tissues from both the TG lines, and this effect was independent of their haplotype (Figure 2). To elucidate the role of SNPs in differential binding of TFs, ChIP assays were performed using USF2 and Pol II antibodies on chromatin extracts from the kidney tissues of the TG animals. As shown in Figure 3a, USF2 (3.06 folds vs. Hap-II, P < 0.014) and Figure 3b, Pol II (2.21 folds vs. Hap-II, P < 0.026) bind more strongly to the chromatin obtained from renal tissue of aged TG mice with Hap-I, as compared with Hap-II. These results show an enhanced binding of TFs to the hAT1R promoter in aging kidneys of TG mice containing Hap-I.

Figure 2.

Age-related expression of renal transcription factors: Fold change in mRNA expression (from adult to aged) for USF2, STAT3, CEBPβ, and GR in the kidney of hAT1R TG mice. Results are shown as mean ± SE (n = 4). Abbreviations: AD, adults; AG, aged; hAT1R, human angiotensin receptor type I; TG, transgenic.

Figure 3.

Representative ChIP assay using immunoprecipitated DNA from the kidney of adult and aged TG mice containing either Hap-I or Hap-II: The assay was performed in the presence of antibodies against USF2 (a) and Pol II (b). Immunoprecipitated DNA was used to amplify the nucleotide sequence encompassing 213 region (USF2-binding region) and 119 region (Pol II-binding region) as described in “Material and Methods.” Quantification of the PCR amplicon of respective antibody-enriched DNA was done by normalizing to their input DNA as performed by Q-PCR. The result shows a significant increase in the age-induced binding of USF2 and Pol II in TG mice with Hap-I. *P < 0.05 compared with Hap-II. ^ϮP < 0.05 compared with their respective adult groups. Results are shown as mean ± SE (n = 4). Abbreviations: AD, adults; AG, aged; ChIP, chromatin immunoprecipitation; Q-PCR, quantitative polymerase chain reaction; TG, transgenic.

Effect of age on physiological aspects of TG animals

Multiple physiological parameters were assessed to gauge the age effect in our 2 haplotypes. The following were measured in adult and aged animals: inflammation and oxidative stress (Figure 4), SBP (Figure 6), creatinine levels, HOMA II score, and plasma aldosterone levels (Table 1). They are all significantly (P < 0.05) and consistently higher in Hap-I mice as compared with mice with Hap-II. Supplementing these results, the antioxidant defense was down in TG mice with Hap-I (Figure 5).

Figure 4.

Blood pressure analysis in TG mice: Each bar represents SBP taken from 4 male animals over a period of 24 hours (c). The hourly mean was taken from the average of 6 SBP data points at an interval of 10 minutes each (a, b). *P < 0.05 compared with Hap-II; ^ϮP < 0.05 compared with respective adult age group. Results are shown as mean ± SE (n = 4). Abbreviations: AD, adults; AG, aged; SBP, systolic blood pressure; TG, transgenic.

Figure 6.

Age-related expression of antioxidant and pro-survival genes in adult and aged TG mice: Quantitative RT-PCR analysis for SOD1 and HO1 was performed to assess the antioxidant defense (a, b); Sirt3, Klotho, and ATRAP as pro-survival genes (c–e) and Col3 as a marker for fibrosis (f) in adult and aged TG mice of both the haplotypes. *P < 0.05 compared with Hap-II. ^ϮP < 0.05 compared with their respective adult groups. Results are shown as mean ± SE (n = 4). Abbreviations: AD, adults; AG, aged; HO1, hemoxygenase; RT-PCR, real-time polymerase chain reaction; SOD1, superoxide dismutase; TG, transgenic.

Table 1.

Plasma creatinine, aldosterone, and HOMA2 score in aged TG mice

Parameter	Hap-I		Hap-II		P values
	Adult	Aged	Adult	Aged
Plasma creatinine (mg/dl)	0.64 ± 0.09	1.46 ± 0.1	0.59 ± 0.08	0.84 ± 0.07	<0.05
Plasma aldosterone (pg/ml)	328 ± 44	181 ± 10	245 ± 7	210 ± 41	<0.05
HOMA2 score	3.37 ± 0.1	6.77 ± 0.1	2.65 ± 0.1	4.52 ± 0.1	<0.05

Figure 5.

Age-associated renal expression of inflammatory and oxidative markers in the kidney of transgenic mice by quantitative RT-PCR analysis: Functional relevance of the upregulated hAT1R was assessed by relative mRNA expression analysis of the pro-inflammatory, pro-oxidative genes including IL6, CRP, TNFα, NOX1 in adult and aged TG mice (a–d). *P < 0.05 compared with Hap-II. ^ϮP < 0.05 compared with their respective adult groups. Results are shown as mean ± SE (n = 4). Abbreviations: AD, adults; AG, aged; hAT1R, human angiotensin receptor type I; RT-PCR, real-time polymerase chain reaction; TG, transgenic.

• (1) TG mice containing Hap-I show an increased expression of pro-inflammatory and fibrosis markers and a decrease in antioxidant and antiaging molecules: Functional relevance of the upregulated hAT1R was assessed by expression analysis of the pro-inflammatory/oxidative and fibrosis markers including IL6, CRP, TNFα, and NOX1. Complementary experiments were performed to examine (i) the cellular antioxidant defenses including superoxide dismutase and hemoxygenase (Figure 5a,b), (ii) the antiaging markers including ATRAP, Klotho, and Sirt3 (Figure 5c–e) and aging or pro-fibrosis marker collagen3 (col3) (Figure 5f). Our results show that there is a significant (P < 0.05) increase in all the indicated inflammatory markers (IL6 1.98 fold, P < 0.028; CRP 4.59 fold, P < 0.013; TNFα 1.76 fold, P < 0.042; Nox1 1.58 fold, P < 0.015) in the renal tissues from the aged TG mice containing Hap-I as compared with the Hap-II of the hAT1R gene (Figure 4a–d). Similarly, the expression of genes involved in defense system was significantly downregulated (SOD 0.67 fold, P < 0.035; hemoxygenase 0.56 fold, P < 0.013; ATRAP 0.63 fold, P < 0.005; Klotho 0.19 fold, P < 0.035; Sirt3 0.59 fold, P < 0.014) in Hap-I animals (Figure 5a–e). The marker Col3 for kidney fibrosis was significantly upregulated in Hap-I TG animals (2.47 fold, P < 0.002, Figure 5f).

• (2) SBP increased in Hap-I TG mice: We observed that TG mice with Hap-I have significantly increased SBP as compared with Hap-II at resting conditions consistent with our published study.¹² We next analyzed the effect of aging on SBP of both of our TG mice with Hap-I and Hap-II. Our results show that SBP increases in both the TG lines but more significantly (P < 0.05) in mice containing Hap-I of hAT1R (from 130 to 145 mm Hg; P < 0.001) as compared with Hap-II animals (from 121 to 131mm Hg, P < 0.007) (Figure 6a–c). We also noticed a flattening of BP circadian curve in our TG animals, more prominently in Hap-I. These results suggest that our AT1R-TG model can be used to study the age-related comorbidities (especially disturbed circadian rhythm and high BP). Each bar in Figure 6a,b represents SBP taken from 4 male animals over a period of 24 hours. The hourly mean was taken from the average of 6 SBP data points at an interval of 10 minutes each.

• (3) Biochemical markers:

  • (i) Increased plasma creatinine levels in Hap-I TG animals: Plasma creatinine levels were elevated in both lines in aged animals but significantly (P < 0.003) higher in Hap-I TG mice (Hap-II 0.84 ± 0.0.07 mg/dl vs. Hap-I 1.46 ± 0.09 mg/dl) (Table 1).
  • (ii) Hap-I TG mice show higher HOMA-insulin resistance score: The HOMA2 is significantly (P < 0.038) higher in aged Hap-I mice (Hap-II, 4.52 ± 0.09 vs. Hap-I, 6.77 ± 0.11) (Table 1).
  • (iii) TG mice with Hap-I show lower plasma aldosterone: Plasma aldosterone levels were significantly lowered in both aged TG mice but more significantly in Hap-I (210pg in Hap-II vs. 181pg/ml in Hap-I, P < 0.04) (Table 1).

DISCUSSION

Majority of the physiological effects of the RAS, especially AngII, are brought about by activation of AT1R in target cells. Multiple studies have shown the activation of AT1R signaling in the process of aging.^5,17,18 Our present study is the first one to explore the effects of the aging process on AT1R transcriptional regulation and expression. We show here that allele-specific, transcriptional regulation of the hAT1R gene is age related with consequential physiological and metabolic alterations. In our previous studies, we have identified 2 haplotypes (Hap-I and Hap-II) of the hAT1R gene based on SNPs in its promoter. We have shown that (i) Hap-I is associated with hypertension in Caucasians and (ii) TG mice with Hap-I overexpress hAT1R gene in different tissues and have high BP as compared with the TG mice containing Hap-II.¹² We have found that expression of hAT1R and mAT1R increases with age in the kidneys of both the TG lines. However, the important observation is that the increase of hAT1R is more significant in TG mice with Hap-I as compared with Hap-II. These results confirm our hypothesis that SNP variations in hAT1R-haplotypes not only regulate basal gene expression but also significantly affect its expression in age-dependent manner. This is further confirmed by the observation that the endogenous mAT1R, although upregulated, is not different in the 2 TG haplotypes.

Recent studies have revealed a global and tissue-specific transcriptomic variation related to aging.^19–21 Some of these age-associated changes in transcriptional signatures may be involved in the current haplotype-specific regulation of hAT1R gene. Previous studies from our group have clearly shown that promoter of hAT1R interacts with certain TFs including CEBPβ, USF2, STAT3.¹³ We were interested in exploring the age-dependent profiling of these TFs in our TG animals. Result from our studies shows that the aged animals indeed have increased levels of renal TFs including, CEBPβ, STAT3, GR, and USF2, which may interact with the promoter of the hAT1R gene. It is noteworthy that increase in the expression of these TFs is haplotype independent.

Although age-related increase in TFs is not haplotype-dependent, their binding to the hAT1R as determined by ChIP assay depends on the haplotype. Thus, haplotype-dependent, variable TF binding to the hAT1R gene in mice undergoing age-associated renal disorders is the another key finding of the study. We have previously shown that nucleotide sequence of the Hap-I (containing nucleoside A at -214) has greater homology with E-box (CANNTG) that is recognized by helix-loop-helix family of TFs including USF1.¹² USF1 binds as a homodimer or as a heterodimer with the related TF USF2 to E boxes and controls the expression of a number of genes.^22,23 USF has been shown to increase the expression of genes involved in glucose and lipid metabolism.²⁴ Overexpression of USF2 in TG mice influences metabolic traits such as obesity, lipid profiles, and glucose/insulin ratio.²⁵ Additionally, earlier studies have established SNP-dependent differential gene regulation by USF.^26–28 Besides USF, the other TFs which have sequence homology to the proximal promoter region of the hAT1R gene are CEBPβ, GR, and STAT3. Their role is well defined in the etiology of metabolic and renal disorders.^29–32 Their expression with age does not vary significantly in both TG AT1R haplotypes. In recent studies, we have shown that these TFs bind differentially to Hap-I and Hap-II of the hAT1R promoter due to their possible cross-talk with USF2.¹³ Results from our ChIP qRT-PCR confirm this finding that with age, the upregulated USF2 TF binds more strongly to the Hap-I as compared with the Hap-II. Thus, this has led us to conclude that age alters cellular transcriptional milieu independent of haplotypes. It is the differential binding of these TFs to the 2 haplotypes that then dictates variable hAT1R expression. This highlights the role of SNPs in the hAT1R promoter in governing its expression during age-related renal disorders.

Another key aspect of this study is a significant pathophysiological impact of differential hAT1R gene regulation in our TG animals. The primary pathophysiological changes anticipated in this study, age-associated renal disorders, are frequently linked with decreased circulating levels of mineralocorticoids, upregulated pro-inflammatory milieu, and end-organ damage. We have shown that an increased expression of the AT1R has the potential to exacerbate the pathological outcomes of age-related renal disorders, increased BP, and oxidative stress. These complications can operate in a vicious cycle with the RAS where altered transcriptional milieu upregulates AT1R, in turn, contributing to the pathologies of the renal system. Crucially, however, this age-associated hAT1R regulation is haplotype-dependent with clear implications for associated pathophysiology. Higher BP, oxidative stress, exaggerated insulin resistance (HOMA2 score), and renal damage (as evidenced by elevated plasma creatinine levels) in Hap-I mice are indicative of the same. An important observation from our radiotelemetric BP recordings is a shift in circadian rhythm. Our TG animals with metabolic disorder due to old age and increased expression of hAT1R show a disrupted BP circadian rhythm with a significant flattening of 24-hour curve for SBP. This effect is in line with the previous studies where aging and metabolic illnesses resulted in disrupted circadian clock.^33–35

Pathophysiological observations in our TG animals are also supported with published reports showing a direct correlation between AT1R levels and oxidative stress, primarily via activation of NADPH oxidase and secretion of pro-inflammatory cytokines.³⁶ Increased expression of cytokines, including IL-6, TNFα, and IL1β, and increased levels of NADPH oxidase component, NOX1, and suppressed antioxidant defense system confirm the functional role of increased hAT1R activation with increasing age in TG mice with Hap-I. Thus, the synergistic interaction between age-related metabolic disarrays and hAT1R, in Hap-I mice, worsens their renal functions with a potential to progress to an end-organ damage.

The functional role of ATRAP, Klotho, and Sirtuin genes as age inhibitory factors and collagen as pro-fibrotic and pro-aging factor is well documented in physiological age-degenerative process in kidney and other tissues.^17,37,38 ATRAP was originally identified as a functional molecule that binds to the carboxy-terminal domain of AT1R and selectively inhibits its over activation under various pathological stimuli are applied.^39–42 Previous studies have also emphasized the role of renal sirtuins in protecting the kidneys against aging. Among 7 mammalian sirtuins, sirtuin1 (sirt1) and sirtuin3 (sirt3) are considered antiaging molecules in the kidney.⁴³ Lim et al.⁴⁴ have shown that in aging mice, there occurs a reciprocal relationship between Sirtuins expression and oxidative stress; sirt1 going down with age. Several reports have also suggested the role of sirt1 as a negative regulator of AT1R expression.⁴⁵ Sirt3 may also be involved in renal aging in association with the RAS. Mice with disrupted AT1a receptor gene live longer and have lower levels of oxidative stress and increased expression of sirt3 compared with aged-wild-type mice.¹⁷ In line with these studies, we also observed that expression of pro-fibrotic marker collagen3 goes significantly up with aging in Hap-1 TG animals, while expression of ATRAP, Klotho, and Sirt3 goes down with age in both TG animals but more significantly in mice containing Hap-1.

In conclusion, we show here that the aging process alters the cellular transcriptional milieu, which in turn regulates the expression of hAT1R gene based on its haplotype. Hap-I of hAT1R is much more amenable to such modulations due to greater affinity of its promoter to the key TFs upregulated by age. This could likely make subjects with Hap-I increasingly susceptible to age-associated, AT1R-mediated complications such as hypertension and chronic renal damage (Figure 7). Clinically, this study is highly significant as it will help in identifying individuals with “at-risk” hAT1R haplotypes and can benefit patients by providing them timely and targeted therapy so as to prevent long-term cardio-renal complications.

Figure 7.

A schematic model showing age-associated regulation of human AT1R gene and related renal complications: The model depicts the age-dependent upregulation of transcription factors which binds with higher affinity to hAT1R promoter in Hap-I TG mice and causes overexpression of hAT1R gene. This results in AT1R-mediated complications such as hypertension and chronic renal damage.

CONFLICT OF INTEREST

The authors have indicated they have no potential conflict of interest to disclose.