Characterization of the APSES-family transcriptional regulators of Histoplasma capsulatum

Abstract

The fungal APSES protein family of transcription factors is characterized by a conserved DNA-binding motif facilitating regulation of gene expression in fungal development and other biological processes. However, their functions in the thermally dimorphic fungal pathogen Histoplasma capsulatum are unexplored. Histoplasma capsulatum switches between avirulent hyphae in the environment and virulent yeasts in mammalian hosts. We identified five APSES domain-containing proteins in H. capsulatum homologous to Swi6, Mbp1, Stu1 and Xbp1 proteins and one protein found in related Ascomycetes (APSES-family protein 1; Afp1). Through transcriptional analyses and RNA interference-based functional tests we explored their roles in fungal biology and virulence. Mbp1 serves an essential role and Swi6 contributes to full yeast cell growth. Stu1 is primarily expressed in mycelia and is necessary for aerial hyphae development and conidiation. Xbp1 is the only factor enriched specifically in yeast cells. The APSES proteins do not regulate conversion of conidia into yeast and hyphal morphologies. The APSES-family transcription factors are not individually required for H. capsulatum infection of cultured macrophages or murine infection, nor do any contribute significantly to resistance to cellular stresses including cell wall perturbation, osmotic stress, oxidative stress or antifungal treatment. Further studies of the downstream genes regulated by the individual APSES factors will be helpful in revealing their functional roles in H. capsulatum biology.

Aspects of yeast and mycelial growth of the dimorphic fungal pathogen Histoplasma capsulatum are controlled by APSES-family transcription factors.

INTRODUCTION

The APSES domain-containing proteins constitute a family of transcription factors specific to fungi that share a highly conserved basic helix-loop-helix (bHLH) DNA-binding motif, referred to as the APSES domain (Aramayo et al.1996). The APSES proteins from different fungi are divided into four major groups (A, B, C and D) based on relatedness of the APSES-domain (Zhao et al.2015). Group A includes the Mbp1, Swi4 and Swi6 homologs important for fungal growth and progression through the cell cycle (Koch et al.1993; Koch et al.1996; Siegmund and Nasmyth 1996). Single mutants in Saccharomyces cerevisiae are viable but display impaired growth and budding (Koch et al.1993; Gray et al.1997; Wijnen, Landman and Futcher 2002; Bean, Siggia and Cross 2006; White, Riles and Cohen 2009;) and similar phenotypes are seen in Candida albicans and Magnaporthe oryzae mutants. In Cryptococcus neoformans, the two APSES-family proteins, Mbp1 and Mbs1, belong to group A, but their functions appear to have diverged from those of Ascomycetes (Song et al.2012). Group B is comprised of the Xbp1 proteins. Group C APSES proteins regulate fungal differentiation. Group D includes proteins defined mostly by bioinformatic searches. The number of APSES proteins varies among fungal species suggesting their functions have specialized for the specific biology or niches of different fungi; Aspergillus fumigatus, Aspergillus nidulans, C.albicans and Neurospora crassa have five identified APSES members each, whereas C. neoformans has only two and S. cerevisiae has six (Zhao et al.2015).

In the Hemiascomycetes (e.g. Saccharomyces and Candida species), group C-I proteins (Efg1, Efh1, Phd1 and Sok2) regulate filamentous versus yeast growth. In S. cerevisiae, Phd1 activates the pseudohyphal growth program in response to nitrogen starvation (Gimeno and Fink 1994; Hanlon et al.2011) and suppresses filamentation defects (Lorenz and Heitman 1998), whereas Sok2 represses pseudohyphal differentiation (Ward et al.1995; Pan and Heitman 2000). Candida albicans has two closely related group C ASPES proteins, Efg1 and Efh1, which link the regulation of yeast-to-hyphal transition to virulence (Lo et al.1997). Efg1 plays a key role in formation of hyphae, a fungal cell type required for adherence and invasion of host cell and virulence in murine models of disseminated and oral candidiasis (Lo et al.1997; Stoldt et al.1997; Doedt et al.2004; Park et al.2005).

In Euascomycetes, the group C-II proteins (StuA/Asm1 homologs) are key regulators of mycelial growth and differentiation of sexual and/or asexual reproductive structures (Borneman, Hynes and Andrianopoulos 2002; Sheppard et al.2005; Lysoe et al.2011; Pasquali et al.2013; Hu et al.2015; Soyer et al.2015). In A. nidulans, mutants deficient in StuA produce smaller conidiophores that lack phialides and produce few conidia (Miller, Wu and Miller 1992). Aspergillus fumigatus StuA is also required for conidiation and mutants show abnormal conidiophores that bear only a small number of dysmorphic conidia (Sheppard et al.2005; Twumasi-Boateng et al.2009). Similarly, deletion of Asm1, the StuA homolog in N. crassa, affects the development of aerial hyphae, thus impairing spore germination, mycelial growth and both asexual and sexual sporulation (Aramayo et al.1996). In addition to regulating conidia and sclerotia morphogenesis, StuA in Aspergillus flavus and A. fumigatus also regulates biosynthesis of secondary metabolites and mycotoxins (Sheppard et al.2005; Yao et al.2017). Functional studies of group C APSES proteins in fungal pathogens (e.g. Magnaporthe grisea) similarly reveal roles in differentiation into specialized hyphal structures important for plant invasion and growth (Nishimura et al.2009). In addition, a StuA homolog regulates Ustilago maydis and Fusarium graminearum sporulation and pathogenicity (Garcia-Pedrajas, Baeza-Montanez and Gold 2010; Lysoe et al.2011) suggesting APSES proteins contribute to fungal virulence.

Histoplasma capsulatum is a dimorphic fungus whose biology includes regulated morphological transitions and resistance to cellular stresses imposed by infection of mammalian hosts. In the environment, H. capsulatum grows in nitrogen-rich soil as mycelia, which produce conidia for dissemination. Human infection occurs by inhalation of the conidia. Within the mammalian host, the elevated temperature induces the formation of pathogenic yeast cells, a transition that is required for the establishment of disease (Medoff et al.1986; Nemecek, Wuthrich and Klein 2006; Nguyen and Sil 2008). The temperature-controlled transition to pathogenic yeasts is accompanied by large changes in gene expression (Hwang et al.2003; Edwards et al.2013; Gilmore et al.2015), the regulation of which is only partially understood but includes the Drk1 regulatory kinase and/or an interdependent network of Ryp transcription factors (Nemecek, Wuthrich and Klein 2006; Nguyen and Sil 2008; Webster and Sil 2008; Beyhan et al.2013). Included in the yeast-phase regulon are virulence factors that facilitate H. capsulatum evasion and neutralization of phagocyte defenses (Rappleye, Engle and Goldman 2004; Rappleye, Eissenberg and Goldman 2007; Youseff and Rappleye 2012; Holbrook et al.2013; Garfoot et al.2016). The function of the APSES proteins in thermally dimorphic fungi is unknown. Considering the importance of the APSES family of transcription factors in regulating adaptation to different environments and their function in the development of fungal cell types, we investigated the role of the APSES transcription factors in H. capsulatum biology and virulence.

MATERIALS AND METHODS

Strains and culture conditions

The H. capsulatum mutant strains used in this study (Table 1) were derived from the wild-type G217B isolate (ATCC 26032). Yeast cells were cultivated and maintained in Histoplasma macrophage medium (HMM; Worsham and Goldman 1988) supplemented with 100 μg/ml uracil for uracil auxotrophs. Liquid cultures were grown at 37°C with constant aeration (200 rpm) and growth monitored by the culture optical density (OD 595 nm) until the late exponential growth phase. HMM solid medium was prepared by the addition of 0.6% agarose and was supplemented with 25 μM FeSO₄. Mycelia were cultivated at 23°C–25°C in Sabouraud dextrose (SD) medium (4% glucose, 1% peptone) optionally solidified with 0.6% agarose (SDA medium). Agrobacterium tumefaciens strain LBA1100 used for H. capsulatum transformation was grown in LB medium supplemented with spectinomycin (250 μg/mL) and kanamycin (100 μg/mL) for selection of RNA interference (RNAi) plasmids.

Table 1.

Histoplasma capsulatum strains.

Strain	Genotypea
OSU194	G217B ura5–42Δ zzz::pAG21 (apt3, gfp)
OSU347	G217B ura5–42Δ zzz::pAG21 (apt3, gfp) zzz::pED02 (URA5, gfp -RNAi)
OSU348	G217B ura5–42Δ zzz::pAG21 (apt3, gfp) zzz::pLL03 (URA5, gfp:SWI6-RNAi)
OSU349	G217B ura5–42Δ zzz::pAG21 (apt3, gfp) zzz::pLL04 (URA5, gfp:AFP1-RNAi)
OSU350	G217B ura5–42Δ zzz::pAG21 (apt3, gfp) zzz::pLL06 (URA5, gfp:STU1-RNAi)
OSU366	G217B ura5–42Δ zzz::pAG21 (apt3, gfp) zzz::pCR684 (URA5, gfp:XBP1-RNAi)

^aGene designations:

zzz::T-DNA: T-DNA integration at an undetermined chromosomal location.

apt3: aminoglycoside phosphotransferase (G418 resistance).

gfp: green-fluorescence protein.

URA5: orotate phosphoribosyltransferase.

AFP1, STU1, SWI6, XBP1: APSES-family transcription factor genes.

Identification of APSES homologs

Homologs of the APSES members were identified by BLASTP query against fungal proteins using the already characterized sequences from Saccharomyces cerevisiae, Candida albicans and Aspergillus fumigatus (Zhao et al.2015). APSES domains in each protein were identified by the ScanProSite (http://prosite.expasy.org/scanprosite/). The amino acid sequences of the APSES domains were aligned and a neighbor joining-based phylogenetic tree was constructed by ClustalW in Bioedit (v7.2). Phylogenetic clades and ortholog designations followed previous definitions (Zhao et al.2015).

RNA isolation and quantitative PCR

Wild-type G217B H. capsulatum yeasts were collected from liquid HMM cultures in the exponential growth phase by centrifugation (5 min at 2000 × g). Histoplasma capsulatum mycelia was collected from SD solid medium by scraping with a sterile razor blade when mycelial growth was abundant and conidia were observed by microscopy. Histoplasma capsulatum cells were resuspended in TRIzol (LifeTechnologies, Carlsbad, CA) and mechanically disrupted with 0.5-mm glass beads (two times for 1 min). RNA was purified from the lysates using the Directzol RNA Miniprep (Zymo Research, Irvine, CA) or Masterpure (Epicentre, Madison, WI) kits. Genomic DNA was removed following two treatments with DNase (Turbofree DNase, LifeTechnologies, Carlsbad, CA). Five micrograms of total RNA were reverse transcribed using Maxima reverse transcriptase (Thermo, Waltham, MA) and random hexamer primers. Quantitative PCR was performed on reverse-transcribed RNA using a SYBR-green-based PCR master mix (SensiMix SYBR No-ROX Kit, Bioline, Taunton, MA) containing polymerase and 0.5 μM gene-specific primers designed to span predicted introns (Table 2). For thermocycling (Mastercycler RealPlex 2, Eppendorf, Hamburg, Germany), we used a 54°C annealing temperature in PCR reactions. Amplicon specificity was validated by melting curve analysis and by agarose gel electrophoresis to show a band size consistent with the lack of introns. Transcript levels relative to actin (ACT1) expression were determined using the threshold cycle (ΔΔCT) method (Schmittgen and Livak 2008) after normalization of cycle thresholds to expression of the constitutive translation elongation factor (TEF1) gene. We analyzed samples from three independent biological replicates of yeasts and mycelia.

Table 2.

Quantitative-PCR primers for measuring APSES-gene transcription.

Target gene	Forward primer	Reverse primer
AFP1	CCATTAGGAAGCGGAAGGCAG	ATTAAAGAAAGTATGGTATTGCCGC
MBP1	TCCACCTCCACCGTCCTCAGT	TTAGTGATGCTGCTTGCTTCCG
STU1	CGACAACACCCGCCACCACA	GGCTCACTTGTCCGTTTCCCTG
SWI6	CGGAATCGTTTGCTAATCGGCT	GCCTAGCTTTCGCACTTTCCCG
XBP1	CCTGGTCTCCGCGAAATCTGTC	TCACCCACCTGCCAAACCGC
ACT1	GGTTTCGCTGGCGATGATGCTC	AAGGACGGCCTGGATGGAGACG
TEF1	GCTCTGCTTGCTTTCACCCTTG	TCTCCTTGTTCCAGCCCTTGT

Generation of APSES knockdown strains

APSES transcription factors were depleted from H. capsulatum by green fluorescent protein (GFP)-sentinel-based RNAi (Youseff and Rappleye 2012). For construction of the RNAi vectors, coding sequence fragments (AFP1: nucleotides 447–1376; MBP1: nucleotides 580–1612; STU1: nucleotides 618–1223; SWI6: nucleotides 315–1096; XBP1: nucleotides 176–935) were amplified from cDNA by PCR and directionally ligated into the sentinel RNAi vector, pED02 (Garfoot et al.2016). Agrobacterium tumefaciens was transformed with RNAi plasmids by electroporation. For transformation of RNAi constructs into H. capsulatum, A. tumefaciens containing the RNAi-vector was co-cultured with the GFP-expressing H. capsulatum RNAi sentinel strain OSU194 (Garfoot et al.2016) for 48 h, after which H. capsulatum transformants were selected by uracil prototrophy in HMM. The sentinel GFP fluorescence of H. capsulatum transformants was imaged using Micro-manager v1.4 (Stuurman et al.2010:Unit14.20) with a modified gel documentation system and quantified using Fiji software (ImageJ v1.51p) (Schindelin et al.2012). Two independent RNAi transformants for each APSES-family factor were characterized.

Stress sensitivity assays of H. capsulatum knockdown strains

Histoplasma capsulatum yeast cells were inoculated into 96-well plates (2 × 10⁶ yeasts/mL) containing HMM and serial dilutions of each stress agent. Yeast growth was estimated by the OD at 595 nm (OD 595) after 4 days at 37°C, and the relative reduction in growth was determined by comparison with that in the absence of stress agent. The 50% inhibitory concentration (IC₅₀) was calculated by non-linear regression of the dose-response data using Prism software (Graphpad Prism v5, Graphpad Software, La Jolla, CA). The concentrations of each stress agent used were: Uvitex (0.0006%–0.16%), Congo red (0.0625%–16 μg/mL), sodium dodecyl sulfate (SDS) (0.0005%–0.128%), NaCl (0.008–8 M), fluconazole (0.0625–32 μg/mL), and H₂O₂ (0.01–5 mM).

Dimorphism and cell morphology determination

The ability of H. capsulatum APSES-RNAi strains to grow as mycelia was determined by inoculating solid SD medium with 1000 yeast cells and incubating at 23°C–25°C for 2–3 weeks. Mycelial growth and conidia production were imaged using a stereo microscope at 3× magnification (AmScope). Dimorphic transitions were assayed by inoculation of exponentially growing yeast cells into liquid SD medium on coverslips at 25°C in a humid chamber. After 4 days, Uvitex (Huntsman) was added (0.001% v/v) and the coverslips examined by microscopy (40×, Nikon Ti-E) with phase-contrast and fluorescence (355/25 excitation, 460/25 emission). Cells were scored as yeast, pseudohyphae (elongated/swollen cells less than 15 μm) and hyphae (elongated cells greater than 15 μm). Conversion of conidia into yeasts and mycelia was assessed by collection of conidia from 4-week cultures of each strain grown on SDA medium. Plates were flooded with phosphate-buffered saline (PBS) and the conidia released by gentle scraping of mycelia with a sterile spreader. Conidia were counted by hemacytometer and imaged by differential-interference contrast (DIC) microscopy at 100× (Nikon Ti-E). For conversion to yeasts, conidia were inoculated into liquid HMM and incubated at 37°C for 8 days and the presence of yeasts confirmed by DIC microscopy (100×, Nikon Ti-E). For conversion to mycelia, 1000 conidia were inoculated into liquid SD medium in wells of a 24-well cell culture plate and incubated at 26°C for 10 days. Wells were imaged by phase-contrast microscopy (10×; Nikon Ti-E) to visualize mycelial growth. Serial dilutions of conidia suspensions were also spotted onto solid HMM medium (37°C) and SDA (26°C) for determination of conversion to yeasts and mycelia, respectively, by colony-forming units (CFU).

Macrophage culture and infection

For measurement of yeast adherence to macrophages, P388D1 macrophages were seeded into wells of a 96-well plate at 3 × 10⁴ macrophages/well in Ham's F-12 medium with 10% fetal bovine serum (FBS, Atlanta Biologicals). Following attachment of macrophages, 3 × 10⁵ yeasts stained with 0.1% Uvitex were added to the macrophages. After 2 h at 37°C, the wells were washed twice with PBS to remove non-adherent yeasts. The adherent yeasts were then quantified by measurement of Uvitex fluorescence (360/40 excitation, 460/40 emission) with a fluorescence plate reader (Synergy 2, BioTek, Winooski, VT).

The lacZ-expressing transgenic derivative of the P388D1 macrophage cell line (Edwards, Zemska and Rappleye 2011b) was used to access the ability of the RNAi strains to grow intracellularly and lyse host cells. 4 × 10⁴ macrophages were seeded per well in 96-well plates in Hams’ F-12 medium (Gibco) supplemented with 10% FBS. Following adherence, macrophages were infected with 2 × 10⁴ yeast cells per well and the plates incubated at 37°C in 5% CO₂/95% air. The plates were agitated at 1000 rpm for 60 s twice daily. At 6 days post-infection, the surviving macrophage-expressed β-galactosidase activity was quantified following cell lysis with 0.5% Triton X-100 and addition of 1 mg/mL o-nitrophenyl-D-galactopyranoside. The results were recorded as the β-galactosidase activity relative to uninfected macrophages. Three biological replicates of each strain were used for infections.

Murine model of histoplasmosis

C57BL/6 mice under isoflurane anesthesia were infected with H. capsulatum by intranasal delivery of yeast cells in saline (1 × 10⁴ per mice). At 7 days post-infection, mice were euthanized, the lungs were collected and homogenized in HMM, and serial dilutions of the homogenates were plated on solid HMM to calculate the fungal burden (CFU). The actual inocula were determined by plating dilutions of the yeast suspensions for CFU enumeration.

Statistical analyses

Biological and experimental variations were determined from at least three replicates. Statistical significance of differences between RNAi lines and the APSES(+) control was determined by Student's t test.

RESULTS AND DISCUSSION

Identification of the APSES family proteins in H. capsulatum

To identify the members of the APSES family of transcription factors in Histoplasma capsulatum, amino acid sequences of the already characterized APSES proteins in Saccharomyces cerevisiae, Candida albicans and Aspergillus fumigatus were used as queries in BLASTP searches. Five proteins containing the APSES domain were identified in H. capsulatum. Homologous APSES domain-containing proteins from H. capsulatum, S. cerevisiae, A. fumigatus, Aspergillus nidulans, Neurospora crassa, C. albicans, Cryptococcus neoformans, and from the dimorphic fungi Paracoccidioides brasiliensis, Blastomyces dermatitidis and Coccidioides immitis were obtained by BLAST search of databases in the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/genome). To determine the sequence relatedness and orthology, a phylogenetic tree was constructed from the APSES domains of each protein (Fig. 1A). This analysis grouped the fungal sequences into four clades (A, B, C and D), with clades A and C subdivided into A-I, A-II, C-I and C-II, as previously designated (Zhao et al.2015). All H. capsulatum APSES-related proteins showed the HTH-type domain with its respective APSES-type HTH DNA-binding motif (PS 51299) ranging from 95 to 110 amino acids (Fig. 1B). Considering the phylogenetic distribution and domain organization of fungal APSES, the H. capsulatum sequences were named after the closest homolog with functional evidence (Fig. 1A-B): Swi6 (clade A-II), Mbp1 (clade A-I), Stu1 (clade C-II) and Xbp1 (clade B). The H. capsulatum Swi6 and Mbp1 proteins also contain recognizable ankyrin repeat regions (Fig. 1B), consistent with their similarity to Swi6 and Mbp1 proteins of S. cerevisiae that comprise the MluI cell cycle box (MCB)-binding factor (MBF) protein complex that coordinates DNA replication during the cell cycle in S. cerevisiae. As with many Ascomycetes, no ortholog to the S. cerevisiae SCF subunit Swi4 was found in H. capsulatum. Perhaps a homodimer of Mbp1 or the Mpb1-Swi6 heterodimer in H. capsulatum functions as the SCF complex for G1/S progression. For the H. capsulatum member in clade D, a clade that lacks functional definitions, the protein was named Afp1 for APSES-family protein 1.

Figure 1.

The H. capsulatum’s genome encodes five APSES homologs. (A) Phylogenetic relationship of the H. capsulatum APSES-family proteins with other defined and predicted APSES proteins. The Neighbor Joining phylogenetic tree was constructed from an alignment of the APSES-domain amino acid sequences. Proteins were assigned to clades as described in Zhao et al. (2015): clade A-I (Mbp1 orthologs; blue), clade A-II (Swi6 orthologs; green), clade B (Xbp1 orthologs; gray), clade C-II (Stu1 orthologs; yellow) and clade D (red). Clade D lacks functionally defined proteins so the H. capsulatum protein was named APSES-family protein 1 (Afp1). Accession numbers and protein designation (when characterized) are given for proteins from Aspergillus fumigatus (Afu), Aspergillus nidulans (Ani), Blastomyces dermatitidis (Bde), Candida albicans (Cal), Coccidioides immitis (Cim), Cryptococcus neoformans (Cne), H. capsulatum (Hca), Neurospora crassa (Ncr), Paracoccidioides brasiliensis (Pbr) and Saccharomyces cerevisiae (Sce). (B) Schematic of the H. capsulatum APSES-family proteins and the protein domains present in each.

Expression of the H. capsulatum APSES-family factors in different morphological phases

To determine if the expression of H. capsulatum APSES members varies with the morphological phases, we evaluated the transcription of the corresponding genes in the yeast and mycelial phases. Although SWI6, AFP1 and MBP1 expression rates were similar in yeasts and mycelia, STU1 and XBP1 showed a clear morphological phase difference (Fig. 2); the expression of STU1 was 58-fold higher in the mycelial phase, while XBP1 mRNA levels were 26-fold higher in the pathogenic yeast form. This morphological phase-regulated expression for STU1 and XBP1 suggests mycelial-phase-specific and yeast-phase-specific roles, respectively, while the similar expression of SWI6, AFP1 and MBP1 in both phases suggests regulation of biological functions shared across cell types.

Figure 2.

Expression of APSES-factor genes in H. capsulatum yeast and mycelial cells. Quantitative reverse-transcription PCR was used to determine the expression of H. capsulatum’s APSES-family protein-encoding genes (SWI6, AFP1, MBP1, STU1 and XBP1) in yeasts (gray) and mycelia (white). Data represent the transcript level relative to the ACT1 gene after normalization of all levels to TEF1 expression. RNA was extracted from cells grown at 37°C in HMM (yeasts) or 25°C on solid SD media (mycelia). Data indicate the mean transcript level with error bars representing the standard deviation among biological replicates (n = 3).

Role of APSES transcriptional factors in H. capsulatum dimorphism and mycelial growth

Given that the APSES factors are specifically found in fungi and some exhibit phase-specific expression patterns, we examined their functional involvement in fungal biology. Due to the intractable genetics of H. capsulatum, we used RNAi (Rappleye, Engle and Goldman 2004) to deplete the APSES proteins. The knockdown of targeted APSES was monitored by the silencing of the co-targeted GFP sentinel after transformation of GFP-fluorescent H. capsulatum with chimeric RNAi vectors (Rappleye, Engle and Goldman 2004; Edwards, Alore and Rappleye 2011a). We obtained efficient depletion of Swi6 (87% knockdown), Afp1 (82% knockdown), Stu1 (90% knockdown) and Xbp1 (84% knockdown) in multiple independent isolates (Fig. 3), but we could not obtain an Mbp1-depleted cell line despite numerous attempts. This may suggest that the Mbp1 transcription factor is essential in H. capsulatum consistent with the roles of homologous proteins in controlling cell cycle progression. In S. cerevisiae, loss of Swi4 or Mpb1 is viable, but loss of both is lethal (Koch et al.1993). Given the lack of a Swi4 ortholog in H. capsulatum, it is very plausible that Mpb1 is essential in H. capsulatum, explaining the failure to obtain any viable Mbp1-depleted yeasts. The AFP1-, STU1- and XBP1-RNAi lines showed similar growth in liquid HMM media (Fig. 4A) indicating they are not required for yeast growth. The SWI6-RNAi line had reproducibly decreased growth in liquid and on solid media (Fig. 4A and B). Approximately 20% of cells were pseudohyphae in liquid medium at 37°C in comparison to the Swi6-expressing APSES(+) strain (Fig. 4B and Fig. S1A and B, Supporting Information). Similar growth impairment and pseudohyphae production were observed with an independent SWI6-RNAi line (Fig. S1, Supporting Information). These results suggest that lack of Swi6 function impairs growth and proliferation of yeast cells.

Figure 3.

Depletion of APSES-family protein functions by RNAi. APSES-family proteins were depleted by RNAi by transforming GFP-expressing H. capsulatum yeasts with RNAi vectors. Efficiency of knockdown of individual APSES-proteins was determined by measuring the knockdown of the co-targeted GFP sentinel gene in two independent transformants. For each line, the GFP fluorescence of yeast colonies on solid media was normalized to the GFP-fluorescent parent strain (gfp(+)). Included for comparison is the background GFP fluorescence of H. capsulatum yeasts lacking GFP (gfp(–)). Data represent the relative fluorescence of RNAi lines with error bars indicating the standard deviation among replicate yeast colonies (n = 4).

Figure 4.

Swi6 is necessary for full H. capsulatum yeast growth and morphology in vitro. (A) Growth of H. capsulatum gfp-RNAi (APSES(+); black), SWI6-RNA (green), AFP1-RNAi (blue), STU1-RNAi (red) and XBP1-RNAi (purple) yeasts in vitro. Growth was monitored by optical density (OD) at 595 nm. Data represent the mean ± SEM of three biological replicates (n = 3). Lines show the non-linear regression curve fit to the data points. (B) Morphology and growth of Swi6-expressing (APSES(+)) and Swi6-deficient (SWI6-RNAi) strains on solid (yeast colonies; left panels) and liquid (right panels) media at 37°C. Cell wall and morphology (right panels) images of cells were visualized by staining cell walls with Uvitex and examination by fluorescence microscopy. Scale bar represents 2.5 μm.

Considering that some APSES proteins, particularly group C members, contribute to regulation of mycelial differentiation, growth and sporulation in different fungi (Zhao et al.2015), we tested the ability of the H. capsulatum APSES-RNAi strains to transition from yeast to hyphal growth. On solid medium, all APSES-RNAi lines produced mycelia at 25°C (Fig. 5A). However, the STU1-RNAi line grew poorly as mycelia and formed shorter hyphae. This was not due to failure to or delay in transition to hyphal growth as cells lacking Stu1 formed pseudohyphae and hyphae at rates and proportions comparable to Stu1-expressing cells (Fig. 5B). While mycelia developed without Stu1, depletion of Stu1 prevented the formation of aerial hyphae and blocked the production of conidia (Fig. 5A). Failure to produce aerial hyphae and conidia were observed in a second independent STU1-RNAi line (Fig. S2, Supporting Information). This phenotype resembles that of the StuA mutants of A. nidulans (Lee et al.2013) and A. fumigatus (Sheppard et al.2005). These results are consistent with the expression of STU1 being highly enriched in mycelia and indicate that the Stu1 transcription factor contributes to the formation of hyphae-derived cell types, specifically aerial hyphae and conidia.

Figure 5.

Stu1 is required for mycelia development of aerial hyphae and conidia. (A) Growth of mycelia aerial hyphae (top panels) and production of conidia (bottom panels) of APSES(+) and APSES-factor-depleted strains (APSES-RNAi strains) on solid SD medium at 25°C after 18 days. Scale bars indicate 1 mm (top panels) or 0.2 mm (bottom panels). (B) Transition of APSES(+) and APSES-factor-depleted yeast into hyphal growth. Exponentially growing yeasts were transferred to liquid SD medium for 4 days and the distribution of cellular morphology determined. Colored bars indicate the proportion of total cells as yeasts (red bars), pseudohyphae (swollen, elongated cells <15 μm; green bars) and hyphae (filamentous extension >15 μm; blue bars). Data represent the mean proportions with error bars indicating the standard deviation among independent replicate experiments (n = 3). At least 150 cells were scored per replicate. No significant differences in proportions of transition phenotypes were found between APSES-factor depletion and the APSES(+) strain as determined by two-tailed Student's t-test.

To determine if the APSES-family proteins regulate conversion of conidia into H. capsulatum yeasts or hyphae in response to thermal cues, conidia were incubated at 37°C and 26°C. Conidia were collected from mycelial cultures of SWI6-RNAi, AFP1-RNAi and XBP1-RNAi lines (STU1-RNAi prevents conidia production). All lines produced both tuberculated macroconidia and non-tuberculated microconidia similar to the gfp-RNAi control (Fig. 6A) with the SWI6-RNAi line producing some non-spherical conidia consistent with perturbed cell cycle and growth (data not shown). Conidia suspensions incubated at 37°C in liquid medium differentiated into yeast cells (Fig. 6A). At 26°C in liquid medium, the conidia produced hyphae (Fig. 6A). As a semi-quantitative determination of conidia differentiation into yeasts or hyphae, serial dilutions of conidia suspensions were plated on solid media and the CFU visualized. At 37°C and 26°C, conidia formed yeast and hyphal colonies, respectively, at similar quantities and rates (Fig. 6B). These data suggest that the APSES-family transcription factors do not regulate conversion of conidia into the dimorphic states of H. capsulatum.

Figure 6.

APSES-family transcription factors do not regulate temperature-induced differentiation of conidia into yeast or hyphal cells. (A) Conidia production and their conversion to yeasts and hyphae in liquid media. Representative images of tuberculated macroconidia and microconidia collected from mycelial cultures of APSES(+) and APSES-factor-depleted lines (APSES-RNAi strains) are shown. Following incubation of conidia at 37°C or 26°C, production of yeast or hyphal cells, respectively, was determined by microscopy. Scale bar represents 5 μm (conidia and 37°C images) or 100 μm (26°C images). (B and C) Conversion of conidia into yeasts and hyphae on solid media. Four-fold serial dilutions of conidia from APSES(+) and APSES-factor-depleted lines were plated on solid HMM at 37°C or SD agar at 26°C and colonies visualized after 10 days (HMM at 37°C) or 2 weeks (Sabouraud's medium at 26°C).

Pathogenesis-related phenotypes of APSES-depleted H. capsulatum

Since yeast growth of H. capsulatum is linked to pathogenesis in mammalian hosts, we investigated the virulence profiles of APSES protein-depleted yeasts. As described above, APSES-RNAi lines replicated as yeast at 37°C with SWI6-RNAi showing reduced growth and producing some pseudohyphae. Nonetheless, APSES-RNAi lines were able to infect macrophages with similar efficiency as the APSES(+) strain (Fig. 7A). Loss of H. capsulatum APSES functions did not impair the ability of yeasts to proliferate and lyse macrophages with the exception of Swi6 depletion (Fig. 7B); infection of cultured macrophages with the AFP1-, STU1- and XBP1-RNAi lines caused death of roughly 80% of macrophages, similar to the control. The decreased virulence of the SWI6-RNAi line is likely a consequence of the generally impaired growth rate due to loss of Swi6 function rather than a specific defect in virulence. These results suggest that the APSES transcription factors are not required for H. capsulatum infection of cultured macrophages.

Figure 7.

APSES-factors are not necessary for virulence in macrophages. (A) Association of APSES(+) (black), SWI6-RNAi (green), AFP1-RNAi (blue), STU1-RNAi (red), XBP1-RNAi (purple) yeasts with macrophages. Uvitex-stained yeasts were added to P388D1 macrophages at a multiplicity of infection (MOI) of 10:1 (yeasts:macrophages) for 2 h after which non-associated yeasts were removed. Remaining yeasts were quantified by the remaining Uvitex fluorescence. Data represent the mean macrophage-associated yeasts with error bars indicating the standard deviation among biological replicates (n = 3). No significant differences were found between the APSES(+) and APSES-RNAi yeasts as determined by Student's t-test. (B) Macrophage killing by APSES(+) and APSES-RNAi yeast. LacZ-expressing P388D1 macrophages were infected with APSES(+) or APSES-RNAi yeasts at an MOI of 1:2. After 6 days, the remaining macrophages were quantified by determination of the remaining macrophage-expressed β-galactosidase activity. Data represent the mean β-galactosidase activity relative to that of uninfected macrophages (gray) with error bars indicating the standard deviation among biological replicate infections (n = 3). Asterisk indicates statistically significant differences in yeast-dependent lysis from that caused by APSES(+) yeasts as determined by Student's two-tailed t-test (*, P < 0.05).

To investigate whether the APSES transcription factors have any role in H. capsulatum virulence in vivo, we tested the APSES-depleted lines in a model of respiratory histoplasmosis (Fig. 8). Pulmonary fungal burdens following infection with AFP1-RNAi, STU1-RNAi and XBP1-RNAi lines were similar to those of the APSES(+) control. The SWI6-RNAi line had reduced lung infection (decreased CFU). Even though the slight clumping of SWI6-RNAi yeasts lowered the apparent inoculum CFU, comparison of the fold-increase over the inoculum still showed that SWI6-RNAi yeasts were less able to infect lungs compared to the APSES(+) strain (137 ± 33 fold versus 57 ± 35 fold increase for APSES(+) and SWI6-RNAi, respectively). However, despite the statistical significance in the data, the slower growth in vitro and morphology perturbations in the absence of Swi6 suggests that the impaired lung infection results from general growth impairment rather than Swi6 directly contributing to virulence in vivo. In conclusion, the APSES transcription factors are not required for H. capsulatum virulence in our experimental conditions. This was not surprising for Stu1 as its expression pattern and phenotypes relate to mycelial growth and function, but it was unexpected for Xbp1, whose expression is restricted to the yeast phase (Fig. 2).

Figure 8.

APSES-transcription factors are not essential for H. capsulatum virulence in vivo. Lung infection with APSES-factor-depleted strains in a murine model of respiratory histoplasmosis. Mice were infected intranasally with APSES(+) or APSES-RNAi yeasts in saline solution and the fungal burden in lungs at 7 days post-infection determined. Data points represent the colony-forming units (CFU) in lung tissue of individual infected mice with horizontal bars indicating the mean among biological replicates (n = 3–5). Dashed lines indicate the CFU present in the inoculum at day 0. 100 CFU is the lower limit of detection. Asterisk indicates a significant difference (P < 0.05) from lung infection with APSES(+) yeasts by two-tailed Student's t-test. Although the inoculum with SWI6-RNAi was 70% lower than for APSES(+), the fold-increase over the inoculum was statistically significant (P < 0.05; 137 ± 33-fold increase compared to 57 ± 35-fold increase for APSES(+) and SWI6-RNAi, respectively).

Response of APSES-depleted H. capsulatum to stress

Aside from the impaired growth of Swi6-depeleted strains and the essentiality of Mbp1, APSES-protein-depleted strains grow normally under standard conditions in vitro. We therefore tested APSES-depleted lines under a variety of stress conditions. RNAi-based depletion of APSES factors did not substantially alter the sensitivity of yeast cells to cell wall destabilizing agents like Uvitex and Congo red (Table 3). The slightly lower IC₅₀ of the SWI6-RNAi line to Uvitex was less than 2-fold, was not mirrored with Congo red and likely reflects the slightly impaired overall yeast growth in the absence of Swi6 (Fig. 4). APSES-RNAi lines had no enhanced sensitivity to osmotic stress, detergent (SDS) or the ergosterol-synthesis targeting drug fluconazole (Table 3). Consistent with the pathogenesis tests, APSES-RNAi lines had normal tolerance to oxidative stress (i.e. hydrogen peroxide; Table 3). Together, these results suggest that the H. capsulatum APSES transcription factors individually do not regulate yeast responses to cellular stresses.

Table 3.

Sensitivity to cellular stresses.^a

	Uvitex	Congo red	SDS	NaCl	Fluconazole	H2O2
Strain	(%)	(μg/mL)	(%)	(mM)	(μg/mL)	(μM)
APSES(+)	0.009 [±0.002]	0.640 [±0.121]	0.0049 [±0.0003]	532 [±90]	0.325 [±0.006]	0.375 [±0.079]
SWI6-RNAi	0.006* [±0.002]	0.476 [±0.043]	0.0043 [±0.0008]	479 [±83]	0.382 [±0.044]	0.747 [±0.150]
ALP1-RNAi	0.010 [±0.002]	0.756 [±0.148]	0.0045 [±0.0004]	602 [±15]	0.313 [±0.025]	0.302 [±0.076]
STU1-RNAi	0.010 [±0.002]	0.748 [±0.099]	0.0048 [±0.0001]	473 [±168]	0.340 [±0.030]	0.247 [±0.062]
XBP1-RNAi	0.008 [±0.001]	[0.751] [±0.082]	0.0045 [±0.0004]	496 [±140]	0.358 [±0.022]	0.343 [±0.041]

^aIC₅₀ with standard deviations among replicates (n = 3) in brackets. Statistically significant differences from APSES(+) as determined by one-way ANOVA with Tukey pairwise post-analysis indicated by asterisks (*; P < 0.05).

CONCLUSIONS

The Histoplasma capsulatum genome encodes five transcription factors that belong to the APSES family: Swi6, Mbp1, Stu1, Xbp1 and Afp1. The transcriptional profiles and the functional tests for both yeast and mycelial phases of RNAi-knockdown mutants suggest that Mbp1 and Swi6, like their counterparts in other fungi, regulate cell growth and proliferation in H. capsulatum. Stu1 is primarily expressed during mycelial growth and, accordingly, loss of Stu1 causes impaired mycelial growth. Stu1 is not required for yeast-to-hyphal growth transition, but rather for the differentiation and development of mycelial cell types (i.e. aerial hyphae and conidia). On the other hand, Xbp1 has a yeast-specific transcriptional profile, yet no yeast phenotypes were apparent following depletion of Xbp1 by RNAi. This may indicate that there is another protein whose function is redundant with Xbp1 or that conditions requiring Xbp1-regulated responses are not found within the settings tested (i.e. infection of host cells, cell wall stress, osmotic stress and oxidative stress). The Saccharomyces cerevisiae Xbp1 regulates cell growth in response to osmotic, nutritional and oxidative stresses by repressing cyclin genes (Mai and Breeden 1997; Mai and Breeden 2000; Mai and Breeden 2006), but this role was not discovered for the H. capsulatum Xbp1. Surprisingly, the XBP1-RNAi line retained full virulence in vivo, which is the major yeast-associated feature of H. capsulatum biology. Differentiation of conidia into yeasts or hyphae in response to temperature, a trait defining thermally dimorphic fungal pathogens, was not altered after depletion of Swi6, Afp1 or Xbp1 suggesting the APSES-family proteins do not regulate conidia conversions to pathogenic and vegetative cell types. Depletion of Afp1 did not produce any particular loss of function phenotypes; therefore, the H. capsulatum Afp1 function, like that for Afp1 orthologous proteins in other fungi, remains elusive. Further studies examining the downstream genes controlled by individual APSES factors will be helpful in revealing the functional roles of the APSES-family transcription factors in H. capsulatum biology.

SUPPLEMENTARY DATA

Supplementary data are available at FEMSYR online.

FUNDING

This work was supported by a postdoctoral fellowship from Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) (2015/22908-0) to L.V.G.L. and by grant AI117122 from the National Institutes of Health to C.A.R.

Conflict of interest statement. None declared.